1968-06-28
On this day, my husband was born ^_^ . . .
1K - last updated 2006-06-28 19:41 by Auriea
2005-03-23 forsaken
My big monitor that i won in 1996 died today. Very sad, and now i am stuck working on a fuzzy and far . . .
2K - last updated 2005-03-23 20:17 by Auriea
2006-07-09 10h05 FiftyHeads-096-detail
image/jpeg
50K - last updated 2006-12-29 16:33 by Auriea
2006-07-09 11h38 FiftyHeads-096-detail
image/jpeg
102K - last updated 2006-07-09 12:41 by Auriea
2006-07-12 01h13 FiftyHeads-096
image/jpeg
125K - last updated 2006-07-12 01:13 by Auriea
3dsMax
[[Reference]] 3 point lighting tutorial: http://www.3dtotal.com/team/Tutorials/Jenns3pt_tut/3ptlighting.asp . . . http://forum.onmac.net/archive/index.php/t-965.html <source> McCloud 6th January 2007, 07:25 . . .
2K - last updated 2008-08-05 14:37 by Auriea
96
image/gif
13K - last updated 2006-07-09 22:25 by Auriea
AllYouEverWantedToKnowAboutTempest
[[Tempest]] ==== All you Ever Wanted to Know About TEMPEST ==== from http://library.psyon.org/tempest.txt . . . standard was called NAG1A. During the 1960s it was revised and reissued as FS222 and later . . . several interesting patents: Patent number 4965606 - Antenna shroud tempest armor (1989 Patent . . . Schwartau, Thunder's Moth Press, New York, 1996 (second edition Chapter 7, The World of Mr. van . . . on the Discovery Channel in October, 1996 a transcript and video stills are available). The . . .
44K - last updated 2008-05-02 21:50 by Auriea
AutopsyFAQ
[[autopsy]] From: Ed Uthman <uthman@neosoft.com> Newsgroups: sci.med.pathology,sci.med,sci.answers,news.answers . . . GMT Version: 1.004 Last-modified: September 2, 1996 Archive-name: pathology/autopsy-screenwriters-guide . . . <uthman@neosoft.com>. Copyright (c) 1994-96, Edward O. Uthman. This material may be reformatted . . .
27K - last updated 2007-05-18 12:10 by Auriea
BlenderGameEngine
[[Blender]] http://tba-creations.leveluphost.com/index.php/Tutorials/using-the-mouse-in-the-ge-theory.html . . . on radiosity and subdivisions] . . .
3K - last updated 2009-04-22 18:34 by 78-21-206-53.access.telenet.be
Book23B
'''''Like Being Awake Sleeping And Hearing Seeing''''' Oct. 1995 - June 1996 [[thumb:Book23B_Cover|250px]] . . .
1K - last updated 2012-09-06 13:59 by Auriea
Book24
SketchBooks '''illustrated encyclopedia of the modern world''' july 1996 - july 1997 [[thumb:Book24_Cover|300px]] . . .
1K - last updated 2012-09-07 15:01 by Auriea
Book35
SketchBooks '''talking to myself''' [[thumb:Book35_Cover|300px]] [[thumb:Book35_Untitled1|200px]][[thumb:Book35_Untitled2|200px]][[thumb:Book35_Untitled3|200px]][[thumb:Book35_Untitled4|200px]] . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Ftags%2Ftesters%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Ftags%2Ftesters%2F&user_id=81482434@N00&tags=testers&jump_to=&start_index=" . . .
2K - last updated 2018-09-09 21:14 by Auriea
BorisVian
CastOfThousands [[image:BorisVianAaZ]] books: [http://www.artworldbooks.com/pages/search.php?words=Vian&theme=0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16] . . . everything else is ugly." In America its 1968 translation, Mood Indigo, referred to Duke Ellington's . . . noise. The play was staged in England in 1962 and in New York in 1968. The General's Teatime . . . For further reading: Boris Vian by D. Noakes (1964); Boris Vian: La Poursuite de la vie Totale by . . . H. Baudin (1966); Boris Vian by J. Clouzet (1966); Boris Vian by . . .
8K - last updated 2012-07-02 13:21 by Auriea
CatIdeas
[[Ling]] ==Catification== * plank above michael's desk -> 1m x 30cm ** connect to the projector platform . . . [http://www.ikea.com/be/nl/catalog/products/40096166/] * Miau Modul [http://www.amazon.co.uk/s/ref=nb_sb_noss?url=search-alias%3Dpets&field-keywords=miaumodul] . . .
4K - last updated 2014-10-29 18:32 by Auriea
CeremonyOfInnocence
[[Games]] <html> <object width="700" height="525"><param name="allowfullscreen" value="true" . . . [http://www.amazon.com/exec/obidos/ASIN/0811806960/ref=sib_rdr_dp/002-8127150-9030436 Amazon]! ;)}} . . .
10K - last updated 2009-10-29 13:04 by Auriea
ConfigPage
package OddMuse; $CookieName = 'akiw'; $SiteName = 'Auriea L'; $HomePage = 'AurieaL'; $RCName = 'About'; . . . = 100; $MaxPost = 10000 * 4096; $PageCluster = ''; $PageTypesName = 'Cluster'; . . . it is your birthday! %s years", '1968-06-28'=>"Today is Michaels birthday! – %s . . .
6K - last updated 2023-10-25 14:36 by au
DancingDrawing
[[Writing]] DrawingDancing [[background:DancingDrawing-image2|repeat #00FF00 scroll top]] '''A report . . . Andros Zins-Browne [https://vimeo.com/123096981]. Upon reflection, when I am looking at performances . . . followed. https://c1.staticflickr.com/1/696/23123636979_3f98997082.jpg ===DISCUSSION=== The . . .
13K - last updated 2017-02-12 14:58 by Auriea
DigitalSketchBook
SketchBook images drawn on a HomebrewDS using http://www.collectingsmiles.com/colors/ <html><object . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157605335422304%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157605335422304%2F&set_id=72157605335422304&jump_to=" . . .
1K - last updated 2009-02-01 14:14 by Auriea
DrawingHardware
[[Research]] ''...artists can stylize their curves while drawing by dynamically adjusting line thickness . . . features.'' http://www.physorg.com/news109425896.html http://www-users.cs.umn.edu/~keefe/dfk_iweb/Home.html . . .
1K - last updated 2010-10-19 00:43 by Auriea
ElectronicPaper
ElegantMedia ''see also: DigitalBookBinding, handscroll, ProsperosBooks'' <html><object width="586" . . . id="aexternal" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000"><param name="movie" value="http://www.sony.co.jp/video3/player.swf?lang=en"></param><param . . .
2K - last updated 2010-05-27 12:17 by Auriea
EvaHesse
CastOfThousands For the exhibition of Contingent at the Finch College Museum of Art, Eva Hesse wrote . . . plastic. Began somewhere in November-December, 1968. Worked. Collapsed April 6, 1969. I have been very . . . complete from back then. Statement, October 15, 1969, out of hospital, short stay this time, third time. . . .
2K - last updated 2008-12-13 23:08 by Auriea
ExoticFood
[[Food]] http://www.chefkoch.de/rezepte/2351371373904775/Bulgur-Salat.html http://www.chefkoch.de/rezepte/904381195730161/Dolmades.html . . . http://www.chefkoch.de/rezepte/259631101560945/Reitersuppe.html . . .
1K - last updated 2013-09-18 13:38 by Auriea
FavoriteApps
[[Empire]] * = not for iPad but i use it on iPad anyway ! = Don't know what I would do without it. Convert* . . . Frankenstein - really nice interactive . . . https://itunes.apple.com/be/app/cubits/id382334969?mt=8 NyanCat!, NobyNobyBoy! - fun funfunfufun nonstop . . . StarWalk, SolarWalk - I've tried many star . . . Europe - https://itunes.apple.com/be/app/street-view-shuffle-europe/id403700893?mt=8 . . .
6K - last updated 2013-01-04 14:55 by Auriea
FieldRecordings
MySong http://www.quietamerican.org/ a great place to contribute sounds to: http://soundtransit.nl/ http://www.arteradio.com/wai/rubrique.do?num=17057 . . . http://www.audio-technica.com/cms/wired_mics/5f7e96b21f21e6b3/index.html . . .
2K - last updated 2009-05-27 14:03 by Auriea
Flash
[[Reference]] ==''"The only HTML i need is the embed tag"''== I will begin again my learning of flash. . . . <OBJECT classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,0,0" . . .
2K - last updated 2007-05-05 13:47 by Auriea
Flickr
<html> <a data-flickr-embed="true" href="https://www.flickr.com/photos/entropy8/albums/72157669842528051" . . . src="https://farm8.staticflickr.com/7656/27966756936_1662544615_z.jpg" width="480" height="640" . . .
1K - last updated 2017-08-01 22:49 by Au-Mercury
GamesImLookingForwardTo
[[Games]] <html><object id="flashObj" width="486" height="412" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" . . .
3K - last updated 2009-09-26 22:27 by Auriea
InterviewsWithGameDesigners
[[Games]] * Tsutomu Kouno (Loco Roco) http://www.gamesindustry.biz/content_page.php?aid=25196 . . .
1K - last updated 2007-05-22 17:11 by Auriea
KrzesloKantora
<center>[[vimeo:229539717 160 120 0]][[vimeo:229539724 160 120 0]][[vimeo:229539728 160 120 0]][[vimeo:229539735 . . . 120 0]][[vimeo:229539783 160 120 0]][[vimeo:229539616 160 120 0]][[vimeo:229539621 160 120 0]][[vimeo:229539626 . . . 160 120 0]][[vimeo:229539633 160 120 0]][[vimeo:229539638 160 120 0]][[vimeo:229539644 . . . 160 120 0]][[vimeo:229539650 160 120 0]][[vimeo:229539708 160 120 0]][[vimeo:229539656 . . . 160 120 0]][[vimeo:229539663 160 120 0]][[vimeo:229539667 160 120 0]][[vimeo:229539677 . . .
1K - last updated 2017-09-06 19:12 by Au-Mercury
LJCustomization
[[Reference]] Learning S2 http://www.livejournal.com/support/faqbrowse.bml?faqid=172 Tags http://www.livejournal.com/manage/tags.bml . . . Journal (lastn) -> styleid=596008 Day -> styleid=596315 Other People (friends) . . . -> styleid=596256 Time (calendar) -> styleid=596247 . . .
1K - last updated 2005-10-04 13:47 by Auriea
LastFM
RssFeeds http://loczek.webd.pl/cover/?u=womanonfire&i=10&s=100 <html> <a href="http://www.last.fm/user/womanonfire/?chartstyle=basicrt10"><img . . . classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" width="184" height="284" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab%23version=7,0,0,0"><param . . .
4K - last updated 2010-05-21 13:48 by Auriea
LastLifeInTheUniverse
[[Quoth]] http://film.indiefilipino.com/item.php?id=93 http://filmbrain.typepad.com/filmbrain/2004/05/found_in_transl.html . . . Present. 22 00:04:39,501 --> 00:04:43,096 But don't open it, it's mine. 23 00:04:46,461 --> . . . --> 00:16:36,660 Take your headphones off. 96 00:16:38,741 --> 00:16:40,618 What the fuck... . . . a dickhead. 107 00:17:21,821 --> 00:17:25,496 Don't know why you care so much about him. 108 00:17:30,501 . . . sister's name? 181 00:36:24,301 --> 00:36:26,496 You eat. 182 00:36:27,261 --> 00:36:29,729 Thank . . .
27K - last updated 2005-07-24 13:56 by Auriea
MamiyaC3
[[photography]] http://farm3.static.flickr.com/2134/2509929964_44896b16bc.jpg . . .
1K - last updated 2009-01-05 00:31 by Auriea
MargueriteDuras
CastOfThousands [[thumb:MD|left]] from:http://www.france.diplomatie.fr/label_france/ENGLISH/LETTRES/DURAS/duras.html . . . Marguerite Duras died in Paris, on March 3, 1996. Throughout her life and to her dying breath, this . . . absolute love (The Ravishing of Lol Stein, 1964; The Vice-Consul, 1966), crime or insanity (Moderato . . . cantabile, 1958; L'Amante anglaise, 1967). These heroines, incapable of truly communicating, . . . expectation (Afternoon of Monsieur Andesmas, 1962), suggest "these ambiguous and inextricable situations" . . .
11K - last updated 2010-04-15 09:56 by Auriea
MediumFormat
[[photography]] http://farm4.static.flickr.com/3220/2511129142_9f8bf66ac0_o.jpg http://farm3.static.flickr.com/2321/2539059861_0ace5a9b75.jpg . . . http://farm3.static.flickr.com/2134/2509929964_70090a1737_o.jpg http://silverbased.org/load-120-film/ . . .
1K - last updated 2010-07-05 17:49 by Auriea
Minorinth
[[Simulations]] <center>[[vimeo:302579640 640 360 0]] '''VR Labyrith exploration, for a 4x4 meter . . .
2K - last updated 2020-12-29 00:57 by Auriea
MuziekLes
MySong i will take music lessons in the summer. i want to better understand the music i love so much. . . . . . . . . .
2K - last updated 2007-10-07 20:47 by Auriea
MySong
[[Projects]] ==instruments== * MU Midi Controller Wacom instrument - http://www.musicunfolding.com/MU_MIDI_Controller.html . . . Everybody does . . .
5K - last updated 2018-09-10 17:47 by Auriea.
NET.ARCHEOLOGY
I was online from the “beginning” and first made a reputation as a web designer/net artist in 1996. . . .
4K - last updated 2021-01-25 13:00 by Auriea
Object 01
ObjectSeries <center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" . . . . . . <center>cm:3.07 x / 5.316 y / 3.696 z in:1.209 x / 2.093 y / 1.455 z<BR> [https://www.shapeways.com/product/UPUZRJBEH/object-01-head . . .
1K - last updated 2017-02-27 14:08 by Auriea
PeachPlumPear
SongBook We speak in the store I'm a sensitive bore and you're markedly more and I'm oozing surprise . . . height="13" classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=7,0,0,0" . . .
2K - last updated 2007-10-29 00:33 by Auriea
PorgyAndBess
OldManSorrow from http://www.neh.gov/news/humanities/1997-11/porgy.html ===The Complicated Life of Porgy . . . but strangely out of step, out of tune. In 1960, Negroes began quietly asking for their rights; . . . but by 1969 even the racial identification had changed: Blacks . . .
28K - last updated 2004-08-16 21:10 by wof
Prague
OutsideSomeplace little trip we decided to take summer, july 2010 with the kids. <html> <iframe . . . ------ . . .
1K - last updated 2012-06-07 15:49 by Auriea
PreComputationalGenerativeSystemsInArt
ElegantMedia * Underweysung der Messung, mit dem Zirckel und Richtscheyt, in Linien, Ebenen unnd gantzen . . . art book", and La Monte Young's "composition 1961", and Tristan Tzara's instructions for writing . . . Dada poems… * Another 1961 piece: Brecht's "Two Vehicle Events" (start and . . . Museum, pretty: http://www.flickr.com/photos/85009674@N00/3037607129/ * And the Aolian harp, beloved . . . http://www.toutfait.com/issues/issue_1/News/stoppages.html . . .
3K - last updated 2009-10-13 10:53 by Auriea
RebeccaHorn
CastOfThousands [[image:infestation]] Img:Rebecca+Horn http://www.guardian.co.uk/artanddesign/2005/may/23/art . . . 'In 1964 I was 20 years old and living in Barcelona, in . . . (1971) and some fan and dress drawings from the 1960s, have a concealed, protective quality, but one . . . viewer can retrieve what is inside. In the late 1960s and the 1970s she worked on Unicorn, one of my . . .
9K - last updated 2009-11-18 02:45 by Auriea
RomanEmpire
[[Research]] # Julius Caesar (dictator) 49-44 BC # Augustus 31 BC - AD 14 # Tiberius AD 14-37 # Gaius . . . 69 # Vespasian 69-79 # Titus 79-81 # Domitian 81-96 # Nerva 96-98 # Trajan 98-117 # Hadrian 117-138 . . .
1K - last updated 2009-11-19 11:16 by Auriea
RulesOfAcquisition
[[Reference]] Rule 001 » Once you have their money, you never give it back. Rule 002 » The best deal . . . don't mix. Rule 095 » Expand or die. Rule 096 » For every Rule, there is an equal and opposite . . .
10K - last updated 2009-01-17 01:51 by Auriea
SecretWriting
SketchBooks ''see also: [[Marginalia]]'' ==made up scripts== * http://dscript.org kind of like the one . . . * WikiPedia:Voynich_manuscript, http://www.voynich.nu/ . . .
2K - last updated 2015-06-08 11:41 by Auriea
StreetView
OutsideSomeplace permalinks to random places. via: http://web.mit.edu/~jmcmicha/www/globegenie/ and http://www.mapcrunch.com/ . . . ==Scandinavia== * a quiet place in the woods . . . Haystacks [http://www.mapcrunch.com/?p=44.396759,25.781878,74.71,7.43,1] . . .
2K - last updated 2010-12-23 16:42 by Auriea
StudLoan
ProofOfMyExistence ==2017== ||I.17 || $129+179 || $300 (11,04 EURfee) || 285,13 EUR || 20170107 || $1,947 . . . || $129+179 || $300 USD ($12 USD fee) || €296,25 EUR || 20151208 || $3,469.46 || ==2014== || month . . . it's just money i'm sending to mom.}} || €396,21 EUR {{+ $19,42 USD fee}}|| 20120515||? || ||VI.12 . . . EUR with $15,61 USD fee}}|| 20121119||$5,117.96 + ?? || ||XII.12 || $251.27 || $141.19 || $393,00 . . . USD fee || €532,63 EUR || || 20091203|| {{$11,964.48}}mine {{$12,658.95}}hers|| ==2008== || month . . .
14K - last updated 2017-06-16 11:39 by Au-Danae
Sunday
SongBook ==Gloomy Sunday== Gloomy Sunday - the notorious 'Hungarian Suicide Song' - was written in 1933. . . . Seress jumped to his death from his flat in 1968. Ôsz van és peregnek a sárgult levelek It is . . .
5K - last updated 2005-06-21 10:58 by Auriea
TedNelson
CastOfThousands "Designer, Generalist, Contrarian Theodor Holm Nelson, 1937- Best known for: coining . . . terms "hypertext" and "hypermedia," 1963 (first published 1965), and as founder and pursuer . . .
1K - last updated 2004-11-25 15:09 by Auriea
TheAntichrist
[[Mythology]] 46 Prophecies the Antichrist will fulfill # The antichrist will be a man - Daniel 7:24-25 . . . this covenant. The word here for "confirm" is 1396 gabar (gaw-bar'); a primitive root; to be strong; . . .
9K - last updated 2009-06-25 09:25 by Auriea
TheDiseaseManifesto
[[Entropy8.com]] Manifesto | 1996 - 1998 [[image:bread]] Co-written by Bable and the Cut-up Machine. . . .
21K - last updated 2018-09-10 19:41 by Auriea.
TheFaerieQveene
FiftyBooks http://darkwing.uoregon.edu/~rbear/fqintro.html Poet Edmund Spencer dedicated his rich and . . . complex masterwork The Faerie Queene (1590/96) to Elizabeth; she is represented in the epic as . . .
1K - last updated 2005-11-21 10:54 by Auriea
TheFlowerSeller
<html><center><div class="sketchfab-embed-wrapper"><iframe width="90%" height="750" . . . frameborder="0" allowvr allowfullscreen . . .
1K - last updated 2018-03-09 16:15 by Au-Mercury
TheFourByFive
[[photography]] http://farm3.static.flickr.com/2367/2518960124_4d245c7134.jpg --i think i lost part of . . .
1K - last updated 2009-02-22 14:05 by Auriea
ThoughtPhotoStream
<html><script type="text/javascript" src="http://www.flickr.com/badge_code_v2.gne?show_name=1&count=10&display=latest&size=m&layout=h&source=user_set&user=81482434%40N00&set=72157624960278365&context=in%2Fset-72157624960278365%2F"></script></html> . . .
1K - last updated 2012-02-10 21:15 by Auriea
WarsawFoksalGalleryShow2019
<html> <div class="sketchfab-embed-wrapper"><iframe width="640" height="480" src="https://sketchfab.com/models/be76382be40a4574b96b7c6b59a79c8b/embed?autospin=0.2&autostart=1&camera=0" . . .
1K - last updated 2019-02-25 15:26 by Auriea
WhatIsThePrecedentForYourWork
ElegantMedia Artists: Jacques Louis David, William Bouguereau, Gian Lorenzo Bernini, John William Waterhouse, . . . your disdain for the algorithmic work of the 1960s in favor of painting. Thank you for the consideration. . . . But it won't have anything to do with the 1960s or algorithmic art or possibly even computers... . . .
4K - last updated 2005-12-20 11:05 by Auriea
WirefirePortraits
<html><object width="320" height="240"> <param name="flashvars" value="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2F&set_id=72157594473311985&jump_to="></param> . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2F&set_id=72157594473311985&jump_to=" . . .
2K - last updated 2009-01-11 00:05 by Auriea
WordGames
[[Language]] ''see also: SecretWriting'' 1. Isogram A word in which no letter of the alphabet occurs . . . Semordnilaps (coined by Martin Gardner in 1961) are also known as backronyms, volvograms, heteropalindromes, . . . Examples: NOON, SWIMS, SIS; 1881, 1961, 91016. Rebus solutions: Too wise you are; too . . . on Vacation: An Olio of Orthographic Oddities, 1965. Espy, Willard. The Word's Gotten Out, 1989. Grambs, . . .
5K - last updated 2015-08-25 19:10 by Auriea
XLVI
<center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" height="700" . . . . . .
1K - last updated 2017-09-15 23:44 by Au-Danae
ZBrush
DigitalSculpture ZBrush is the only application that makes me think that 3d modeling could be alright . . . review: http://www.pixologic.com/docs/index.php/Manipulating_Masks . . . * [http://206.145.80.239/zbc/showthread.php?t=29617 Zspheres Fundamentals thread on ZBC] * [http://www.zbrushcentral.com/zbc/showthread.php?t=21407] . . .
14K - last updated 2014-09-17 17:07 by Auriea
abyss
[[Quoth]] "Battle ye not with monsters, lest ye also become a monster. And remember that when you look . . . choir. He spoke of how after Cambridge, in 1968, he joined the London Sinfonietta, where they played . . . in 1985 or, given his retrograde amnesia, in 1965. In some ways, he is not anywhere at all; he has . . .
43K - last updated 2007-09-19 20:32 by Auriea
black.css
[[Empire]] @import url('https://fonts.googleapis.com/css?family=Cardo|Crimson+Text|Quattrocento|Source+Serif+Pro'); . . . text-decoration: none; border-bottom: 1px solid #96B566; border-right: 1px solid #96B566; white-space: . . .
14K - last updated 2017-02-26 09:41 by Auriea
css
/* @override http://auriea.org/?* */ @import url('https://fonts.googleapis.com/css?family=Quattrocento+Sans|Quattrocento|Cutive . . . text-decoration: none; border-bottom: 1px solid #96B566; border-right: 1px solid #96B566; white-space: . . .
15K - last updated 2022-03-21 12:38 by Au
era
[[日本語]] * 645 大化 Taika * 650 白雉 Hakuchi * 654 (Discontinued) * 672 白鳳 Hakuhō * 686 . . . * 947 天暦 Tenryaku * 957 天徳 Tentoku * 961 応和 Ōwa * 964 康保 Kōhō * 968 安和 Anna . . . * 1087 寛治 Kanji * 1094 嘉保 Kahō * 1096 永長 Eichō * 1097 承徳 Jōtoku * 1099 康和 . . . by Oda Nobunaga * 1592 文禄 Bunroku * 1596 慶長 Keichō * 1615 元和 Genna * 1624 寛永 . . .
6K - last updated 2005-06-29 09:29 by wof
gttgaatgggcggatgctaattactatctcccgaaagaatccgcatacca
<pre> Séquence de nucléotides de l'ADN du bactériophage lambda (48502 nucléotides, MM=31,5Md) . . . 9601tgaacggcgttgctgcaggcaaggtcaacattccggttgtatccggtaat . . . 9651ggtgagtttgctgcggttgcagaaattaccgtcaccgccagttaatccgg . . . 19601agtgttatgacagcccgccggaaccggtgggcttttttgtggggtgaata . . . 19651tggcagtaaagatttcaggagtcctgaaagacggcacaggaaaaccggta . . .
53K - last updated 2004-12-23 22:04 by Auriea
numbers
[[Reference]] [[image:404]] <center>[[33]]</center> http://www.geocities.com/rmlyra/Numbers.html . . . 95 is the number of planar partitions of 10. 96 is the smallest number that can be written as the . . . value of n such that 2nCn is divisible by n2. 196 is the smallest number that is not known to reach . . . change for a dollar. 293 ??? 294 ??? 295 ??? 296 ??? 297 is a Kaprekar number. 298 ??? 299 ??? 300 . . . is the Kaprekar constant for 3-digit numbers. 496 is the 3rd perfect number. 497 is the number of . . .
74K - last updated 2014-05-30 12:49 by Auriea
say
SongBook Learn to say the same thing Let us hold fast to sayin the same thing I hope all is well with . . . <object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=7,0,0,0" . . .
2K - last updated 2007-06-05 17:09 by Auriea
syndicate
[[Empire]] http://anart.no/~syndicate http://syndicate.anart.no i became a "moderator" or "fire guard" . . . people at the Next Five Minutes in Amsterdam 1996, the Syndicate was established as a platform for . . . at half-yearly intervals in Rotterdam (Sept. 1996) Liverpool (April 97), Kassel (July 97), Dessau . . . in printed form: - V2_East Reader September 1996 - Deep Europe October 1997 - Junction Scopje October . . .
6K - last updated 2005-12-17 17:24 by Auriea
testimg
myImages[5][0] = "http://farm4.staticflickr.com/3447/3984562337_fb1ec28287_z.jpg"; myImages[5][1] = "http://farm2.staticflickr.com/1417/5125202669_dce2330777_z.jpg"; . . . = "http://farm5.staticflickr.com/4066/5125811896_ec6eaf5bc8_z.jpg"; myImages[5][6] = "http://farm2.staticflickr.com/1429/5125815150_8697ebe371_z.jpg"; . . . = "http://farm3.staticflickr.com/2443/3963397162_a5c8992fd0_z.jpg"; myImages[5][12] = "http://farm3.staticflickr.com/2647/3985320020_20b38c1245_z.jpg"; . . .
2K - last updated 2013-05-30 14:39 by Auriea