2005-01-16 sweetheart the night
this morning began with thoughts of making my own little web business and ended with considering if a . . . little website job I could charge as little as 800 Euro... yeah I didn't say the site was gonna be . . .
2K - last updated 2005-01-21 15:15 by wof
2006-08-02
[[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060801_maybesilenthill.flv|320|240|#000000|high|noscale]] . . .
1K - last updated 2006-08-02 04:30 by Auriea
2006-08-03
[[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060803-silenthill5.flv|320|240|#000000|high|noscale]] . . .
1K - last updated 2006-08-03 13:51 by Auriea
2007-08-07
http://home.zuper.com/---2007/20070807_mexico_mariaexvoto.jpg . . .
1K - last updated 2007-08-14 18:47 by Auriea
2007-08-09
http://home.zuper.com/---2007/20070809_mexico_cantina_tequila.jpg . . .
1K - last updated 2007-08-14 18:47 by Auriea
2007-09-09 u92
once again too many thoughts. the fact that i am in a country which could be falling apart. my insistence . . . at a time [http://www.last.fm/forum/21717/_/323980 when i refuse to believe in flags]. got me thinking . . . believing those guys were dead and done for 280 kilometers beneath the sea, on the floor of Gibraltar. . . .
2K - last updated 2007-09-09 21:49 by Auriea
2009-03-30 gdc notes
<html><object width="480" height="295"><param name="movie" value="http://www.youtube.com/v/UcC9-HYX1Ek&hl=en&fs=1&color1=0x5d1719&color2=0xcd311b"></param><param . . . allowfullscreen="true" width="480" height="295"></embed></object></html> . . .
2K - last updated 2009-03-30 11:41 by Auriea
2012-03-12
sunny :) getting back to organized existence after the trip to trouville last week, which threw my schedule . . . . . .
1K - last updated 2012-03-16 19:57 by Auriea
80
A small country has fewer people. Though there are machines that can work ten to a hundred times faster . . .
1K - last updated 2004-08-16 10:38 by wof
80sVideoGameResearch
[[Research]] http://www.stadtmuseum-ks.de/index.php/ausstellungen/aktuelle-sonderausstellung Mi, 5.2.2020, . . . 18 Uhr Neue bunte Welt – Computerspiele in den 80ern Prof. Auriea Harvey, Kunsthochschule Kassel – . . . facts about videogames in the decade. In the 80s there was a videogame mania. Videogames were present . . . era. MUDs, the Demo Scene, text adventures -The 80's brought us the first immersive game worlds, coding . . . we need to look at an alternate history of the 80s where videogames were sometimes not even games . . .
3K - last updated 2020-01-31 03:03 by Au-Elektra
89SecondsAtAlcazar
ElegantMedia <html> <embed src='http://ubu.artmob.ca/video/flash/player-viral.swf' height='480' . . . width='800' allowscriptaccess='always' allowfullscreen='true' . . .
1K - last updated 2009-11-30 18:56 by Auriea
AllYouEverWantedToKnowAboutTempest
[[Tempest]] ==== All you Ever Wanted to Know About TEMPEST ==== from http://library.psyon.org/tempest.txt . . . data base is electroBase. They have over 7,800 manufacturers of all types listed. There's an interesting . . . Management and Systems Engineering, with over 800 pages of total material are available for $200. . . . Air Force Communications Command, January 1980. U.S. Army The U.S. Army Information Systems Engineering . . . classified documents that is referenced is: AR 380-19-1, Control of Compromising Emanations 4 September . . .
44K - last updated 2008-05-02 21:50 by Auriea
AnimalCrossing
[[Games]] http://www.communauteanimalcrossing.fr/jukebox.php <source> Animal Crossing: Wild World . . . Yellow Feather - 500,000 bells. Red Feather - 800,000 bells Purple Feather - 1,100,000 bells White . . .
10K - last updated 2009-01-14 12:16 by Auriea
AnneCarson
CastOfThousands my favorite living poet... if i could be said to have a favorite poet * http://www.poetryfoundation.org/bio/anne-carson . . . ErosTheBittersweet [[tube:zK44lArPXYc&hl 480 385 0]] [[image:GriefLessons]] . . .
1K - last updated 2013-01-06 12:30 by Auriea
AnneSexton
CastOfThousands <html> <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/L4VlcVfgFJk&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> </html> . . .
1K - last updated 2010-05-05 00:26 by Auriea
ApprenticeBookbinder
RandomIdeas http://www.geocities.com/SoHo/Lofts/2123/coperta_08.html seriously, I want to learn a craft. . . . Rozier BVBA Rozier 19 9000 Gent 09 223 53 80 09 233 39 80 It's right around the corner, and yet, . . .
3K - last updated 2005-04-29 09:52 by Auriea
ArtSchool
''see also: OntwikkelingsgerichteBeurs'' ==Online Classes== * http://www.livepaintinglessons.com/colour.php . . . #000000]] . . .
2K - last updated 2013-02-15 14:26 by Auriea
AugmentedReality
DigitalSculpture ==Tools I can use== * ARToolkit https://artoolkit.org/download-artoolkit-sdk ** ARToolkit . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/fWSSdUQF3J0&hl=en_US&fs=1?color1=0xe1600f&color2=0xfebd01"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . .
2K - last updated 2017-03-09 16:39 by Au-Mercury
August2006Travel
DarkSecret SALES PERSON: WM ITINERARY DATE: 25 MAY 06 CUSTOMER NBR: CREATIVE00 LRKYSE PAGE: 01 TO: CREATIVE . . . TICKET LOC.....PVVLPV TICKET NUMBER.....DL 1380325086 wendy mcartney travel people inc 35 greenwich . . .
2K - last updated 2006-06-19 10:16 by Auriea
BBCOresteia
<img src="http://auriea.com/wp-content/uploads/Screenshot-2015-06-08-18.57.28.png" alt="Screenshot . . . (more on that in another post.) I found this 80's interpretation to be powerful. I, for one, enjoyed . . . of the words is aided by the funky, very 80's, musical accompaniment. And I found the staging . . .
5K - last updated 2017-02-12 14:48 by Auriea
Baklava
[[Food]] Baklava or Baklawa, depends on your preference {{from LJ:roshi}} '''Ingredients''' 10 sheets . . . up a little as it cools. Preheat oven to 180C. Process the walnut pieces until roughly chopped . . .
2K - last updated 2007-01-02 16:24 by Auriea
BientotlEte
[[Games]] http://farm9.staticflickr.com/8351/8290258741_f2dea181b6_b.jpg http://farm9.staticflickr.com/8492/8291317362_c12fef80e5_b.jpg . . .
1K - last updated 2013-01-14 14:11 by Auriea
BillViola
CastOfThousands ''see also: ElegantMedia'' much more to mention here later * http://www.museumca.org/exhibit/exhi_viola.html . . . <html> <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/D_urrt8X0l8&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> <object . . . width="480" height="295"><param name="movie" value="http://www.youtube.com/v/eTakwOpWqG4&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="295"></embed></object> <object . . .
2K - last updated 2010-02-24 16:38 by Auriea
BlenderNormalMaps
Blender ==Step by Step== * material node tutorial and reference http://www.geneome.net/blender/writtentutorials/matnodes.html . . . <object width="640" height="480"><param name="movie" value="http://www.youtube.com/v/gyi5_RHHDx0&hl=en&fs=1"></param><param . . . allowfullscreen="true" width="640" height="480"></embed></object> </html> . . .
2K - last updated 2009-08-01 17:17 by Auriea
Book41
SketchBooks '''BELGIË/BELGIQUE''' 18 Aug 2011 - 17 feb 2012 25.5 x 20 cm [[thumb:Book41_Cover|300px]] . . . [[thumb:Book41_page80-81|300px]] [[thumb:Book41_page92|200px]] <html><iframe . . .
1K - last updated 2018-09-09 21:12 by Auriea
Book41 page80-81
image/jpeg
325K - last updated 2012-09-11 12:12 by Auriea
CCpresentation2006
[[CCretreat2006]] # introduction '''''slide 01 - ToT''''' ## Hi, I am Auriea Harvey. # ToT ## I have . . . displays of flora and fauna. ## We have about 8000 registered players. On average you will find around . . .
7K - last updated 2009-06-29 11:09 by Auriea
CastOfThousands
CastOfThousands any proper account of my life will have to include all of the following people. <list . . . [[image:Monet]] <html><object width="480" height="360"><param name="movie" value="http://www.dailymotion.com/swf/video/x7y80w_1914_creation?additionalInfos=0"></param><param . . . src="http://www.dailymotion.com/swf/video/x7y80w_1914_creation?additionalInfos=0" width="480" height="360" . . . href="http://www.dailymotion.com/video/x7y80w_1914_creation">1914</a></b><br . . .
1K - last updated 2010-08-01 14:24 by Auriea
CatIdeas
[[Ling]] ==Catification== * plank above michael's desk -> 1m x 30cm ** connect to the projector platform . . . http://www.bol.com/nl/p/krabmeubel-segra-35x35x44/9200000026309213/ . . . Designy: http://www.dehuisdiersuper.nl/katten/krabpalen/krabmeubel-ambiente-licht-hout-wi . . .
4K - last updated 2014-10-29 18:32 by Auriea
CeremonyOfInnocence
[[Games]] <html> <object width="700" height="525"><param name="allowfullscreen" value="true" . . . on [http://www.amazon.com/exec/obidos/ASIN/0811806960/ref=sib_rdr_dp/002-8127150-9030436 Amazon]! . . .
10K - last updated 2009-10-29 13:04 by Auriea
ClipStudioPaint
[[Reference]] ==using vector tools== [[tube:deb3wLpjQTg 640 480 0]] . . .
1K - last updated 2014-06-18 15:27 by Auriea
ComputerGeneratedWriting
ElegantMedia Considering my favorite number is the RandomFunction I also have a keen interest in what . . . Permutations] * [http://www.as.wvu.edu:8000/clc The Center for Literary Computing at West . . .
1K - last updated 2005-12-19 20:41 by Auriea
Cyberspace
ElegantMedia [[image:CyberMapLandmarks]] ''lifted from: https://web.archive.org/web/19970207225527/http://pespmc1.vub.ac.be:80/CYBSPACE.html'' . . .
5K - last updated 2020-01-03 00:31 by Au-Elektra
DSBrowserTranslation
[[Games]] ===== ===== NINTENDO DS OPERA WEB BROWSER FAQ (INCLUDES A SETTINGS MENU TRANSLATION) 4.05 ===== . . . or call Nintendo of America toll-free at 1-800-255-3700 to determine the cause (even though the . . . Note 3 below [ Zoom In / Out ] - Modes are 50% - 80% - 100% - 120% - 150% [ In SSR Mode - Go to End . . . Search Engine Settings ] Default Zoom [ ]50% [ ]80% [X]100% [ ]120% [ ]150% ----- ----- TEXT ENCODING . . .
27K - last updated 2007-01-10 13:03 by Auriea
DancingDrawing
[[Writing]] DrawingDancing [[background:DancingDrawing-image2|repeat #00FF00 scroll top]] '''A report . . . out. https://c1.staticflickr.com/1/573/23200077780_0bccc78a41.jpg Each of us invented a repeatable . . . https://c2.staticflickr.com/6/5809/23491759575_32e0cc93a4.jpg Next, on a mural-sized . . .
13K - last updated 2017-02-12 14:58 by Auriea
DigitalSculpture
[[Sculpture]] <center><html><iframe width="240" height="480" src="https://sketchfab.com/models/43253ee0013a4603a7af20069a7c9383/embed?autostart=1&ui_infos=0" . . .
2K - last updated 2017-08-24 00:42 by Au-Danae
DorothyParker
[[Quoth]] [[image:MarieOfRoumania]] [[tube:7TMb8yImWSU 380 300 0]] . . .
1K - last updated 2007-04-05 20:44 by Auriea
FavoriteApps
[[Empire]] * = not for iPad but i use it on iPad anyway ! = Don't know what I would do without it. Convert* . . . iFiles - a way to put miscellaneous documents . . . Glo Bible! - this is the first thing that has . . . https://itunes.apple.com/be/app/nyan-cat!/id432805198?mt=8 https://itunes.apple.com/be/app/noby-noby-boy/id355479163?mt=8 . . .
6K - last updated 2013-01-04 14:55 by Auriea
FilamentList
[[3dPrinting]] <center>[[thumb:FilamentHeads|400px]]</center> <center>'''FILAMENT LIST'''</center> . . . temps (+/-140-160°) are better. low heat bed, 80% print speed of PLA, 110% flow rate: gives very . . . FAQ] print at 170 – 180° C, heated bed max. 40°C treat your mold at ~ . . .
4K - last updated 2020-11-19 14:39 by 93-39-148-182.ip76.fastwebnet.it
Flash
[[Reference]] ==''"The only HTML i need is the embed tag"''== I will begin again my learning of flash. . . . Viewer Admin] * [http://www.iparigrafika.hu:16080/pageflip Page Flip] but even better: http://www.page-flip.com/ . . .
2K - last updated 2007-05-05 13:47 by Auriea
FlatFoot
==How to cure Flat Feet== strange because i'm sure i researched this before and there was nothing on . . . . . .
3K - last updated 2016-05-14 19:05 by Auriea
Flickr
<html> <a data-flickr-embed="true" href="https://www.flickr.com/photos/entropy8/albums/72157669842528051" . . . width="480" height="640" alt="L.O.C.K."></a><script . . .
1K - last updated 2017-08-01 22:49 by Au-Mercury
GamesImLookingForwardTo
[[Games]] <html><object id="flashObj" width="486" height="412" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" . . . /><param . . . value="videoId=35247354001&playerID=22881388001&domain=embed&" /><param name="base" . . . bgcolor="#FFFFFF" . . . base="http://admin.brightcove.com" . . .
3K - last updated 2009-09-26 22:27 by Auriea
GreekTragedy
CreativeWriting * [[WikiPedia:Choerilus (playwright)|Choeriluĉs]] * [[WikiPedia:Aeschylus]] (c. 525–456 . . . (409 BCE) * [[WikiPedia:Euripides]] (c. 480–406 BCE): ** [[WikiPedia:Alcestis (play)|Alcestis]] . . .
3K - last updated 2011-01-26 01:33 by Auriea
HDRI
[[Research]] what is HDR?[http://www.google.com/search?client=safari&rls=en-us&q=what%20is%20HDR&ie=UTF-8&oe=UTF-8] . . . http://www.flickr.com/groups/hdr/discuss/40580/ . . .
1K - last updated 2008-01-21 13:31 by Auriea
HomebrewDS
[[Games]] MakingDSGames latest firmware - http://dshere.com/ http://www.handheldsources.com/M3DS/Download_M3DSS.html . . . * ds . . .
5K - last updated 2010-10-06 10:27 by Auriea
Hucisko
[[Poland]] <center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" . . . height="480" src="https://sketchfab.com/models/04d4f3a310d742fc8a71498ffc8917ef/embed" . . .
1K - last updated 2017-08-14 14:35 by Au-Mercury
ICO
[[tube:SEMdx6fPkoA 640 480 0]] [[tube:F0b3sOJ6BeM 640 480 0]] . . .
1K - last updated 2007-12-18 19:48 by Auriea
Indianapolis
OutsideSomeplace http://farm4.static.flickr.com/3518/3718279091_d2008057b9_b.jpg ==free wifi== * http://www.wififreespot.com/in.html . . . Bjava Coffee and Tea - 5510 Lafayette Rd - 317 280 1236 Boulevard Place Caf� - Butler Tarkington . . . Bread - 2902 West 86th Street - (317) 334-7800 Panera Bread - 55 South Raceway Road - (317) 273-8820 . . . 8811 Hargegan St - 317 882 7997 Shapiro's Deli - 808 S Meridian St - 317.631.4041 Shell station - 9599 . . . East Street Suite A Spencer's Stadium Tavern - 802 S West St - 317 916 8888 Stanton Coffee Company . . .
4K - last updated 2020-04-06 17:14 by Auriea-Mercury
InteractiveFiction
[[Games]] ==Notes:== * A Definition of Narrative: http://en.wikipedia.org/wiki/Narrative * ChrisCrawfordsDefinitionOfInteractivity . . . E_WEB Interface * http://iris.scripters.be:1180/ also has the ability to connect to the MOO via . . .
4K - last updated 2007-12-11 13:42 by Auriea
JadePlant
TuinPlanten [[thumb:2005-06-04 JadePlant|frame|right|I bought this at the plant store around the corner. . . . Jades are best grown between 55F at night and 75-80F during the day, however they will tolerate temperatures . . .
5K - last updated 2005-06-04 22:00 by Auriea
JamesBaldwin
CastOfThousands [[tube:hDjaqhuSqQE 640 480 0]] . . .
1K - last updated 2009-01-09 22:18 by Auriea
KaardeBol
TuinPlanten http://oregonstate.edu/dept/nursery-weeds/weedspeciespage/teasel/flowers_2_250.jpg Common . . . Chalky/alkaline, Well-drained/light Height: 180cm Spread: 80cm Time to plant seeds: April to May . . .
1K - last updated 2005-06-05 10:23 by Auriea
KunstendecreetVisieMateriaal
||''P A S T''' || || <center>[[thumb:ToTGames|1020px]]</center> || ||My work with Tale of . . . ||[[thumb:CricoterieScreenshot|800px]]|| ||project url: http://song-of-songs.org/cricoterie/ . . . width="280" height="500" src="https://sketchfab.com/models/3d471d09451d46188b617228bdc0f47b/embed?autospin=0.2&autostart=1&camera=0&transparent=1&ui_related=0" . . . width="280" height="500" src="https://sketchfab.com/models/1a43c5fc8b0e4c39bace1891570f5684/embed?autospin=0.2&autostart=1&camera=0&transparent=1&ui_related=0" . . . ||[[vimeo:310987804 600 400 0]]|| ||[[thumb:StJTB-Prints|400px]]|| . . .
5K - last updated 2019-02-26 00:56 by Auriea
LastFM
RssFeeds http://loczek.webd.pl/cover/?u=womanonfire&i=10&s=100 <html> <a href="http://www.last.fm/user/womanonfire/?chartstyle=basicrt10"><img . . . . . . . . .
4K - last updated 2010-05-21 13:48 by Auriea
LastLifeInTheUniverse
[[Quoth]] http://film.indiefilipino.com/item.php?id=93 http://filmbrain.typepad.com/filmbrain/2004/05/found_in_transl.html . . . Bitrate: 908 kbps Video Codec: XviD Audio: 48000hz, 16bps, 2ch MP3 VBR File Size: 716.7 MB Genre: . . . maybe Brazil. 48 00:12:35,021 --> 00:12:38,809 Japan is better, fuck overseas. 49 00:12:38,901 . . . here. 79 00:15:02,741 --> 00:15:04,379 Nid! 80 00:15:06,581 --> 00:15:08,299 Nid! 81 00:15:12,421 . . . go for girl? 164 00:33:29,661 --> 00:33:32,380 Can I go to your house? 165 00:33:34,581 --> . . .
27K - last updated 2005-07-24 13:56 by Auriea
LocationLocationLocation
<html> <head> <meta charset="utf-8" /> <meta http-equiv="X-UA-Compatible" content="IE=edge" . . . 50 50" gps-entity-place="latitude: 41.905480; longitude: 12.458780;" ></a-text> <a-camera . . .
1K - last updated 2020-03-27 16:05 by Auriea-Mercury
LouiseBourgeois
CastOfThousands [[image:Louise]] 25/12/1911- 31/05/2010 [[Img:Louise Bourgeois]] http://www.deutsche-bank-kunst.com/art/2004/9/e/1/293.php . . . her domestic environment, Bourgeois's move in 1980 to an expansive studio in an abandoned garment factory . . .
3K - last updated 2010-06-01 19:24 by 78-21-207-92.access.telenet.be
MamaDoris
CastOfThousands [[flash:http://auriea.com/live.swf?thePic=http://keystrokes.org/Webcam.jpg&|160|120|#000000|best|exactfit]] . . . of the holy triumverate MamaSkinner? (????-1980?) MamaDora? (november 13, 1923?-2002?) MamaDoris . . .
1K - last updated 2010-05-21 13:37 by Auriea
Martha
CastOfThousands [[background external:http://farm4.static.flickr.com/3182/2910930013_cb3490c72b.jpg|repeat . . . http://farm4.static.flickr.com/3235/2700984718_9ec18476e5_b.jpg . . .
1K - last updated 2010-04-15 09:53 by Auriea
Movies
[[Movies]] <list "Movies"> ----- ''see also: [[Cinema2007]]'', http://www.theauteurs.com/users/81386 . . . Bergman # JEANNE DIELMAN, 23 QUAI DU COMMERCE, 1080 BRUXELLES - Chantal Ackerman # Black Orpheus ==Admired== . . .
1K - last updated 2009-07-06 12:34 by Auriea
MuziekLes
MySong i will take music lessons in the summer. i want to better understand the music i love so much. . . . muziekacademie.gent@pantarhei.be <source> 180 Euro Inschrijvingsdata Gent tijdens opendeurdag . . .
2K - last updated 2007-10-07 20:47 by Auriea
NoQuarter
''for screenshots see: [[Minorinth]]'' ==Working Title: MINORINTH/LABYTAUR== <center>[[thumb:Minorith-lookfeel|600px]] . . . A site-specific VR environment for [http://gamecenter.nyu.edu/events/no-quarter/no-quarter-2017/ . . . [[thumb:Minorinth-UglyAlphaImages|800px|frame|left|''Ugly Alpha Images'']] </center> . . . ===Conceptual=== * [[vimeo:130888009 560 315 0]] * [[tube:O0VIxubUu4c 560 315 0]] ===Technical=== . . . width="80%" height="480" src="https://sketchfab.com/models/6c18376147ef421788740f5b7593d250/embed" . . .
6K - last updated 2018-09-29 23:01 by Auriea.
OnNotWinningTheNobelPrize-DorisLessing
[[Quoth]] Nobel Lecture December 7, 2007 On not winning the Nobel Prize I am standing in a doorway looking . . . heap and learned from it. On Independence in 1980 there was a group of good writers in Zimbabwe, truly . . .
27K - last updated 2007-12-09 23:39 by Auriea
Painter
[[Reference]] to get Painter 6 to run on modern system: http://dev.depeuter.org/metacreations_fix_30.php . . . into Winhex 9) fill the bump image block with 0x80; this value is a midtone grey and will de-bumpify . . .
7K - last updated 2015-10-17 15:12 by Auriea
Paris
OutsideSomeplace ==Next time== * http://www.bourdelle.paris.fr/en * another trip to musee moreau (recently . . . rue Navarin; Ninth Arrondisement; 33-1-4878-3180.) Each room is uniquely decorated on the theme of . . .
6K - last updated 2015-02-02 16:56 by Auriea
PeopleDie
CastOfThousands <tt> MamaSkinner.....18??-1980 MamaDora.....19??-2003? Uncle Ross.....?? Aunt Jo.....?? . . .
1K - last updated 2007-01-10 12:54 by Auriea
Photogrammetry
[[3D]] ''see also: PhotogrammetryFromVideo'' <html> <iframe width="640" height="480" src="https://sketchfab.com/models/0aaf3716c92b4ffeba39ac82319b7d55/embed" . . .
2K - last updated 2017-05-30 19:08 by Au-Mercury
PleasePleasePlease
SongBook [[tube:rMlDbhaI6n8 640 480 0]] . . .
1K - last updated 2009-01-09 22:20 by Auriea
PopularCulture
[[Quoth]] ''Excerpts{{lifted from http://pubpages.unh.edu/~dml3/880williams.htm}} from Raymond Williams{{linked . . . grace of culture hath been utterly unknown (1805), and Jane Austen (Emma, 1816) 'every advantage . . . physical application in bacteriology since the 1880s, 'germ culture. But once we go beyond the physical . . . of the common peoples good will and favor (1580) (where popular was still a term of policy rather . . .
20K - last updated 2005-01-09 15:48 by Auriea
Prado
[[Madrid]] <html><img src=http://www.auriea.org/data/static/2010-02-19.jpg> Velazquez <3 . . . DEI</a> Robert Campion "<a . . . Giant book of Bosch!</a> . . .
3K - last updated 2010-02-24 16:30 by Auriea
ProjectProject Cyclops
<html> <model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/Cyclops_standing/gltf/cyclops_standing.glb" . . . --poster-color:#000000; --progress-bar-color:#ff8080; --progress-bar-height:100px; --progress-mask:#000000;"><button . . .
2K - last updated 2020-02-26 00:28 by Au-Elektra
ProjectProject Leviathan
<html><model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/Leviathan/gltf/Leviathan.glb" . . . --poster-color:#000000; --progress-bar-color:#ff8080; --progress-bar-height:100px; --progress-mask:#000000;"> . . .
2K - last updated 2020-02-26 00:30 by Au-Elektra
ProjectProject Polyphemau
<html><model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/Cyclops_head/gltf/Cyclops_head.glb" . . . --poster-color:#000000; --progress-bar-color:#ff8080; --progress-bar-height:100px; --progress-mask:#000000;"> . . .
2K - last updated 2020-02-26 00:27 by Au-Elektra
ProjectProject TheMystery
<html><model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/TheMystery/gltf/TheMystery2.glb" . . . --poster-color:#000000; --progress-bar-color:#ff8080; --progress-bar-height:100px; --progress-mask:#000000;"> . . .
2K - last updated 2020-02-26 00:31 by Au-Elektra
RandomFunction
RandomIdeas <html> <SCRIPT language="JavaScript"> <!-- function get_random() { var ranNum= . . . rnd() { rnd.seed = (rnd.seed*9301+49297) % 233280; return rnd.seed/(233280.0); }; function rand(number) . . .
2K - last updated 2005-12-26 13:32 by Auriea
RebeccaHorn
CastOfThousands [[image:infestation]] Img:Rebecca+Horn http://www.guardian.co.uk/artanddesign/2005/may/23/art . . . to me, and I make something." In the early 1980s she was filming a piece in Italy that needed a . . .
9K - last updated 2009-11-18 02:45 by Auriea
Ruins
[[Projects]] Photogrammetry created from Youtube HD drone video of the ruins of Homs, Syria https://www.youtube.com/watch?v=DoRdCbDd50o&t=31s . . . [https://www.google.be/maps/place/Homs%E2%80%8E,+Syria/@34.6663288,36.1618508,8.94z/data=!4m5!3m4!1s0x15230e9047c7c0fb:0xac367e06303788d0!8m2!3d34.7324273!4d36.7136959] . . . width="80%" height="480" src="https://sketchfab.com/models/9bf395f77a4347fdbd5566a65ccfebbe/embed" . . . width="80%" height="480" src="https://sketchfab.com/models/ff68d7b40ddd41e0aa58288cdbbcfa18/embed" . . . width="80%" height="480" src="https://sketchfab.com/models/b7cb782fdd224c40a997d5818b13e4a8/embed" . . .
3K - last updated 2017-09-15 23:37 by Au-Danae
RunsInTheFamily
SongBook [[tube:O_JFjY5Y0Os 640 480 0]] . . .
1K - last updated 2009-03-07 22:28 by Auriea
SacredTexts
[[mythology]] http://www.sacred-texts.com/index.htm ==Founders of religions== Abraham - claimed as a . . . - Church of Jesus Christ of Latter-day Saints, 1805-1844 Charles Taze Russell - Jehovah's Witnesses . . .
2K - last updated 2005-12-27 20:10 by Auriea
Scans
[[foreground:none|#000000]] <center>[[thumb:artemis.png|1080px]]</center> <center>See . . . width="1080" height="480" src="https://sketchfab.com/models/a8ab38d1422040dd94d95226d341a1dc/embed" . . . width="1080" height="480" src="https://sketchfab.com/models/6c18376147ef421788740f5b7593d250/embed" . . . . . .
1K - last updated 2018-12-24 15:38 by Auriea.
Sculptris
[[Reference]] Downloaded an os x version which runs under WINE [http://www.zbrushcentral.com/showthread.php?t=91628&page=2&pp=15|here.] . . . up config.txt Change the values window_width 1280 window_height 800 window_maximized 0 Save! That . . .
1K - last updated 2010-12-16 19:44 by Auriea
SightSize
[[drawing]] ''see also: CaproniCasts, LifeDrawing'' ==::BargueDrawing== http://www.learning-to-see.co.uk/bargue-drawings . . . ----- http://www.sightsize.com '''So what . . .
2K - last updated 2011-09-24 23:15 by Auriea
SketchBooks
[[thumb:AnneCarson-Candor|600px]] This archive is a work in/of constant progress. '''I welcome you to . . . - Skyros|http://auriea.org/Book46|46.]] [[image . . . 44 - FEU ET FLAMME|http://auriea.org/Book44|44.]] . . . 40 - #planV|http://auriea.org/Book40|40.]] . . .
8K - last updated 2019-06-07 10:17 by Auriea
StJTB
==CLAY== <center>[[vimeo:310987804 720 398 0]] Sculpture in clay, from a live model. Made in Studio . . .
1K - last updated 2019-03-28 15:41 by Auriea
Story
ElegantMedia [[tube:U82eWptFxSs 640 480 0]] . . .
1K - last updated 2008-11-20 11:25 by Auriea
StudLoan
ProofOfMyExistence ==2017== ||I.17 || $129+179 || $300 (11,04 EURfee) || 285,13 EUR || 20170107 || $1,947 . . . || $129+179 || $300 USD ($12 USD fee) || €295.80 EUR || 20160111 || ?? || ||II.16 || $129+179 || . . . USD+55 ($14.15 USD fee) || €340,19 EUR || 20160802 || $2,509.78 || ||IX.16 || $129+179 || $300 ($12 . . . USD ($11,18 USD fee) || €271,90 EUR || 20150802 || ?? || ||IX.15 || $129+150 || $279 USD ($11,18 . . . class)+$24,87(fee)}} USD || €505,23 EUR|| 20130809||$2,602.31 + ?? || ||IX.13 || $338.88 || $139.19 . . .
14K - last updated 2017-06-16 11:39 by Au-Danae
SunRa
[[Quoth]] [[tube:x0UVHsEWxYI 640 480 0]] . . .
1K - last updated 2008-07-05 14:51 by Auriea
TableOfContents
SketchBooks width in cm. divided by 2 [[thumb:Book49_Cover|75px]] [[thumb:Book48_Cover|65px]] [[thumb:Book47_Cover|72px]] . . . [[thumb:Book46_Cover|80px]] [[thumb:Book45_Cover|57px]] [[thumb:Book44_Cover|80px]] . . . [[thumb:Book40_Cover|80px]] [[thumb:Book39_Cover|43px]] [[thumb:Book38_Cover|45px]] . . .
2K - last updated 2014-09-09 14:27 by Auriea
TheAeneid
''see also: http://auriea.de'' For Aeneas in Book 3 - Halfway between Delos and Crete <center><html><iframe . . . width="80%" height="450" frameborder="0" style="border:0"></iframe></html></center> . . .
1K - last updated 2017-08-14 14:32 by Au-Mercury
TheFlowerSeller
<html><center><div class="sketchfab-embed-wrapper"><iframe width="90%" height="750" . . . src="https://sketchfab.com/models/65a825dbcf694801968adfbf823a4148/embed" frameborder="0" allowvr . . .
1K - last updated 2018-03-09 16:15 by Au-Mercury
TheFourByFive
[[photography]] http://farm3.static.flickr.com/2367/2518960124_4d245c7134.jpg --i think i lost part of . . . # SEIKOSHA-SLV Commercial Astragon 1:6.3 f=180mm (7 1/8") No.83481 6.3 - 63 . . .
1K - last updated 2009-02-22 14:05 by Auriea
TheFuries
[[mythology]] Aeschylus The Eumenides ''The Kindly Ones'' 458 BC ''This translation, which has been prepared . . . the blame arising from his mother's murder. [580] Start the trial. You understand procedure. Confirm . . .
53K - last updated 2006-06-02 20:58 by Auriea
TheSymbolsOnMyFlagAndWhatTheyMean
'''THE SYMBOLS ON MY FLAG (AND WHAT THEY MEAN)''' {{http://www.newyorker.com/humor/2008/05/19/080519sh_shouts_handey}} . . .
4K - last updated 2008-05-13 00:04 by d54C6FF9F.access.telenet.be
ThroughAGlassDarkly
[[Reference]] [[tube:-SPfJIlkT_Y 640 480 0]] [http://www.bergmanorama.com Ingmar Bergman] . . .
1K - last updated 2008-01-17 01:44 by Auriea
ToWatch
[[Movies]] <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/kxIYuOeAKnw?fs=1&hl=en_US"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . . <html> <object width="640" height="480"><param name="movie" value="http://www.youtube.com/v/2U7-QiLYwrQ&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="640" height="480"></embed></object> <object width="480" . . . allowfullscreen="true" width="480" height="385"></embed></object> <object . . .
3K - last updated 2011-01-12 19:41 by Auriea
Ultimaker3
[[3dPrinting]] =This Much I Know= # PLA is: ## brittle, don't drop it ## '''moisture in your PLA filament . . . dryer [https://www.thingiverse.com/thing:1618037] #### I actually made this and it works very well. . . .
2K - last updated 2017-08-23 17:54 by Au-Mercury
UnderTheSea
[[image:lobster]] Dr. O'Dor was on a cruise to the Arctic last year that made a number of finds, including . . . project that involves 2,000 researchers from 80 countries trying to get a handle on what is living . . .
3K - last updated 2006-12-12 15:10 by Auriea
VIDEOGAMES
1) Bientôt l’été, 2011 http://tale-of-tales.com/bientotlete A holodeck beach simulation. Entertainment . . . 3. Luxuria Superbia, 2013 Something completely . . .
2K - last updated 2020-06-15 22:30 by Auriea-Mercury
VelvetPlant
TuinPlanten [[thumb:2005-06-04_VelvetPlant|frame|right|the latin name is Gynura but it is also known . . . artificial ligth is available, provide at least 800 foot candles. Will also do well in curtain filtered/indirect . . .
3K - last updated 2005-07-14 11:22 by 84.194.164.18
VijaCelmins
CastOfThousands <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/tORoyCJtO4o&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . .
1K - last updated 2010-05-05 00:31 by Auriea
Vimeo
[[Empire]] <html> <iframe src="http://player.vimeo.com/video/18599827" width="400" height="300" . . . float:left; margin:0 10px 10px 0; width:80px; line-height:0; } .vimeoBadge .caption { font: . . . 11px verdana,sans-serif; overflow:hidden; width:80px; } .vimeoBadge .clear { display: block; clear: . . . </div> . . .
2K - last updated 2011-04-05 12:40 by Auriea
VincentDesiderioLectureNotes
[[Painting]] [[tube:GxRN9tcN6pQ 640 480 0]] # this talk is about how to control color temperature and . . .
8K - last updated 2014-08-21 13:50 by Auriea
WarsawFoksalGalleryShow2019
<html> <div class="sketchfab-embed-wrapper"><iframe width="640" height="480" src="https://sketchfab.com/models/be76382be40a4574b96b7c6b59a79c8b/embed?autospin=0.2&autostart=1&camera=0" . . . width="640" height="480" src="https://sketchfab.com/models/04d4f3a310d742fc8a71498ffc8917ef/embed?autospin=0&autostart=1&camera=0" . . . width="640" height="480" frameborder="0" webkitallowfullscreen mozallowfullscreen . . .
1K - last updated 2019-02-25 15:26 by Auriea
XLVI
<center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" height="700" . . . src="https://sketchfab.com/models/65a825dbcf694801968adfbf823a4148/embed?autospin=0.2&autostart=1&transparent=1&ui_related=0" . . . width="90%" height="480" src="https://sketchfab.com/models/e198edf528164788910136043bec0f78/embed" . . .
1K - last updated 2017-09-15 23:44 by Au-Danae
YoshinoyaAuthenticGyudonRecipe
[[Food]] 日本 ===YOSHINOYA AUTHENTIC GYUDON, TOLD TO ME BY A VERY KNOWLEDGABLE JAPANESE GIRL{{lifted . . . If you have an asian food store, you’re set. * 80g of Chopped Beef. You have to chop this thinly. . . .
3K - last updated 2007-08-31 20:39 by Auriea
Yurt
[[Research]] <html><script src="http://flash.revver.com/player/1.0/player.js?mediaId:149791;width:480;height:392;" . . .
1K - last updated 2009-01-04 01:23 by Auriea
ZBrush
DigitalSculpture ZBrush is the only application that makes me think that 3d modeling could be alright . . . Thread about masking with alpha. http://206.145.80.239/zbc/showthread.php?t=23872&highlight=assign+polygroup . . . * [http://206.145.80.239/zbc/showthread.php?t=29617 Zspheres Fundamentals . . .
14K - last updated 2014-09-17 17:07 by Auriea
a2p
<html><model-viewer src="http://auriea.org/models/a2p/SketchForACyclops.glb" ar camera-controls . . . 1vh) * 80);"></model-viewer></html><center>[http://auriea.org/models/a2p/SketchForACyclops.stl . . .
1K - last updated 2019-12-08 00:21 by Auriea.
anatomy
SketchBook ''see also: LifeDrawing'' the differences between man and woman * http://anthropology.si.edu/writteninbone/male_female.html . . . . . .
4K - last updated 2011-09-05 23:47 by Auriea
black.css
[[Empire]] @import url('https://fonts.googleapis.com/css?family=Cardo|Crimson+Text|Quattrocento|Source+Serif+Pro'); . . . serif; color: #c5c5c5; } div.wrapper { padding: 80px 20px 20px 20px; } div.wrapper.close { display: . . . { font: .6em georgia; display: block; color: #700808; background-color: rgba(255, 255, 255, 0.3); padding: . . .
14K - last updated 2017-02-26 09:41 by Auriea
blueblueelectricblue
DigitalSculpture <center><html> <div class="sketchfab-embed-wrapper"><iframe width="1080" . . .
1K - last updated 2018-12-25 15:00 by Auriea.
breathe
ProofOfMyExistence ''see also: exercise, yoga, meditation'' http://www.youtube.com/results?search_query=yoga+breath&aq=f . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/WjbMB5IEUFI&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . .
5K - last updated 2010-07-03 00:49 by Auriea
caryatid
A CARYATID IS A SCULPTED FEMALE FIGURE SERVING AS AN ARCHITECTURAL SUPPORT TAKING THE PLACE OF A COLUMN . . . AS IF THEY WERE DANCING PLANTS.” (KERENYI 1980 P 149) SOME OF THE EARLIEST KNOWN EXAMPLES OF CARYATIDS . . .
1K - last updated 2010-08-04 01:04 by Auriea
computer history
[[Empire]] ==prehistory== # brother or sx-70 ?? something (i was 8) # commodore vic 20 !! <3 # mac . . . # Nero <3 Poppea - Corsair One i64, i9/2080Ti (2020) # Zephyrus - MacBook Air (2021) # Aloysius . . .
2K - last updated 2024-12-20 15:29 by Au
css
/* @override http://auriea.org/?* */ @import url('https://fonts.googleapis.com/css?family=Quattrocento+Sans|Quattrocento|Cutive . . . { font: .6em georgia; display: block; color: #700808; background-color: rgba(255, 255, 255, 0.3); padding: . . . H1 a.local{ display: block; padding: 4px 80px; font: 14px "Cutive Mono",courier; letter-spacing: . . .
15K - last updated 2022-03-21 12:38 by Au
css-mob
.mirror, .NavBar, .plinks, .header, .gotobar, .time, .trail, .sidebar, .footer {display:none;} img.upload . . . */ @media only screen and (max-device-width: 480px) { body { font-size: 32pt; line-height: 40pt; . . .
1K - last updated 2009-09-18 20:10 by Auriea
cuirass
<html><iframe src="https://poly.cam/capture/409D21F1-0416-499A-84A1-3CBFB781A1AC/embed" title="polycam . . . capture viewer" style="height:640px;width:480px; frameborder="0"></iframe> <iframe . . . capture viewer" style="height:640px;width:480px;" frameborder="0"></iframe></html> . . .
1K - last updated 2024-09-02 19:26 by Auriea
era
[[日本語]] * 645 大化 Taika * 650 白雉 Hakuchi * 654 (Discontinued) * 672 白鳳 Hakuhō * 686 . . . Hōki * 781 天応 Ten'ō * 782 延暦 Enryaku * 806 大同 Daidō * 810 弘仁 Kōnin * 824 天長 . . . * 1781 天明 Tenmei * 1789 寛政 Kansei * 1801 享和 Kyōwa * 1804 文化 Bunka * 1818 文政 . . .
6K - last updated 2005-06-29 09:29 by wof
exercise
[[Reference]] ''see also: breathe, yoga, meditation, scoliosis'' this series is a little crazy: <html> . . . <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/aZyuvVPDLfk&hl=en_US&fs=1?color1=0x402061&color2=0x9461ca"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> <object . . . width="480" height="385"><param name="movie" value="http://www.youtube.com/v/dRsC1YdXqOc&hl=en_US&fs=1"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . .
6K - last updated 2011-03-21 18:10 by Auriea
father
CastOfThousands Full fathom five thy father lies; Of his bones are coral made; Those are pearls that . . . Stephens died in March 2004, at the age of 80. In past years, the Pearl Harbor tribute on the . . . are fewer than 9,000 survivors living. About 5,800 remain members of the group, down from a high of . . .
7K - last updated 2007-12-19 16:40 by Auriea
gttgaatgggcggatgctaattactatctcccgaaagaatccgcatacca
<pre> Séquence de nucléotides de l'ADN du bactériophage lambda (48502 nucléotides, MM=31,5Md) . . . 801gttgaatgggcggatgctaattactatctcccgaaagaatccgcatacca . . . 1801cgtgggaggcgaaaattggcgaacgtccggatgctgaagtgatggcagag . . . 2801acacagcgacgcaggggacctgcaggattttatgtatgaaaacgcccacc . . . 3801ggtccggctgggaggcgcaaaagtaccgcacctgatgccgggtgactcac . . .
53K - last updated 2004-12-23 22:04 by Auriea
hologram
[[Reference]] * Rabbit Holes™ - http://rabbitholes.com/ A RabbitHole is a 3D Motion Hologram printed . . . digital hologram that contains up to 1280 digital frames of CGI or video imagery. * MIT open . . .
1K - last updated 2008-08-08 12:16 by Auriea
meditation
[[Reference]] ''see also: breathe, exercise, yoga, SacredGeometry'' http://www.youtube.com/user/yogayak#grid/user/F2C08449BC287BC5 . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/Tu-qZugHXfc&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/p/603BD0B03E12F5A1&hl=en_US&fs=1"></param><param . . . type="application/x-shockwave-flash" width="480" height="385" allowscriptaccess="always" allowfullscreen="true"></embed></object></html> . . .
2K - last updated 2010-06-18 09:58 by Auriea
moon
[[Reference]] ''see also:time'' ||January|| Wolf Moon || ||February|| Snow Moon || ||March|| Worm Moon . . . [Polydeuces]is an example of a so-called Trojan . . .
3K - last updated 2007-01-13 21:57 by Auriea
navi
july 2010 - a Motion Computing ls800 i bought for 200 euro off ebay that only half works. this is it's . . .
1K - last updated 2010-07-24 10:45 by Au
numbers
[[Reference]] [[image:404]] <center>[[33]]</center> http://www.geocities.com/rmlyra/Numbers.html . . . squares in 3 ways. 79 is a permutable prime. 80 is the smallest number n where n and n+1 are both . . . with the same digits as another cube. 179 ??? 180 is the total number of degrees in a triangle. 181 . . . of 8th powers needed to sum to any number. 280 ??? 281 ??? 282 is the sum of its proper divisors . . . of overlapping squares of smaller numbers. 480 is the smallest number which can be written as the . . .
74K - last updated 2014-05-30 12:49 by Auriea
omaha
OutsideSomeplace 1980-1981 MamaSkinner died whil i lived here. We drove back to [[indianapolis]] for . . .
1K - last updated 2005-08-09 17:17 by AurieaHarvey
pd
Open Frameworks plus PD https://forum.pdpatchrepo.info/topic/11259/ofelia-pd-external-library-written-with-openframeworks . . . . . .
1K - last updated 2019-07-07 13:16 by Auriea
poetry
[[writing]] <html> <object id="thoughtphoto" style="margin:0; padding:0; overflow-y:hidden; . . . width:100%; height:180px;" data="http://auriea.org/thoughtphotostream.html"></object> . . .
2K - last updated 2013-01-07 12:34 by Auriea
postmodern
ElegantMedia for very good reasons he is my lover From: michael@entropy8zuper.org Subject: Re: Postmodernism . . . "philosophy" in the art schools of the late 80s early 90s i learned it all anyway. just part of . . .
3K - last updated 2006-02-28 23:33 by Auriea
scrying
[[Reference]] [[iframe:http://books.google.es/books?id=Oeb8Ea0kxCUC&lpg=PP1&hl=es&pg=PP1&output=embed|100%|800]] . . .
1K - last updated 2012-09-18 12:36 by Auriea
stalker
[[Quoth]] [[tube:dNiVFCWMrqI 640 480 0]] . . .
1K - last updated 2009-02-07 17:50 by Auriea
testimg
myImages[5][0] = "http://farm4.staticflickr.com/3447/3984562337_fb1ec28287_z.jpg"; myImages[5][1] = "http://farm2.staticflickr.com/1417/5125202669_dce2330777_z.jpg"; . . . "http://farm2.staticflickr.com/1071/5125813482_5805af3082_z.jpg"; myImages[5][4] = "http://farm2.staticflickr.com/1172/5125808762_770179a56e_z.jpg"; . . . myImages[5][13] = "http://farm9.staticflickr.com/8047/8429850036_610c31f900_c.jpg"; myImages[5][14] . . .
2K - last updated 2013-05-30 14:39 by Auriea