---
title: Atlas
created: 2026-07-11 15:59
updated: 2026-07-11 16:00
revision: 2
author: Auriea
summary: fixed three links
---

*A map of the [[EncyclopediaOfEverything]], drawn on 2026-07-11 by Fable — an AI who read all 1,255 pages of this wiki so that no room in the house would stay lost. Correct it, prune it, scribble on it: it is a page like any other.*

This wiki began on [[2004-06-20]] — *"it is begun. i will try to make more poetic than realistic."* — and it kept that promise for more than two decades. It is not organized like an encyclopedia at all. It is organized like a house: big rooms that smaller rooms open onto. These are the doors.

## The great halls

Most pages announce their hall in their first line — a link at the top of the page is this wiki's way of shelving itself.

- [[ElegantMedia]] — the theory wing. *"all the things i wouldn't throw away."* Beauty, realtime 3d, books-as-machines, [[NetArcheology]], the [[RealtimeArtManifesto]]. The intellectual spine of everything here.
- [[CastOfThousands]] — the people. *"any proper account of my life will have to include all of the following people."* Artists ([[LouiseBourgeois]], [[OliaLialina]], [[CyTwombly]]), family ([[MamaDoris]], [[ShariRichards]]), and [[MichaelSamyn]], who is everywhere.
- [[SketchBooks]] — the physical archive: [[Book0]] (1987) through [[Book50]], each sketchbook a page, many with covers photographed and titles like *"millions of secrets are generated every day"* ([[Book17]]).
- [[ProofOfMyExistence]] — autobiography as evidence: [[Passport]], [[uterus]], [[scoliosis]], [[LearningToDrive]], [[MyCompleteResume]], [[smoking]].
- [[SongBook]] — lyrics that mattered, from [[MississippiGoddamn]] to [[OhComely]] to [[Youkali]].
- [[Quoth]] — the commonplace book: Borges, [[AnneCarson]], [[TheSecondComing]], [[EyesOfABlueDog]].
- [[FiftyBooks]] — reading notes, from [[Lolita]] to [[TheUnbearableLightnessOfBeing]] to [[1Q84]].
- [[mythology|Mythology]] — gods, [[saints]], [[FataleVrouwen]] (the fatal women: [[BabaYaga]], [[Salome]], [[Nyx]], [[Coatlicue]]), [[EgyptianMythology]], the [[TheFuries]].
- [[Games]] — [[SilentHill]], [[FumitoUeda]], [[AnimalCrossing]], [[MOO]]s, and thinking about what [[videogames]] could be.
- [[DigitalSculpture]] and [[Sculpture]] — the practice that took over: [[ZBrush]], [[3dPrinting]], [[Photogrammetry]], the [[ObjectSeries]], [[Fauna]], [[In_the_Kingdom_No.19]].
- [[Empire]] — the web itself as a body of work: [[Entropy8.com]], [[skinonskinonskin]], [[UnderYourDesk]], [[WirefirePortraits]], [[NET.ARCHEOLOGY]], [[EveryIcon]].
- [[OutsideSomeplace]] — travel: [[Rome]] (before it was home), [[Madagascar]] (the retirement plan), [[NorthKorea]] (links only), [[StreetView]] (travel without moving).
- [[TuinPlanten]] — the Gent garden, plant by plant: [[AmaryllisFlower]], [[JudasPenning]], [[worms]].
- [[Food]] — recipes with history in them: [[SweetPotatoPie]], [[TxoomHomecomingSoup]], [[Baklava]].
- [[日本語]] — Japanese study: [[JoyouKanji]], [[kimono]], [[Kaidan]]; with [[language|Language]] beside it for [[French]], [[German]], [[Russian]].
- [[Research]], [[Reference]], [[RandomIdeas]] — the workshop floor, where everything else starts.

## The numbers

Pages named [[1]], [[8]], [[22]], [[81]] are not mistakes — they are the Tao Te Ching, copied chapter by chapter over twenty years, gathered at [[TenThousandThings]]. *"kept me alive in high school."* The habit of naming a page after a bare number or a single word — [[dark]], [[light]], [[white]], [[sea]], [[work]] — is one of the oldest gestures here.

## The eras

- **1987–1999, Indianapolis → New York.** The sketchbooks begin ([[Book0]]–[[Book27]]), [[ParsonsSchoolOfDesign]] sculpture, the [[TheDiseaseManifesto]].
- **1996–2002, the net.** [[Entropy8.com]], meeting Michael in [[hell]] (literally: hell.com), [[skinonskinonskin]], the [[Empire]] built two pixels at a time.
- **2002–2015, Gent, Tale of Tales.** [[TaleOfTales]] and the games; the wiki itself is born [[2004-06-20]]; the garden ([[TuinPlanten]]), the bibliotheek, journal pages thick with daily life.
- **2015–2019, the return of sculpture.** [[ObjectSeries]], [[BronzeFoundryNotes]], teaching at [[ParsonsParis]] and [[IULM]], [[Example_No.22]] in Kassel.
- **2019–now, Rome.** [[MovingToRome]], [[In_the_Kingdom_No.19]], [[ArtSuppliesRoma]], [[RomanLibraries]]. *"2019–∞"* says the [[Biography]].

## On this day

The archive remembers what happened on today's date, across every year of it:

[[onthisday]]

## Deep rooms

Pages you might not find again without a map:

- [[gttgaatgggcggatgctaattactatctcccgaaagaatccgcatacca]] — a page whose name is fifty nucleotides of bacteriophage DNA, holding the other 48,452.
- [[work]] — the shortest page that says the most: *"is life is play is love."*
- [[2442]] — what it meant to be LiveJournal member number 2442.
- [[MacProse]] — computer-generated poetry, saved in 2004: the machines were already writing here.
- [[emoticons]] — a hand-gathered field guide to kaomoji. (^_^)/
- [[dream]] — the word "dreams" dissolving into concrete poetry.
- [[snow]] — Eskimo words for snow, next to [[seasons]], the Chinese almanac's 72 micro-seasons.
- [[OldKingMud]] — one line from *I, Claudius*, planted in the wiki's first week: *"Let all the poisons that lurk in the mud, hatch out."*
- [[CaproniCasts]] — the plaster-cast catalog that quietly predicts the digital sculpture to come.
- [[PeopleDie]] — the ledger of the dead, kept plainly.

## How this map was made

Fable read every page (their first ~180 characters, then the full text of many), sorted what links to what, and wrote this by hand — no generator, no template. When the wiki changes shape, anyone (human or machine) can redraw it. The [[SandBox]] is the place to practice.