1999-01-29
ProofOfMyExistence [[image:Riea-VSOP]] <tt>y must get tripod... just a sec [fakeshop]: telephone . . . life: gate has Art at his back ! life: yea...46 signmonger: just crashed but frankenstein has no . . .
32K - last updated 2018-09-11 12:03 by Auriea.
2011-01-24
http://farm6.static.flickr.com/5217/5384081289_0c2f98d18c.jpg http://farm6.static.flickr.com/5220/5384685608_f29334f390.jpg . . .
1K - last updated 2011-01-24 18:09 by Auriea
2046Poster
image/jpeg
73K - last updated 2005-06-28 16:20 by Auriea
45
The most complete seems lacking. Yet in use it is not exhausted. The most abundant seems empty. Yet in . . . govern the world. <center><--[[44]] - [[46]]--></center> . . .
1K - last updated 2017-11-25 11:25 by Au-Mercury
46
When the Way governs the world, The proud stallions drag dung carriages. When the Way is lost to the . . .
1K - last updated 2017-11-25 11:26 by Au-Mercury
47
Without going outside, you may know the whole world. Without looking through the window, you may see . . . He works without doing. <center><--[[46]] - [[48]]--></center> . . .
1K - last updated 2019-06-14 22:06 by Au-Roma
80sVideoGameResearch
[[Research]] http://www.stadtmuseum-ks.de/index.php/ausstellungen/aktuelle-sonderausstellung Mi, 5.2.2020, . . . Adventure games Muds The covers vs how they really . . .
3K - last updated 2020-01-31 03:03 by Au-Elektra
AllYouEverWantedToKnowAboutTempest
[[Tempest]] ==== All you Ever Wanted to Know About TEMPEST ==== from http://library.psyon.org/tempest.txt . . . of accredited laboratories that perform MIL-STD-462 (electromagnetic interference) testing. Some of . . . with the following standards: EMI (MIL-STD-461C and MIL-STD-462 TEMPEST (NACSIM 5100A, NACSIM . . . collection systems providing support to MIL-STD-461C/462 radiated and conducted emission testing from . . . Engineering Practices Handbook, NATO File No. 1460-2, October 1977 === Other Countries === The US . . .
44K - last updated 2008-05-02 21:50 by Auriea
Ana
CastOfThousands http://profile.myspace.com/index.cfm?fuseaction=user.viewProfile&friendID=227408394 . . . http://farm3.static.flickr.com/2463/3722815466_35162e7cdc_b.jpg . . .
1K - last updated 2010-04-14 23:40 by Auriea
Astronaut
SongBook http://blog.amandapalmer.net/post/185458467/the-writing-filming-of-the-song-astronaut . . .
1K - last updated 2009-09-12 21:29 by 78-21-206-50.access.telenet.be
Barry
CastOfThousands [[background:TheHangedMan|repeat #000000]] http://farm3.static.flickr.com/2446/3714923618_1c449775d3_b.jpg . . .
1K - last updated 2010-04-14 23:38 by Auriea
BlenderGameEngine
[[Blender]] http://tba-creations.leveluphost.com/index.php/Tutorials/using-the-mouse-in-the-ge-theory.html . . . on radiosity and subdivisions] . . .
3K - last updated 2009-04-22 18:34 by 78-21-206-53.access.telenet.be
Book12B
'''sketchbook #12-B46A6/Q''' sept 1991 - feb 1992 [[thumb:Book12B_Cover|300px]] . . .
1K - last updated 2012-09-06 13:19 by Auriea
Book45
SketchBooks [[thumb:Book45_Cover|400px]] '''Mars Black''' 13 November 2012 - 5 March 2013 ----- [[thumb:Book45_InsidePortrait|200px]] . . . <table/booknav prev, next> prev/l=[[Book46|46.]] next/r=[[Book44|44.]] ----- . . .
1K - last updated 2018-09-09 21:07 by Auriea
Book46
SketchBooks '''Σκύρος''' 06 March 2013 - 26 July 2013 14 x 25 cm handmade, canson mi-tientes paper, . . . ink, watercolor, colored pencil [[thumb:Book46_Cover|300px]] [[thumb:Book46_frontpiece-AEStallings|300px]] . . . ----- [[thumb:Book46_1|200px]][[thumb:Book46_2|200px]][[thumb:Book46_3|200px]][[thumb:Book46_4|200px]][[thumb:Book46_5|200px]][[thumb:Book46_6|200px]][[thumb:Book46_7|200px]][[thumb:Book46_8|200px]][[thumb:Book46_9|200px]][[thumb:Book46_10|200px]][[thumb:Book46_11|200px]][[thumb:Book46_12|200px]] . . . [[thumb:Book46_theaudience|200px]] [[thumb:Book46_metsculpture|200px]] . . . [[thumb:Book46_crouchingvenus|200px]] [[thumb:Book46_sintpietersabdij|200px]] . . .
1K - last updated 2018-09-09 21:06 by Auriea
Book46 1
image/jpeg
1281K - last updated 2014-09-01 23:40 by Auriea
Book46 10
image/jpeg
1419K - last updated 2014-09-01 23:44 by Auriea
Book46 11
image/jpeg
1579K - last updated 2014-09-01 23:44 by Auriea
Book46 12
image/jpeg
1334K - last updated 2014-09-01 23:45 by Auriea
Book46 2
image/jpeg
1400K - last updated 2014-09-01 23:41 by Auriea
Book46 3
image/jpeg
1573K - last updated 2014-09-01 23:41 by Auriea
Book46 4
image/jpeg
1285K - last updated 2014-09-01 23:42 by Auriea
Book46 5
image/jpeg
1489K - last updated 2014-09-01 23:42 by Auriea
Book46 6
image/jpeg
1701K - last updated 2014-09-01 23:42 by Auriea
Book46 7
image/jpeg
1547K - last updated 2014-09-01 23:43 by Auriea
Book46 8
image/jpeg
1579K - last updated 2014-09-01 23:43 by Auriea
Book46 9
image/jpeg
1284K - last updated 2014-09-01 23:44 by Auriea
Book46 Cover
image/jpeg
417K - last updated 2013-07-21 13:19 by Auriea
Book46 crouchingvenus
image/jpeg
717K - last updated 2014-09-01 23:50 by Auriea
Book46 frontpiece-AEStallings
image/jpeg
885K - last updated 2014-09-01 23:53 by Auriea
Book46 maria
image/jpeg
640K - last updated 2014-09-01 23:51 by Auriea
Book46 metsculpture
image/jpeg
229K - last updated 2013-07-21 13:37 by Auriea
Book46 orchidsbarelyopen
image/jpeg
975K - last updated 2014-09-01 23:51 by Auriea
Book46 selfsketchwithskull
image/jpeg
636K - last updated 2014-09-01 23:51 by Auriea
Book46 sintpietersabdij
image/jpeg
909K - last updated 2014-09-01 23:50 by Auriea
Book46 theaudience
image/jpeg
718K - last updated 2013-07-21 13:36 by Auriea
Book46 thedance
image/jpeg
847K - last updated 2014-09-01 23:52 by Auriea
Book46 theview
image/jpeg
1060K - last updated 2014-09-01 23:52 by Auriea
Book47
SketchBooks '''Costumes Anciens et Modernes''' 26 July 2013 - 25 Sept 2013 14.5 x 23 cm handmade, found . . . next> prev/l=[[Book48|48.]] next/r=[[Book46|46.]] ----- . . .
1K - last updated 2018-09-09 21:05 by Auriea
BorisVian
CastOfThousands [[image:BorisVianAaZ]] books: [http://www.artworldbooks.com/pages/search.php?words=Vian&theme=0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16] . . . (1947) and J'irai cracher sur vos tombes (1946, I Shall Spit on Your Graves). Vian's collected . . . It was written in 1943, but published in 1946. After the war he played trumpet in the Left Bank . . . sur vos tombes was written in ten days in 1946 under the pseudonym Vernon Sullivan. Vian had made . . . absurd. L'équarissage pour tous, written in 1946, was a "paramilitary vaudeville in one long act." . . .
8K - last updated 2012-07-02 13:21 by Auriea
CatIdeas
[[Ling]] ==Catification== * plank above michael's desk -> 1m x 30cm ** connect to the projector platform . . . * http://www.zooplus.nl/shop/katten/krabpaal_krabmeubels/krabtonnen/krabtonnen/277865 . . . == Stores == * http://www.purrfectdesign.net == . . .
4K - last updated 2014-10-29 18:32 by Auriea
DancingDrawing
[[Writing]] DrawingDancing [[background:DancingDrawing-image2|repeat #00FF00 scroll top]] '''A report . . . https://c1.staticflickr.com/1/649/23386951742_41aa815b47_b.jpg . . . was had! https://c2.staticflickr.com/6/5781/23465573206_dcbb81bb16_c.jpg [[image:DancingDrawing-image3]] . . .
13K - last updated 2017-02-12 14:58 by Auriea
DigitalPhotography
[[photography]] ===Problems=== # Digital photography is too beholden to past paradigms ## the framing . . . . . .
4K - last updated 2008-11-11 22:55 by Auriea
DigitalSculpture
[[Sculpture]] <center><html><iframe width="240" height="480" src="https://sketchfab.com/models/43253ee0013a4603a7af20069a7c9383/embed?autostart=1&ui_infos=0" . . .
2K - last updated 2017-08-24 00:42 by Au-Danae
Drawing
ElegantMedia ''see also: Projects, ElegantMedia, RandomIdeas, Books, Raphael, DancingDrawing, TheLivingLine'' . . . Art Collections – . . .
2K - last updated 2017-08-23 13:18 by Au-Mercury
FavoriteApps
[[Empire]] * = not for iPad but i use it on iPad anyway ! = Don't know what I would do without it. Convert* . . . Tweetbot! - may absolute favorite twitter . . .
6K - last updated 2013-01-04 14:55 by Auriea
FavoritePodcasts
[[Empire]] ===Antiquity Podcasts=== # Dan Carlin's Hardcore History - https://itunes.apple.com/be/podcast/dan-carlins-hardcore-history/id173001861?mt=2 . . . # The Roman World - http://itunes.apple.com/be/itunes-u/the-roman-world/id547152737 . . .
3K - last updated 2013-01-07 11:59 by Auriea
Flickr
<html> <a data-flickr-embed="true" href="https://www.flickr.com/photos/entropy8/albums/72157669842528051" . . . width="480" height="640" alt="L.O.C.K."></a><script . . .
1K - last updated 2017-08-01 22:49 by Au-Mercury
GreekTragedy
CreativeWriting * [[WikiPedia:Choerilus (playwright)|Choeriluĉs]] * [[WikiPedia:Aeschylus]] (c. 525–456 . . . (472 BCE) ** [[WikiPedia:Seven Against Thebes]] (467 BCE) ** [[WikiPedia:The Suppliants]] (463 BCE) . . .
3K - last updated 2011-01-26 01:33 by Auriea
InSearchOfLostTime
FiftyBooks == ...in Proust the present is always absent. == # SwannsWay # -- # -- # -- # -- # -- # -- . . . GoodReads http://www.goodreads.com/group/show/75460-2013-the-year-of-reading-proust Final Reading Schedule . . .
1K - last updated 2013-01-07 11:50 by Auriea
Indianapolis
OutsideSomeplace http://farm4.static.flickr.com/3518/3718279091_d2008057b9_b.jpg ==free wifi== * http://www.wififreespot.com/in.html . . . Shop - 10 S Johnson LuLu's Electric Cafe - 1460 W 86th St - 317-879-1995 McAlister's Deli - 7711 . . . Shell station - 9599 North Meridian St - 317-846-9748 SimplyeOffice, Inc. - 6351 S. East Street Suite . . . - lobby area - 5151 South East Street - I-465 & 31 South (Exit 2B) - 317-783-5151 Lees Inn . . .
4K - last updated 2020-04-06 17:14 by Auriea-Mercury
KunstendecreetVisieMateriaal
||''P A S T''' || || <center>[[thumb:ToTGames|1020px]]</center> || ||My work with Tale of . . . frameborder="0" allow="autoplay; fullscreen; . . . src="https://sketchfab.com/models/3d471d09451d46188b617228bdc0f47b/embed?autospin=0.2&autostart=1&camera=0&transparent=1&ui_related=0" . . .
5K - last updated 2019-02-26 00:56 by Auriea
LastLifeInTheUniverse
[[Quoth]] http://film.indiefilipino.com/item.php?id=93 http://filmbrain.typepad.com/filmbrain/2004/05/found_in_transl.html . . . But don't open it, it's mine. 23 00:04:46,461 --> 00:04:52,058 Nice place... big... Not . . . 45 00:11:20,621 --> 00:11:23,135 Thank you. 46 00:12:29,021 --> 00:12:31,774 I got to find a . . . allergic to fish. 74 00:14:44,901 --> 00:14:46,414 Sorry. 75 00:14:46,501 --> 00:14:49,299 Thank . . . Did you fuck Jon? 98 00:16:44,261 --> 00:16:46,331 Who told you that? 99 00:16:46,461 --> 00:16:48,736 . . .
27K - last updated 2005-07-24 13:56 by Auriea
Martha
CastOfThousands [[background external:http://farm4.static.flickr.com/3182/2910930013_cb3490c72b.jpg|repeat . . . http://farm4.static.flickr.com/3169/2837461044_214dd5e8aa_b.jpg http://farm4.static.flickr.com/3200/2836838413_11cb9c931f_b.jpg . . .
1K - last updated 2010-04-15 09:53 by Auriea
Mother
[[Games]] [http://mother3.fobby.net/ Mother 3 fan translation project] [http://www.gamefaqs.com/portable/gbadvance/file/914622/42740 . . .
1K - last updated 2007-10-04 13:16 by Auriea
Movies
[[Movies]] <list "Movies"> ----- ''see also: [[Cinema2007]]'', http://www.theauteurs.com/users/81386 . . . # In the Mood For Love/Chungking Express/2046/Fallen Angels - Wong Kar Wai # My Neighbor Totoro . . . ** ChungKingExpress ** InTheMoodForLove ** [[2046]] * HalHartley ** UnbelieveableTruth * PedroAlmodovar . . .
1K - last updated 2009-07-06 12:34 by Auriea
MovingToRome
https://www.belgium.be/nl/huisvesting/verhuizen/naar_het_buitenland https://www.immobiliare.it/agenzie-immobiliari/168346/zanni-roma/ . . .
1K - last updated 2019-05-18 17:15 by Auriea
Murakami interview2
[[Quoth]] from: http://www.sundayherald.com/46885 '''Found in translation''' Haruki Murakami writes about . . .
16K - last updated 2005-10-21 13:52 by Auriea
NothingEverDiesOnTheNet
RandomIdeas ''see also: ImmortalComputing, MemoriesWereMeantToFade'' i used to believe this. not sure . . . i still can. [http://www.daniweb.com/blogs/entry1464.html mega zombie botnets]!! =) related: [::TheStrengthOfWeakTies][http://www.stanford.edu/dept/soc/people/faculty/granovetter/documents/TheStrengthofWeakTies.pdf], . . .
1K - last updated 2007-08-26 20:05 by Auriea
Object 02
ObjectSeries <center><html><nobr><div class="sketchfab-embed-wrapper"><iframe . . . src="https://sketchfab.com/models/3d471d09451d46188b617228bdc0f47b/embed?autostart=1&camera=0&transparent=1&ui_related=0" . . .
6K - last updated 2017-03-28 19:42 by Au-Danae
Paris
OutsideSomeplace ==Next time== * http://www.bourdelle.paris.fr/en * another trip to musee moreau (recently . . . Doubles from 140 euros, around $200 at $1.46 to the euro. The phrase “design hotel” finds . . .
6K - last updated 2015-02-02 16:56 by Auriea
PataX
[[Research]] http://en.wikipedia.org/wiki/Alfred_Jarry Shoplifted from LibFoam:PataX LibFoam:pataphysics . . . potentiality, to their display. --''Mina Loy, 1946, France.'' Pataphor: http://www.paulavion.com/ptest.html . . .
7K - last updated 2008-10-31 00:04 by Auriea
Rome
OutsideSomeplace Living here. ArtSuppliesRoma -------- [[Italy]] ''[[Rome2017]]'' Extended Stay at Academia . . . van de apostel Petrus. Naast hem liggen er nog 146 andere pausen begraven (luguber als je eraan denkt...). . . .
5K - last updated 2021-06-05 11:45 by 93-39-148-146.ip76.fastwebnet.it
Rome2017
OutsideSomeplace [[Roma]] That time we went to Rome and stayed for 5 months. September 2017 - January . . . . . .
3K - last updated 2018-03-29 10:07 by 78-22-179-76.access.telenet.be
RulesOfAcquisition
[[Reference]] Rule 001 » Once you have their money, you never give it back. Rule 002 » The best deal . . . Rule 045 » Ambition knows no family. Rule 046 » Make your shop easy to find. Rule 047 » Don't . . . long as it winds up in your pocket. Rule 146 » Necessity, n. The mother of invention. Profit . . .
10K - last updated 2009-01-17 01:51 by Auriea
SacredTexts
[[mythology]] http://www.sacred-texts.com/index.htm ==Founders of religions== Abraham - claimed as a . . . prophet of Islam, ca. 570-632 Nanak - Sikhism, 1469-1539 Nakayama Miki - Tenrikyo, 1798-1887 Joseph . . .
2K - last updated 2005-12-27 20:10 by Auriea
SightSize
[[drawing]] ''see also: CaproniCasts, LifeDrawing'' ==::BargueDrawing== http://www.learning-to-see.co.uk/bargue-drawings . . . plates: http://picasaweb.google.com/104620822473004383244/BargueBook ==::CastDrawing== sources . . .
2K - last updated 2011-09-24 23:15 by Auriea
SketchBooks
[[thumb:AnneCarson-Candor|600px]] This archive is a work in/of constant progress. '''I welcome you to . . . - Skyros|http://auriea.org/Book46|46.]] . . . 12B - B46A6/Q|http://auriea.org/Book12|12.]] [[image external:http://auriea.org/oddmuse_thumbnail_cache/Book11_Cover/103|Book . . .
8K - last updated 2019-06-07 10:17 by Auriea
StreetView
OutsideSomeplace permalinks to random places. via: http://web.mit.edu/~jmcmicha/www/globegenie/ and http://www.mapcrunch.com/ . . . ==South America== * Buenos Airies [http://web.mit.edu/~jmcmicha/www/globegenie/index.html?llyp=-22.905322,-43.18532,51.72,9.77] . . . ==Antarctica== * penguins! [http://web.mit.edu/~jmcmicha/www/globegenie/index.html?llyp=-62.594036,-59.894441,290.96,13.33] . . .
2K - last updated 2010-12-23 16:42 by Auriea
StudLoan
ProofOfMyExistence ==2017== ||I.17 || $129+179 || $300 (11,04 EURfee) || 285,13 EUR || 20170107 || $1,947 . . . ($12 USD fee) || €296,25 EUR || 20151208 || $3,469.46 || ==2014== || month || mom || USD || EUR || . . . USD fee}} || €316,81 EUR|| 20130121||$4,646.60 + ?? || ||II.13 || $251.27 || $140.64 || $393,00 . . . || ||VI.12 || $251.27 || $141.19 || $392.46 + 100 || €401,68 EUR {{+ $19,53 USD fee}}|| 20120618||$6,298.32 . . . || ||VII.12 || $251.27 || $141.19 || $392.46 || €329,80 EUR {{+ $15,61 USD fee}}|| 20120718||$6,066.08 . . .
14K - last updated 2017-06-16 11:39 by Au-Danae
SwannsWay
InSearchOfLostTime ===Week 2=== thread: [http://www.goodreads.com/topic/show/1046872-through-sunday-13-jan-swann-s-way] . . . thread: [http://www.goodreads.com/topic/show/1046827-through-sunday-6-jan-swann-s-way] * I read it . . .
7K - last updated 2013-01-07 13:05 by Auriea
Synthetic Corpo-Reality
[[Exhibitions]] <aggregate "La_Vita_Nova"> Synthetic Corpo-Reality is inspired by the extended . . . and soundscape in Mozilla Hubs. when i was 46 it was the year after a deep depression. the year . . . I had learned about choosing. when i turned 46 i learned what it was to have chosen. I would go . . . and her death, and about creation. On my 46th birthday I forgave myself. I made two 3d scans . . . new life, a life that i am living right now. At 46, choosing to write incipit vita nova in ink at the . . .
3K - last updated 2021-02-23 13:08 by Auriea
TableOfContents
SketchBooks width in cm. divided by 2 [[thumb:Book49_Cover|75px]] [[thumb:Book48_Cover|65px]] [[thumb:Book47_Cover|72px]] . . . [[thumb:Book46_Cover|80px]] [[thumb:Book45_Cover|57px]] [[thumb:Book44_Cover|80px]] . . .
2K - last updated 2014-09-09 14:27 by Auriea
TheAeneid
''see also: http://auriea.de'' For Aeneas in Book 3 - Halfway between Delos and Crete <center><html><iframe . . . . . .
1K - last updated 2017-08-14 14:32 by Au-Mercury
TheAntichrist
[[Mythology]] 46 Prophecies the Antichrist will fulfill # The antichrist will be a man - Daniel 7:24-25 . . .
9K - last updated 2009-06-25 09:25 by Auriea
TheSandman
FiftyBooks A GraphicNovel series written by NeilGaiman. Covers by DaveMcKean. [http://spiffyness.net/dream/ . . . Watches II, DC Comics, 1993 ''Sandman #46'', Life Isn't Pleasant, Petrified-The Parting Of . . .
7K - last updated 2010-05-19 14:56 by Auriea
The Archive To Come
<center><html><iframe src="https://player.vimeo.com/video/461163311?title=0&byline=0&portrait=0" . . .
3K - last updated 2021-01-04 12:13 by Auriea
TillWeHaveFaces
FiftyBooks [[thumb:TillWeHaveFaces-scan1]] [[thumb:TillWeHaveFaces-scan2]] [[thumb:TillWeHaveFaces-scan3]] . . . . . .
1K - last updated 2006-11-08 02:29 by Auriea
Twine
ElegantMedia These will be notes about how to use [http://twinery.org twine] ==Resources== * [http://twinery.org/forum/index.php . . . link: http://twinery.org/forum/index.php/topic,2467.0.html ==custom color link=== <code>(set: . . .
2K - last updated 2015-08-06 16:14 by Auriea
WongKarWai
CastOfThousands His films are complex and very romantic. Saturated colors and ornamental sets even if . . . another before giving it up completely. [::2046] Mainly about a playboy writer and his many conquests. . . .
3K - last updated 2007-01-22 01:58 by Auriea
cinamatography
[[Movies]] [::VadimYusov] * tarkovski ** ivan's childhood ** solaris ** etc. [::ChristopherDoyle] * WongKarWai . . . ** in the mood for love ** 2046 ** chungking express ** etc. . . .
1K - last updated 2007-04-05 11:47 by Auriea
color
[[Reference]] ''see also: FavoriteColor'' [::DeadColor] The first layers of paint the artist applies . . . 231, G:081, B:110 Rose Madder R: 166, G:036, B:046 Alizarin Crimson R: 208, G:042, B:064 Permanent . . .
2K - last updated 2013-01-16 12:15 by Auriea
era
[[日本語]] * 645 大化 Taika * 650 白雉 Hakuchi * 654 (Discontinued) * 672 白鳳 Hakuhō * 686 . . . * 1040 長久 Chōkyū * 1044 寛徳 Kantoku * 1046 永承 Eishō or Eijō * 1053 天喜 Tengi * 1058 . . . * 1336 延元 Engen * 1340 興国 Kōkoku * 1346 正平 Shōhei * 1370 建徳 Kentoku * 1372 文中 . . . * 1455 康正 Kōshō * 1457 長禄 Chōroku * 1460 寛正 Kanshō * 1466 文正 Bunshō * 1467 応仁 . . . Ōnin * 1469 文明 Bunmei * 1487 長享 Chōkyō * 1489 延徳 . . .
6K - last updated 2005-06-29 09:29 by wof
exercise
[[Reference]] ''see also: breathe, yoga, meditation, scoliosis'' this series is a little crazy: <html> . . . name="allowFullScreen" . . . type="application/x-shockwave-flash" allowscriptaccess="always" . . . name="allowFullScreen" . . . type="application/x-shockwave-flash" allowscriptaccess="always" . . .
6K - last updated 2011-03-21 18:10 by Auriea
groworld
hexagons <html> <object width="400" height="500"> <param name="flashvars" value="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Ffoam%2Fsets%2F72157610724467408%2Fshow%2F&page_show_back_url=%2Fphotos%2Ffoam%2Fsets%2F72157610724467408%2F&set_id=72157610724467408&jump_to="></param> . . . . . .
10K - last updated 2009-05-21 19:06 by Auriea
gttgaatgggcggatgctaattactatctcccgaaagaatccgcatacca
<pre> Séquence de nucléotides de l'ADN du bactériophage lambda (48502 nucléotides, MM=31,5Md) . . . 4601gcattatccggtgatgatgacggaccacgacaggcccgcagttatcaggt . . . 4651catgaacggcatcgccgtgctgccggtgtccggcacgctggtcagccgga . . . 14601tggaggcgacggggctgtatcaggtgccgttgtcagcggcacagccgggc . . . 14651gatgtgctgctgtgctgttttggttcatcagtgccgaatcacgccgcaat . . .
53K - last updated 2004-12-23 22:04 by Auriea
hotglue
* https://hotglue.me/manual#manual.head.130934635562 * https://www.favicon.cc . . .
1K - last updated 2021-03-03 01:43 by Auriea
numbers
[[Reference]] [[image:404]] <center>[[33]]</center> http://www.geocities.com/rmlyra/Numbers.html . . . http://3.141592653589793238462643383279502884197169399375105820974944592.com Greek . . . of 5 items. 45 is a Kaprekar number. 46 is the number of different arrangements (up to rotation . . . in the Fibonacci sequence. 145 = 1! + 4! + 5! 146 = 222 in base 8. 147 is the number of sided 6-hexes. . . . 2 5th powers. 245 is a stella octangula number. 246 = 9C2 + 9C4 + 9C6. 247 is the smallest possible . . .
74K - last updated 2014-05-30 12:49 by Auriea
photography
ElegantMedia http://farm4.static.flickr.com/3397/3203934691_f52381bb57.jpg * polaroid * MediumFormat . . .
2K - last updated 2010-07-05 17:51 by Auriea
say
SongBook Learn to say the same thing Let us hold fast to sayin the same thing I hope all is well with . . . name="FlashVars" value="resourceID=1046689&flp=false" /> <param name="movie" value="http://static.last.fm/webclient/inline/1/inlinePlayer.swf" . . . quality="high" FlashVars="resourceID=1046689&flp=false" bgcolor="#ffffff" width="13" height="13" . . .
2K - last updated 2007-06-05 17:09 by Auriea
trees
[[Research]] [[background external:http://farm4.static.flickr.com/3155/2428209195_46906f733c_o.jpg|repeat . . . http://farm5.static.flickr.com/4008/4519132068_2c517a372d_b.jpg . . .
2K - last updated 2010-04-15 11:13 by Auriea