1999-01-29
ProofOfMyExistence [[image:Riea-VSOP]] <tt>y must get tripod... just a sec [fakeshop]: telephone . . . now life: the nite is still young life: 1:48 AM signmonger: goodnight.... or good afetrnoon gate: . . .
32K - last updated 2018-09-11 12:03 by Auriea.
2006-05-30 muse 12h48
it occurs to me most accutely this day that my biggest problem is that i don't know what i want. that . . .
1K - last updated 2006-05-30 12:51 by Auriea
2009-03-30 gdc notes
<html><object width="480" height="295"><param name="movie" value="http://www.youtube.com/v/UcC9-HYX1Ek&hl=en&fs=1&color1=0x5d1719&color2=0xcd311b"></param><param . . . allowfullscreen="true" width="480" height="295"></embed></object></html> . . .
2K - last updated 2009-03-30 11:41 by Auriea
47
Without going outside, you may know the whole world. Without looking through the window, you may see . . . without doing. <center><--[[46]] - [[48]]--></center> . . .
1K - last updated 2019-06-14 22:06 by Au-Roma
48
In the pursuit of learning, every day something is acquired. In the pursuit of Tao, every day something . . .
1K - last updated 2020-10-08 09:02 by Auriea
49
The sage has no concern for himself, But makes the concerns of others his own. He is good to those who . . . like his own children. <center><--[[48]] - [[50]]--></center> . . .
1K - last updated 2020-10-08 09:02 by Auriea
89SecondsAtAlcazar
ElegantMedia <html> <embed src='http://ubu.artmob.ca/video/flash/player-viral.swf' height='480' . . .
1K - last updated 2009-11-30 18:56 by Auriea
AmaryllisFlower
TuinPlanten Ours didn't flower this year so I am thining I didn't let it hybernate properly: ''Advice . . . Rinse & repeat. . . .
1K - last updated 2005-06-05 11:10 by Auriea
AnneCarson
CastOfThousands my favorite living poet... if i could be said to have a favorite poet * http://www.poetryfoundation.org/bio/anne-carson . . . ErosTheBittersweet [[tube:zK44lArPXYc&hl 480 385 0]] [[image:GriefLessons]] . . .
1K - last updated 2013-01-06 12:30 by Auriea
AnneSexton
CastOfThousands <html> <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/L4VlcVfgFJk&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> . . .
1K - last updated 2010-05-05 00:26 by Auriea
AugmentedReality
DigitalSculpture ==Tools I can use== * ARToolkit https://artoolkit.org/download-artoolkit-sdk ** ARToolkit . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/fWSSdUQF3J0&hl=en_US&fs=1?color1=0xe1600f&color2=0xfebd01"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . .
2K - last updated 2017-03-09 16:39 by Au-Mercury
BBCOresteia
<img src="http://auriea.com/wp-content/uploads/Screenshot-2015-06-08-18.57.28.png" alt="Screenshot . . . alt="GriefLessons" width="491" height="748" class="aligncenter size-full wp-image-638" /> . . .
5K - last updated 2017-02-12 14:48 by Auriea
Bauhaus
ElegantMedia <html> <img src="http://www.auriea.org/index.pl/download/BauhausPhoto" USEMAP="#meisterfoto" . . . true"> <AREA SHAPE=RECT COORDS="24,15,48,122" HREF="http://images.google.com/images?q=Hinnerk . . .
4K - last updated 2005-11-15 14:15 by Auriea
BillViola
CastOfThousands ''see also: ElegantMedia'' much more to mention here later * http://www.museumca.org/exhibit/exhi_viola.html . . . <html> <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/D_urrt8X0l8&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> . . . <object width="480" height="295"><param name="movie" value="http://www.youtube.com/v/eTakwOpWqG4&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="295"></embed></object> . . .
2K - last updated 2010-02-24 16:38 by Auriea
BlenderNormalMaps
Blender ==Step by Step== * material node tutorial and reference http://www.geneome.net/blender/writtentutorials/matnodes.html . . . <object width="640" height="480"><param name="movie" value="http://www.youtube.com/v/gyi5_RHHDx0&hl=en&fs=1"></param><param . . . allowfullscreen="true" width="640" height="480"></embed></object> </html> . . .
2K - last updated 2009-08-01 17:17 by Auriea
Book19
SketchBooks '''everyday kinds of peace and violence''' july 1993 - september 1993 23.5 x 31 cm; handbound . . . [[thumb:Book19_NeverDoubt|500px]] [[vimeo:48441613 500 281 0]] [[foreground:paper_bkg2|repeat . . .
1K - last updated 2012-09-06 12:31 by Auriea
Book20
SketchBooks '''Psyche Story''' Oct 1993 - Apr 1994 20 x 25.5 cm; handbound, found cover w/collage <center>[[vimeo:3065816 . . . 700 481 0]]</center> . . .
1K - last updated 2020-04-09 12:01 by Auriea-Mercury
Book23B
'''''Like Being Awake Sleeping And Hearing Seeing''''' Oct. 1995 - June 1996 [[thumb:Book23B_Cover|250px]] . . . http://farm4.staticflickr.com/3350/3220857040_48e56f5eeb.jpg first ever trip to London http://farm4.staticflickr.com/3494/3220003661_a98e4b51a4_z.jpg . . .
1K - last updated 2012-09-06 13:59 by Auriea
Book25
SketchBooks 16 july 1997 - jun 1999 '''2 million year-old light''' [[image:Book25_Cover]] [[vimeo:48442206 . . .
1K - last updated 2012-11-20 18:27 by Auriea
Book32
SketchBooks '''Beautiful Lightside/Beautiful Darkside''' June 2006 - March 2007 16.3 x 24.3 cm; handbound, . . . [[thumb:Book32_Page48-49|300px]] [[thumb:Book32_Page53|150px]][[thumb:Book32_Page60-61|300px]] . . . [[thumb:Book32_Page48_darkside|150px]] [[thumb:Book32_Page49_darkside|150px]] . . .
2K - last updated 2018-09-09 21:17 by Auriea
Book32 Page48-49
image/jpeg
289K - last updated 2006-08-18 06:02 by Auriea
Book32 Page48 darkside
image/jpeg
184K - last updated 2007-01-10 12:37 by Auriea
Book35
SketchBooks '''talking to myself''' [[thumb:Book35_Cover|300px]] [[thumb:Book35_Untitled1|200px]][[thumb:Book35_Untitled2|200px]][[thumb:Book35_Untitled3|200px]][[thumb:Book35_Untitled4|200px]] . . . . . . . . .
2K - last updated 2018-09-09 21:14 by Auriea
Book43
SketchBooks '''De Rerum Natura''' March 18, 2012 - June 25, 2012 17 x 25.5 cm; handbound cover: canvas, . . . the TransitOfVenus in 2012. ------ [[vimeo:48441029 640 360 0]] <table/booknav prev, next> . . .
3K - last updated 2018-09-09 21:08 by Auriea
Book47
SketchBooks '''Costumes Anciens et Modernes''' 26 July 2013 - 25 Sept 2013 14.5 x 23 cm handmade, found . . . <table/booknav prev, next> prev/l=[[Book48|48.]] next/r=[[Book46|46.]] ----- . . .
1K - last updated 2018-09-09 21:05 by Auriea
Book48
SketchBooks [[thumb:Book48_Cover|300px]] [[thumb:Book48_BackCover|300px]] '''Paris''' 25 Sept 2013 - . . . - requiescat in pace) ------- [[thumb:Book48_1|200px]] [[thumb:Book48_2|200px]] [[thumb:Book48_3|200px]] . . . [[thumb:Book48_4|200px]] [[thumb:Book48_5|200px]] [[thumb:Book48_6|200px]] . . . [[thumb:Book48_7|200px]] [[thumb:Book48_8|200px]] [[thumb:Book48_9|200px]] . . . [[thumb:Book48_10|200px]] [[thumb:Book48_11|200px]] [[thumb:Book48_12|200px]] . . .
2K - last updated 2018-09-09 21:05 by Auriea
Book48 1
image/jpeg
279K - last updated 2014-09-09 13:33 by Auriea
Book48 10
image/jpeg
328K - last updated 2014-09-09 13:36 by Auriea
Book48 11
image/jpeg
330K - last updated 2014-09-09 13:37 by Auriea
Book48 12
image/jpeg
263K - last updated 2014-09-09 13:37 by Auriea
Book48 13
image/jpeg
396K - last updated 2014-09-09 13:37 by Auriea
Book48 14
image/jpeg
280K - last updated 2014-09-09 13:38 by Auriea
Book48 15
image/jpeg
309K - last updated 2014-09-09 13:38 by Auriea
Book48 16
image/jpeg
305K - last updated 2014-09-09 13:38 by Auriea
Book48 17
image/jpeg
335K - last updated 2014-09-09 13:38 by Auriea
Book48 18
image/jpeg
303K - last updated 2014-09-09 13:39 by Auriea
Book48 19
image/jpeg
210K - last updated 2014-09-09 13:39 by Auriea
Book48 2
image/jpeg
244K - last updated 2014-09-09 13:33 by Auriea
Book48 20
image/jpeg
234K - last updated 2014-09-09 13:41 by Auriea
Book48 21
image/jpeg
243K - last updated 2014-09-09 13:41 by Auriea
Book48 22
image/jpeg
259K - last updated 2014-09-09 13:41 by Auriea
Book48 23
image/jpeg
240K - last updated 2014-09-09 13:42 by Auriea
Book48 24
image/jpeg
163K - last updated 2014-09-09 13:42 by Auriea
Book48 25
image/jpeg
260K - last updated 2014-09-09 13:42 by Auriea
Book48 26
image/jpeg
193K - last updated 2014-09-09 13:42 by Auriea
Book48 3
image/jpeg
272K - last updated 2014-09-09 13:33 by Auriea
Book48 4
image/jpeg
213K - last updated 2014-09-09 13:34 by Auriea
Book48 5
image/jpeg
325K - last updated 2014-09-09 13:34 by Auriea
Book48 6
image/jpeg
332K - last updated 2014-09-09 13:35 by Auriea
Book48 7
image/jpeg
326K - last updated 2014-09-09 13:35 by Auriea
Book48 8
image/jpeg
309K - last updated 2014-09-09 13:36 by Auriea
Book48 9
image/jpeg
250K - last updated 2014-09-09 13:36 by Auriea
Book48 BackCover
image/jpeg
254K - last updated 2014-09-09 13:44 by Auriea
Book48 Cover
image/jpeg
316K - last updated 2014-09-09 13:43 by Auriea
Book49
SketchBooks [[thumb:Book49_Cover|400px]] [[thumb:Book49_BackCover|400px]] '''La salle des Caryatides''' . . . next> prev/l=[[Book50|50.]] next/r=[[Book48|48.]] . . .
2K - last updated 2018-09-09 21:04 by Auriea
BorisVian
CastOfThousands [[image:BorisVianAaZ]] books: [http://www.artworldbooks.com/pages/search.php?words=Vian&theme=0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16] . . . Bradbury. New Sullivans followed in 1947 and 1948. At the same time Vian produced more or less serious . . . for Darius Milhaud, was performed in Berlin in 1948. In the preface of L'écume des jours (1947) Vian . . .
8K - last updated 2012-07-02 13:21 by Auriea
CastOfThousands
CastOfThousands any proper account of my life will have to include all of the following people. <list . . . [[image:Monet]] <html><object width="480" height="360"><param name="movie" value="http://www.dailymotion.com/swf/video/x7y80w_1914_creation?additionalInfos=0"></param><param . . . width="480" height="360" allowfullscreen="true" allowscriptaccess="always"></embed></object><br . . .
1K - last updated 2010-08-01 14:24 by Auriea
ClipStudioPaint
[[Reference]] ==using vector tools== [[tube:deb3wLpjQTg 640 480 0]] . . .
1K - last updated 2014-06-18 15:27 by Auriea
CraterLake
OutsideSomeplace [[background external:http://farm4.static.flickr.com/3311/3220926576_c92fc88cbc_b.jpg|repeat . . . . . . . . .
1K - last updated 2010-04-06 00:16 by Auriea
DeepPaint
[[Reference]] I've chosen to learn DeepPaint3d instead of BodyPaint3d because it has '''less''' features. . . . align="left" valign="top"> <td width="248"><p class="tablebodytext">Select All</p> . . . align="left" valign="top"> <td width="248"><p class="tablebodytext">Deselect All</p> . . . align="left" valign="top"> <td width="248"><p class="tablebodytext">Select Inverse</p> . . . align="left" valign="top"> <td width="248"><p class="tablebodytext">Move Selection . . .
23K - last updated 2006-07-15 13:35 by Auriea
DigitalSculpture
[[Sculpture]] <center><html><iframe width="240" height="480" src="https://sketchfab.com/models/43253ee0013a4603a7af20069a7c9383/embed?autostart=1&ui_infos=0" . . .
2K - last updated 2017-08-24 00:42 by Au-Danae
Drawing
ElegantMedia ''see also: Projects, ElegantMedia, RandomIdeas, Books, Raphael, DancingDrawing, TheLivingLine'' . . . Art Collections . . .
2K - last updated 2017-08-23 13:18 by Au-Mercury
FieldRecordings
MySong http://www.quietamerican.org/ a great place to contribute sounds to: http://soundtransit.nl/ http://www.arteradio.com/wai/rubrique.do?num=17057 . . . LESBROUSSART 1050 BRUSSELS BELGIUM tél. 0032 2 648.47.09 fax 0032 2 648.45.86}} ;) http://www.soundman.de/usa/usa.htm . . .
2K - last updated 2009-05-27 14:03 by Auriea
FinalFantasy
[[Games]] <html><embed style="width:400px; height:326px;" id="VideoPlayback" type="application/x-shockwave-flash" . . . flashvars=""> </embed></html> . . .
1K - last updated 2007-10-15 01:13 by Auriea
FlashSettings
[[Flash]] http://livedocs.macromedia.com/flash/mx2004/main_7_2/wwhelp/wwhimpl/common/html/wwhelp.htm?context=Flash_MX_2004&file=00000484.html . . . publish settings for . . .
12K - last updated 2006-09-04 10:58 by Auriea
Flickr
<html> <a data-flickr-embed="true" href="https://www.flickr.com/photos/entropy8/albums/72157669842528051" . . . width="480" height="640" alt="L.O.C.K."></a><script . . .
1K - last updated 2017-08-01 22:49 by Au-Mercury
GamesImLookingForwardTo
[[Games]] <html><object id="flashObj" width="486" height="412" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" . . . name="flashObj" width="486" height="412" seamlesstabbing="false" type="application/x-shockwave-flash" . . . 320 240 0]] [http://imomus.livejournal.com/334948.html momus review] . . .
3K - last updated 2009-09-26 22:27 by Auriea
GawkerArtists
<html> <a href='http://d1.openx.org/ck.php?n=a4b76645&cb=12345' target='_blank'> <img . . . src='http://d1.openx.org/avw.php?zoneid=22048&n=a4b76645' border='0' alt='' ></a> . . .
1K - last updated 2009-04-08 14:39 by Auriea
GreekTragedy
CreativeWriting * [[WikiPedia:Choerilus (playwright)|Choeriluĉs]] * [[WikiPedia:Aeschylus]] (c. 525–456 . . . ** Tantalus * [[WikiPedia:Achaeus of Eretria]] (484-c. 405 BCE) ** Adrastus ** Linus ** Cycnus ** Eumenides . . . (c. 356 BCE) * [[WikiPedia:Agathon]] (c. 448–400 BCE) * [[WikiPedia:Aphareus (writer)|Aphareus]] . . . (409 BCE) * [[WikiPedia:Euripides]] (c. 480–406 BCE): ** [[WikiPedia:Alcestis (play)|Alcestis]] . . .
3K - last updated 2011-01-26 01:33 by Auriea
HomebrewDS
[[Games]] MakingDSGames latest firmware - http://dshere.com/ http://www.handheldsources.com/M3DS/Download_M3DSS.html . . . * ds . . .
5K - last updated 2010-10-06 10:27 by Auriea
Hucisko
[[Poland]] <center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" . . . height="480" src="https://sketchfab.com/models/04d4f3a310d742fc8a71498ffc8917ef/embed" . . .
1K - last updated 2017-08-14 14:35 by Au-Mercury
ICO
[[tube:SEMdx6fPkoA 640 480 0]] [[tube:F0b3sOJ6BeM 640 480 0]] . . .
1K - last updated 2007-12-18 19:48 by Auriea
ImmortalComputing
RandomIdeas ''see also: MemoriesWereMeantToFade, NothingEverDiesOnTheNet'' Microsoft is trying to patent . . . P-I reporter Todd Bishop can be reached at 206-448-8221 or toddbishop@seattlepi.com. © 1998-2007 Seattle . . .
8K - last updated 2007-05-10 15:48 by Auriea
Indianapolis
OutsideSomeplace http://farm4.static.flickr.com/3518/3718279091_d2008057b9_b.jpg ==free wifi== * http://www.wififreespot.com/in.html . . . station - 9599 North Meridian St - 317-846-9748 SimplyeOffice, Inc. - 6351 S. East Street Suite . . .
4K - last updated 2020-04-06 17:14 by Auriea-Mercury
JamesBaldwin
CastOfThousands [[tube:hDjaqhuSqQE 640 480 0]] . . .
1K - last updated 2009-01-09 22:18 by Auriea
LambdaMOO
[[MOO]] telnet://lambda.moo.mud.org:8888 <pre> Store | West Bank---LambdaSt.---Street... | | Landing . . . Subject: Your LambdaMOO character, Vaarg From: 2487@lambda.moo.mud.org Date: 2005年4月24日 09:00:00 . . .
4K - last updated 2019-10-21 19:32 by Auriea.
LastLifeInTheUniverse
[[Quoth]] http://film.indiefilipino.com/item.php?id=93 http://filmbrain.typepad.com/filmbrain/2004/05/found_in_transl.html . . . Video Bitrate: 908 kbps Video Codec: XviD Audio: 48000hz, 16bps, 2ch MP3 VBR File Size: 716.7 MB Genre: . . . This could be me three hours from now. 3 00:01:48,061 --> 00:01:51,940 Why do I want to kill myself? . . . --> 00:12:34,541 If not Japan, maybe Brazil. 48 00:12:35,021 --> 00:12:38,809 Japan is better, . . . Who told you that? 99 00:16:46,461 --> 00:16:48,736 Did you fuck him? 100 00:16:52,381 --> 00:16:54,690 . . .
27K - last updated 2005-07-24 13:56 by Auriea
Lendelede
OutsideSomeplace where Michael's parents live http://farm5.static.flickr.com/4147/4982248862_b69c67199a_b.jpg . . .
1K - last updated 2010-09-13 10:07 by Auriea
LifeDrawing
[[Drawing]] ''see also: drawing, anatomy, LeonardoDaVinci, CaproniCasts, SightSize'' ''also! also!: http://atelierauriea.tumblr.com/'' . . . anatomy thread] on CGTalk. (terribly outdated and . . .
4K - last updated 2014-09-29 17:47 by Auriea
LocationLocationLocation
<html> <head> <meta charset="utf-8" /> <meta http-equiv="X-UA-Compatible" content="IE=edge" . . . 50 50" gps-entity-place="latitude: 41.905480; longitude: 12.458780;" ></a-text> <a-camera . . .
1K - last updated 2020-03-27 16:05 by Auriea-Mercury
MamiyaC3
[[photography]] http://farm3.static.flickr.com/2134/2509929964_44896b16bc.jpg . . .
1K - last updated 2009-01-05 00:31 by Auriea
Martha
CastOfThousands [[background external:http://farm4.static.flickr.com/3182/2910930013_cb3490c72b.jpg|repeat . . . http://farm4.static.flickr.com/3211/2711744348_8afe7809be_b.jpg http://farm4.static.flickr.com/3235/2700984718_9ec18476e5_b.jpg . . .
1K - last updated 2010-04-15 09:53 by Auriea
MaxMspJitter
VisualProgramming realtime audiovisual programming. ''see also: MySong, DigitalSculpture, RealTime'' . . . * https://www.patreon.com/posts/virtual-reality-8482498 ** Tracking Heads android app - https://play.google.com/store/apps/details?id=com.hollyhook.trackingheads . . . http://www.mat.ucsb.edu/~whsmith/xray.html . . .
4K - last updated 2017-04-18 19:34 by Au-Mercury
MexicoCity
OutsideSomeplace ==2014== In Mexico City there are a number of activities that may be appealing to them. . . . . . . . . .
2K - last updated 2014-09-29 11:55 by Auriea
Murakami interview1
[[Quoth]] from: http://www.salon.com/books/int/1997/12/cov_si_16int.html BY LAURA MILLER | The heroes . . . I can understand their feelings very well. I am 48, and they are in their 20s or 30s, but I have a . . .
20K - last updated 2005-08-09 17:17 by AurieaHarvey
MuziekLes
MySong i will take music lessons in the summer. i want to better understand the music i love so much. . . . . . . . . .
2K - last updated 2007-10-07 20:47 by Auriea
MyTopOneHundredSongsOfAllTime
SongBook upon a dare from LJ:hiphopdiary http://hiphopdiary.livejournal.com/488494.html?nc=5&style=mine . . .
5K - last updated 2006-12-15 12:13 by Auriea
NET.ARCHEOLOGY
I was online from the “beginning” and first made a reputation as a web designer/net artist in 1996. . . . It was a web browser, a parser, which creates . . .
4K - last updated 2021-01-25 13:00 by Auriea
NoQuarter
''for screenshots see: [[Minorinth]]'' ==Working Title: MINORINTH/LABYTAUR== <center>[[thumb:Minorith-lookfeel|600px]] . . . heaven [http://www.phaistosgame.com/Phaistos48.htm] * Maps, pilgrimage [http://www.luc.edu/medieval/labyrinths/imaginary_pilgrimage.shtml] . . . width="80%" height="480" src="https://sketchfab.com/models/6c18376147ef421788740f5b7593d250/embed" . . .
6K - last updated 2018-09-29 23:01 by Auriea.
Paris
OutsideSomeplace ==Next time== * http://www.bourdelle.paris.fr/en * another trip to musee moreau (recently . . . Amour (8, rue Navarin; Ninth Arrondisement; 33-1-4878-3180.) Each room is uniquely decorated on the . . . Prix-fixe dinner 190 euros. Casa Olympe, 48, rue St-Georges; Ninth; 33-1-4285-2601 Angélina, . . . 57, bis rue de Babylone; Seventh, 33-1-4555-4848. Théâtre du Châtelet, 1, place du Châtelet; . . .
6K - last updated 2015-02-02 16:56 by Auriea
Photogrammetry
[[3D]] ''see also: PhotogrammetryFromVideo'' <html> <iframe width="640" height="480" src="https://sketchfab.com/models/0aaf3716c92b4ffeba39ac82319b7d55/embed" . . .
2K - last updated 2017-05-30 19:08 by Au-Mercury
PleasePleasePlease
SongBook [[tube:rMlDbhaI6n8 640 480 0]] . . .
1K - last updated 2009-01-09 22:20 by Auriea
PopularCulture
[[Quoth]] ''Excerpts{{lifted from http://pubpages.unh.edu/~dml3/880williams.htm}} from Raymond Williams{{linked . . . (cf. in English culture as 'worship in Caxton (1483)). The French forms of cultura were couture, OF, . . .
20K - last updated 2005-01-09 15:48 by Auriea
Projects
==Currently== [[In_the_Kingdom_No.19]] ------ == Queue == * Cyclops * StillLives ** Bugs ** The Cat * . . . TRACKS (total time 42:09) : # I Got Soul (4:48) # Welfare Slave (5:49) # Nothingness (2:28) # Thanksgiving . . .
1K - last updated 2019-12-12 14:08 by Au-Elektra
Ruins
[[Projects]] Photogrammetry created from Youtube HD drone video of the ruins of Homs, Syria https://www.youtube.com/watch?v=DoRdCbDd50o&t=31s . . . width="80%" height="480" src="https://sketchfab.com/models/9bf395f77a4347fdbd5566a65ccfebbe/embed" . . . width="80%" height="480" src="https://sketchfab.com/models/ff68d7b40ddd41e0aa58288cdbbcfa18/embed" . . . width="80%" height="480" src="https://sketchfab.com/models/b7cb782fdd224c40a997d5818b13e4a8/embed" . . . width="80%" height="480" src="https://sketchfab.com/models/9bf395f77a4347fdbd5566a65ccfebbe/embed" . . .
3K - last updated 2017-09-15 23:37 by Au-Danae
RulesOfAcquisition
[[Reference]] Rule 001 » Once you have their money, you never give it back. Rule 002 » The best deal . . . a man wearing a better suit than your own. Rule 048 » The bigger the smile, the sharper the knife. . . .
10K - last updated 2009-01-17 01:51 by Auriea
RunsInTheFamily
SongBook [[tube:O_JFjY5Y0Os 640 480 0]] . . .
1K - last updated 2009-03-07 22:28 by Auriea
SacredTexts
[[mythology]] http://www.sacred-texts.com/index.htm ==Founders of religions== Abraham - claimed as a . . . BC Siddartha Gautama - Buddhism, ca. 563 BC-483 BC, or (trad.) 1029 BC-949 BC. Mahavira - Jainism, . . .
2K - last updated 2005-12-27 20:10 by Auriea
Scans
[[foreground:none|#000000]] <center>[[thumb:artemis.png|1080px]]</center> <center>See . . . width="1080" height="480" src="https://sketchfab.com/models/a8ab38d1422040dd94d95226d341a1dc/embed" . . . width="1080" height="480" src="https://sketchfab.com/models/6c18376147ef421788740f5b7593d250/embed" . . .
1K - last updated 2018-12-24 15:38 by Auriea.
SeydouKeita
[[photographers]] Img:Seydou+Keita [http://www.skny.com/lasso-bin/artist_artwork.lasso?-token.ArtistID=51&-token.ArtistName=The%20Estate%20of%20Seydou%20Ke%EFta] . . . angry, but they were the ones that moved! In 1948 Mountaga admitted that I was qualified enough to . . .
5K - last updated 2007-10-01 15:14 by Auriea
SightSize
[[drawing]] ''see also: CaproniCasts, LifeDrawing'' ==::BargueDrawing== http://www.learning-to-see.co.uk/bargue-drawings . . . . . . ----- http://www.sightsize.com '''So what . . .
2K - last updated 2011-09-24 23:15 by Auriea
SketchBooks
[[thumb:AnneCarson-Candor|600px]] This archive is a work in/of constant progress. '''I welcome you to . . . look at: [[Book49|49]], [[Book48|48]], [[Book44|44]], [[Book43|43]], [[Book42|42]], . . . - Paris |http://auriea.org/Book48|*48.]] . . .
8K - last updated 2019-06-07 10:17 by Auriea
SnelBelgWet
ProofOfMyExistence U kunt in lokaal 211 in het Administratief centrum uw aanvraag doen. Hiervoor heeft . . . (samenstelling gezin formulier 42F en 48F) te bekomen idem als nr. 4 . . .
1K - last updated 2008-04-09 16:58 by Auriea
Story
ElegantMedia [[tube:U82eWptFxSs 640 480 0]] . . .
1K - last updated 2008-11-20 11:25 by Auriea
StreetView
OutsideSomeplace permalinks to random places. via: http://web.mit.edu/~jmcmicha/www/globegenie/ and http://www.mapcrunch.com/ . . . ==GB== * a rather large cemetary in Ipswitch . . .
2K - last updated 2010-12-23 16:42 by Auriea
StudLoan
ProofOfMyExistence ==2017== ||I.17 || $129+179 || $300 (11,04 EURfee) || 285,13 EUR || 20170107 || $1,947 . . . || $579,00 USD{{$479+100+$22,88(fee)}} USD || €481,32 EUR|| 20130705||$2,933.53 + ?? || ||VIII.13 . . . ||II.09 || 147.19 || 174.00 || 321.19 || €273,48 EUR || $340.00 USD || 20090103|| ||III.09 {{missed . . . || ||IV.09 || 331.70 {{147.19 + 184.51}} || 348 {{174 x 2}} || 679.70 || €545,51 EUR || $700.00 . . . {{missed a payment}} || ||IX.09 || $402.48 || $281.74 || $684.22 + 26,98 fee || €510,36 EUR . . .
14K - last updated 2017-06-16 11:39 by Au-Danae
SunRa
[[Quoth]] [[tube:x0UVHsEWxYI 640 480 0]] . . .
1K - last updated 2008-07-05 14:51 by Auriea
TableOfContents
SketchBooks width in cm. divided by 2 [[thumb:Book49_Cover|75px]] [[thumb:Book48_Cover|65px]] [[thumb:Book47_Cover|72px]] . . .
2K - last updated 2014-09-09 14:27 by Auriea
TheAntichrist
[[Mythology]] 46 Prophecies the Antichrist will fulfill # The antichrist will be a man - Daniel 7:24-25 . . . the definition of the word "craft" here. It is 4820 mirmah (meer-maw'); from 7411 in the sense of . . .
9K - last updated 2009-06-25 09:25 by Auriea
TheFlowerSeller
<html><center><div class="sketchfab-embed-wrapper"><iframe width="90%" height="750" . . . src="https://sketchfab.com/models/65a825dbcf694801968adfbf823a4148/embed" frameborder="0" allowvr . . .
1K - last updated 2018-03-09 16:15 by Au-Mercury
TheFourByFive
[[photography]] http://farm3.static.flickr.com/2367/2518960124_4d245c7134.jpg --i think i lost part of . . . Commercial Astragon 1:6.3 f=180mm (7 1/8") No.83481 6.3 - 63 . . .
1K - last updated 2009-02-22 14:05 by Auriea
TheSandman
FiftyBooks A GraphicNovel series written by NeilGaiman. Covers by DaveMcKean. [http://spiffyness.net/dream/ . . . Unlikely Growth, DC Comics, 1993 ''Sandman #48'', Journey's End-Brains, A Heart, A Ride In A Balloon-Dinner-Something . . .
7K - last updated 2010-05-19 14:56 by Auriea
ThoughtPhotoStream
<html><script type="text/javascript" src="http://www.flickr.com/badge_code_v2.gne?show_name=1&count=10&display=latest&size=m&layout=h&source=user_set&user=81482434%40N00&set=72157624960278365&context=in%2Fset-72157624960278365%2F"></script></html> . . .
1K - last updated 2012-02-10 21:15 by Auriea
ThroughAGlassDarkly
[[Reference]] [[tube:-SPfJIlkT_Y 640 480 0]] [http://www.bergmanorama.com Ingmar Bergman] . . .
1K - last updated 2008-01-17 01:44 by Auriea
TillWeHaveFaces
FiftyBooks [[thumb:TillWeHaveFaces-scan1]] [[thumb:TillWeHaveFaces-scan2]] [[thumb:TillWeHaveFaces-scan3]] . . . . . .
1K - last updated 2006-11-08 02:29 by Auriea
ToWatch
[[Movies]] <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/kxIYuOeAKnw?fs=1&hl=en_US"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . . <html> <object width="640" height="480"><param name="movie" value="http://www.youtube.com/v/2U7-QiLYwrQ&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="640" height="480"></embed></object> <object width="480" . . . allowfullscreen="true" width="480" height="385"></embed></object> . . .
3K - last updated 2011-01-12 19:41 by Auriea
VIDEOGAMES
1) Bientôt l’été, 2011 http://tale-of-tales.com/bientotlete A holodeck beach simulation. Entertainment . . . 3. Luxuria Superbia, 2013 Something completely . . .
2K - last updated 2020-06-15 22:30 by Auriea-Mercury
VijaCelmins
CastOfThousands <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/tORoyCJtO4o&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . .
1K - last updated 2010-05-05 00:31 by Auriea
VincentDesiderioLectureNotes
[[Painting]] [[tube:GxRN9tcN6pQ 640 480 0]] # this talk is about how to control color temperature and . . .
8K - last updated 2014-08-21 13:50 by Auriea
WarsawFoksalGalleryShow2019
<html> <div class="sketchfab-embed-wrapper"><iframe width="640" height="480" src="https://sketchfab.com/models/be76382be40a4574b96b7c6b59a79c8b/embed?autospin=0.2&autostart=1&camera=0" . . . width="640" height="480" src="https://sketchfab.com/models/04d4f3a310d742fc8a71498ffc8917ef/embed?autospin=0&autostart=1&camera=0" . . . width="640" height="480" frameborder="0" webkitallowfullscreen mozallowfullscreen . . .
1K - last updated 2019-02-25 15:26 by Auriea
XLVI
<center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" height="700" . . . src="https://sketchfab.com/models/65a825dbcf694801968adfbf823a4148/embed?autospin=0.2&autostart=1&transparent=1&ui_related=0" . . . width="90%" height="480" src="https://sketchfab.com/models/e198edf528164788910136043bec0f78/embed" . . .
1K - last updated 2017-09-15 23:44 by Au-Danae
Yurt
[[Research]] <html><script src="http://flash.revver.com/player/1.0/player.js?mediaId:149791;width:480;height:392;" . . .
1K - last updated 2009-01-04 01:23 by Auriea
ZBrush
DigitalSculpture ZBrush is the only application that makes me think that 3d modeling could be alright . . . ginormous topology . . .
14K - last updated 2014-09-17 17:07 by Auriea
anatomy
SketchBook ''see also: LifeDrawing'' the differences between man and woman * http://anthropology.si.edu/writteninbone/male_female.html . . . * http://inventiontocompletehumanbeing.blogspot.com/ . . .
4K - last updated 2011-09-05 23:47 by Auriea
autodidact
ProofOfMyExistence 2 definitions The Collaborative International Dictionary of English v.0.48 Autodidact . . .
1K - last updated 2006-12-24 14:40 by Auriea
breathe
ProofOfMyExistence ''see also: exercise, yoga, meditation'' http://www.youtube.com/results?search_query=yoga+breath&aq=f . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/WjbMB5IEUFI&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . .
5K - last updated 2010-07-03 00:49 by Auriea
color
[[Reference]] ''see also: FavoriteColor'' [::DeadColor] The first layers of paint the artist applies . . . 205, G:141, B:066 Raw Sienna R: 185, G:075, B:048 Burnt Sienna R: 137, G:079, B:055 Brown Oxide R: . . .
2K - last updated 2013-01-16 12:15 by Auriea
css-mob
.mirror, .NavBar, .plinks, .header, .gotobar, .time, .trail, .sidebar, .footer {display:none;} img.upload . . . */ @media only screen and (max-device-width: 480px) { body { font-size: 32pt; line-height: 40pt; . . .
1K - last updated 2009-09-18 20:10 by Auriea
cuirass
<html><iframe src="https://poly.cam/capture/409D21F1-0416-499A-84A1-3CBFB781A1AC/embed" title="polycam . . . capture viewer" style="height:640px;width:480px; frameborder="0"></iframe> <iframe . . . capture viewer" style="height:640px;width:480px;" frameborder="0"></iframe></html> . . .
1K - last updated 2024-09-02 19:26 by Auriea
era
[[日本語]] * 645 大化 Taika * 650 白雉 Hakuchi * 654 (Discontinued) * 672 白鳳 Hakuhō * 686 . . . 天長 Tenchō * 834 承和 Jōwa or Shōwa * 848 嘉祥 Kajō * 851 仁寿 Ninju * 854 斉衡 Saikō . . . * 1467 応仁 Ōnin * 1469 文明 Bunmei * 1487 長享 Chōkyō * 1489 延徳 Entoku * 1492 明応 . . . * 1624 寛永 Kan'ei * 1644 正保 Shōhō * 1648 慶安 Keian * 1652 承応 Jōō * 1655 明暦 Meireki . . . * 1741 寛保 Kampō * 1744 延享 Enkyō * 1748 寛延 Kan'en * 1751 宝暦 Hōreki * 1764 明和 . . .
6K - last updated 2005-06-29 09:29 by wof
exercise
[[Reference]] ''see also: breathe, yoga, meditation, scoliosis'' this series is a little crazy: <html> . . . <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/aZyuvVPDLfk&hl=en_US&fs=1?color1=0x402061&color2=0x9461ca"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> . . . <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/dRsC1YdXqOc&hl=en_US&fs=1"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . .
6K - last updated 2011-03-21 18:10 by Auriea
gttgaatgggcggatgctaattactatctcccgaaagaatccgcatacca
<pre> Séquence de nucléotides de l'ADN du bactériophage lambda (48502 nucléotides, MM=31,5Md) . . . 4801cgatatggacacgcccggcgggatggtggcgggggcatttgactgcgctg . . . 4851acatcatcgcccgtgtgcgtgacataaaaccggtatgggcgcttgccaac . . . 14801cgtcaccgggcatggcgcgcatctgcctttacggggatttacaacgattt . . . 14851ggtcgccgcatcgaccttcgtgtgaaaacgggggctgaagccatccgggc . . .
53K - last updated 2004-12-23 22:04 by Auriea
iceland
OutsideSomeplace http://farm4.static.flickr.com/3403/3220856292_ee834ca8c2.jpg http://farm4.static.flickr.com/3350/3220857040_48e56f5eeb.jpg . . .
1K - last updated 2010-04-06 00:10 by Auriea
meditation
[[Reference]] ''see also: breathe, exercise, yoga, SacredGeometry'' http://www.youtube.com/user/yogayak#grid/user/F2C08449BC287BC5 . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/Tu-qZugHXfc&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/p/603BD0B03E12F5A1&hl=en_US&fs=1"></param><param . . . type="application/x-shockwave-flash" width="480" height="385" allowscriptaccess="always" allowfullscreen="true"></embed></object></html> . . .
2K - last updated 2010-06-18 09:58 by Auriea
numbers
[[Reference]] [[image:404]] <center>[[33]]</center> http://www.geocities.com/rmlyra/Numbers.html . . . largest number of cubes that cannot tile a cube. 48 is the smallest number with 10 divisors. 49 is the . . . in base 8. 147 is the number of sided 6-hexes. 148 is the number of perfect graphs with 6 vertices. . . . that together contain each digit exactly once. 248 is the smallest number n>1 for which the arithmetic, . . . as the sum of 3 distinct squares in 8 ways. 448 is the number of 10-iamonds. 450 = (5+4)(5+5)(5+0). . . .
74K - last updated 2014-05-30 12:49 by Auriea
pd
Open Frameworks plus PD https://forum.pdpatchrepo.info/topic/11259/ofelia-pd-external-library-written-with-openframeworks . . . https://forum.pdpatchrepo.info/uploads/files/1518488138074-objectlist.pdf . . .
1K - last updated 2019-07-07 13:16 by Auriea
skinonskinonskin
[[Empire]] http://entropy8zuper.org/skinonskinonskin/onskin/ <html> <iframe align=center src=http://www.flickr.com/slideShow/index.gne?user_id=81482434@N00&set_id=72157594508283369 . . .
11K - last updated 2007-01-30 17:19 by Auriea
stalker
[[Quoth]] [[tube:dNiVFCWMrqI 640 480 0]] . . .
1K - last updated 2009-02-07 17:50 by Auriea
testimg
myImages[5][0] = "http://farm4.staticflickr.com/3447/3984562337_fb1ec28287_z.jpg"; myImages[5][1] = "http://farm2.staticflickr.com/1417/5125202669_dce2330777_z.jpg"; . . . = "http://farm2.staticflickr.com/1071/5125813482_5805af3082_z.jpg"; myImages[5][4] = "http://farm2.staticflickr.com/1172/5125808762_770179a56e_z.jpg"; . . .
2K - last updated 2013-05-30 14:39 by Auriea
trees
[[Research]] [[background external:http://farm4.static.flickr.com/3155/2428209195_46906f733c_o.jpg|repeat . . . http://farm5.static.flickr.com/4011/4521074821_20f846b0f7_b.jpg http://farm5.static.flickr.com/4008/4519132068_2c517a372d_b.jpg . . . . . . . . .
2K - last updated 2010-04-15 11:13 by Auriea