1968-06-28
On this day, my husband was born ^_^ . . .
1K - last updated 2006-06-28 19:41 by Auriea
1971-06-02
I was born. [http://en.wikipedia.org/wiki/June_2 Also, on this day...] . . .
1K - last updated 2005-06-05 19:56 by Auriea
1999-01-29
ProofOfMyExistence [[image:Riea-VSOP]] <tt>y must get tripod... just a sec [fakeshop]: telephone . . . life: gate has Art at his back ! life: yea...46 signmonger: just crashed but frankenstein has no . . . (private) oldfashionedphonetypething=718.599.6565 womanonfire -> [fakeshop]: snailconferencing--->212 . . . 614 1676 lia: guy, are these people still around next . . . no danger...not here.. zuper: wof = 0.6, gate = 0.4, fake = 0.1 zuper: wof now 4.3 life: . . .
32K - last updated 2018-09-11 12:03 by Auriea.
2001-11-06
image/jpeg
11K - last updated 2007-12-24 00:20 by Auriea
2003-01-08
it is a funny thing, being married. i want nothing more than for us to be flowers together. ----- for . . . anniversary we bought a bed! yes for the past 6 years Michael and I have slept on a mattress on the . . .
2K - last updated 2013-01-08 20:38 by Auriea
2004-06-02
[[Diary]] my 33rd birthday. michael brought me huge lilies http://entropy8.com/live/index.php?dir=loot . . .
1K - last updated 2004-09-22 09:13 by wof
2004-06-20
it is begun. i will try to make more poetic than realistic. i will do my best to get it out. . . .
1K - last updated 2004-07-25 00:04 by 192.168.0.10
2004-11-04
http://womanonfire.livejournal.com/633234.html i thought i would never write here again but, here goes. . . . insight. I have not lived in the .us for almost 6 years. Don't blame me. But still I apologize for . . .
4K - last updated 2012-06-05 13:49 by Auriea
2005-01-16 sweetheart the night
this morning began with thoughts of making my own little web business and ended with considering if a . . .
2K - last updated 2005-01-21 15:15 by wof
2005-02-06 Spring
More than anything I would like to see the cherry blossoms in Kyoto. --cut-- This is a test. But I meant . . . visual quotations. NotesForANewE8Z ==== 2005-02-06 Spring ==== . . .
1K - last updated 2005-02-07 02:34 by 192.168.123.100
2005-02-07 The Day Before
Today I fixed up the wireless modem. Gave it a nice sensible password so that the whole neighborhood . . . The poor get poorer (and fatter) I weighed 62kg this morning! michael is just this side of 70! . . .
1K - last updated 2005-02-07 19:23 by 192.168.0.9
2005-03-18
today is our anniversary :) http://entropy8zuper.org/godlove/6years.html i guess we still love the net. . . .
1K - last updated 2005-03-18 13:24 by me
2005-03-23 forsaken
My big monitor that i won in 1996 died today. Very sad, and now i am stuck working on a fuzzy and far . . .
2K - last updated 2005-03-23 20:17 by Auriea
2005-03-26
spent the day making a new [[sketchbook]]. i was just in the mood. it is all uneven. i am calling it . . .
1K - last updated 2005-03-26 23:52 by Auriea
2005-05-26 Self Portrait
image/jpeg
60K - last updated 2006-07-09 22:02 by Auriea
2005-06-02 HemelSleutel
image/jpeg
24K - last updated 2005-06-05 13:56 by Auriea
2005-06-04
=== 1 Comment. === this plant has died. long time ago now. most unfortunate because it was beautiful. . . .
1K - last updated 2009-02-11 21:41 by Auriea
2005-06-04 JadePlant
image/jpeg
87K - last updated 2007-01-05 11:39 by Auriea
2005-06-04 VelvetPlant
image/jpeg
95K - last updated 2005-06-04 21:29 by Auriea
2005-06-08 VindgerhoedsKruidInBloom
image/jpeg
96K - last updated 2005-06-22 22:28 by Auriea
2005-06-08 WederikInBloom
image/jpeg
173K - last updated 2005-06-22 22:27 by Auriea
2005-06-11 Self Portrait
image/jpeg
104K - last updated 2006-12-29 16:33 by Auriea
2005-06-11 painting
image/jpeg
39K - last updated 2012-06-05 13:51 by Auriea
2005-06-22 PrikneusInBloom
image/jpeg
193K - last updated 2005-06-22 22:30 by Auriea
2005-06-22 TeunisBloemBloom
image/jpeg
117K - last updated 2005-06-22 22:19 by Auriea
2005-06-24 My desk on a hot day
image/jpeg
140K - last updated 2005-06-24 19:36 by Auriea
2005-06-28 orchids
image/jpeg
77K - last updated 2005-06-29 09:46 by wof
2005-06-28 zBirthdayFlowers
image/jpeg
125K - last updated 2005-06-28 14:38 by Auriea
2005-06-28 zBirthdayFlowers2
image/jpeg
38K - last updated 2005-06-29 09:48 by wof
2005-06-29 forest work
image/jpeg
74K - last updated 2006-11-05 14:57 by Auriea
2005-07-16 painting
image/jpeg
64K - last updated 2006-07-09 22:03 by Auriea
2005-10-06 remembrance of things past
image/jpeg
134K - last updated 2007-01-10 13:13 by Auriea
2006-01-19 crossroads
image/jpeg
23K - last updated 2006-01-20 00:53 by Auriea
2006-01-27 artefact posters
image/jpeg
94K - last updated 2006-01-27 15:06 by Auriea
2006-02-15 endless arcade
image/jpeg
13K - last updated 2006-02-15 19:00 by Auriea
2006-02-17 3stags
image/jpeg
64K - last updated 2007-05-06 14:32 by Auriea
2006-03-13 sick of people heres an owl
image/jpeg
20K - last updated 2006-12-29 16:34 by Auriea
2006-03-31 PERFKT
image/jpeg
32K - last updated 2006-03-31 18:38 by Auriea
2006-04-11 The eight legs of the devil
image/jpeg
84K - last updated 2006-04-11 19:22 by Auriea
2006-04-30 deertile from chad
image/jpeg
53K - last updated 2006-05-02 20:01 by Auriea
2006-05-04 art supplies
image/jpeg
54K - last updated 2006-05-04 19:14 by Auriea
2006-05-04 deer paradox from nik
image/jpeg
63K - last updated 2006-05-04 17:02 by Auriea
2006-05-04 deerpot from nik
image/jpeg
46K - last updated 2006-05-04 18:50 by Auriea
2006-05-07 weapon of choice
image/jpeg
55K - last updated 2006-05-07 10:35 by Auriea
2006-05-08 one last thing
3am normally i would be going to bed about now but instead i'm waking up and getting on a plane. so just . . .
2K - last updated 2006-05-08 03:16 by Auriea
2006-05-09 Berninis grave
image/jpeg
69K - last updated 2006-05-14 21:48 by Auriea
2006-05-11 under the tree
image/jpeg
138K - last updated 2006-05-13 14:31 by Auriea
2006-05-17 lina site launch day
image/jpeg
85K - last updated 2006-05-17 19:27 by Auriea
2006-05-30 muse 12h48
it occurs to me most accutely this day that my biggest problem is that i don't know what i want. that . . .
1K - last updated 2006-05-30 12:51 by Auriea
2006-06-02
My 35th birthday. Michael brought me 8 of the most beautiful roses. They were pink at the middle and . . .
1K - last updated 2006-06-13 19:59 by Auriea
2006-06-02 champagne 10h21
image/jpeg
233K - last updated 2006-06-24 23:38 by Auriea
2006-06-05 The Big German 20h25
image/jpeg
54K - last updated 2006-06-05 20:25 by Auriea
2006-06-07 Story Of My Life 09h21
image/jpeg
22K - last updated 2006-06-07 09:21 by Auriea
2006-06-09 21h40 broken foot drawing
image/jpeg
188K - last updated 2006-06-27 12:08 by Auriea
2006-06-10 08h37 Adam drawing
image/jpeg
145K - last updated 2006-06-17 21:10 by Auriea
2006-06-18 20h36 OFDW17-honglyfinal
image/jpeg
129K - last updated 2006-06-19 09:27 by Auriea
2006-06-24 19h11 OFDW18-Waterhouse-Circe
image/jpeg
218K - last updated 2006-07-09 00:36 by Auriea
2006-06-30 21h25 Our Little Girl
image/jpeg
146K - last updated 2006-07-09 22:29 by Auriea
2006-07-03 20h45 limits of two revisited
image/jpeg
276K - last updated 2013-01-01 16:50 by Auriea
2006-07-07 20h59 FiftyHeads-079
image/jpeg
76K - last updated 2006-07-07 22:59 by Auriea
2006-07-07 22h30 OFDW18-Waterhouse-Circe
image/jpeg
75K - last updated 2006-12-26 17:33 by Auriea
2006-07-09 10h05 FiftyHeads-096-detail
image/jpeg
50K - last updated 2006-12-29 16:33 by Auriea
2006-07-09 11h38 FiftyHeads-096-detail
image/jpeg
102K - last updated 2006-07-09 12:41 by Auriea
2006-07-11 22h09 youth against fascism
image/jpeg
45K - last updated 2006-07-11 22:09 by Auriea
2006-07-12 01h13 FiftyHeads-096
image/jpeg
125K - last updated 2006-07-12 01:13 by Auriea
2006-08-02
[[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060801_maybesilenthill.flv|320|240|#000000|high|noscale]] . . .
1K - last updated 2006-08-02 04:30 by Auriea
2006-08-03
[[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060803-silenthill5.flv|320|240|#000000|high|noscale]] . . .
1K - last updated 2006-08-03 13:51 by Auriea
2006-08-14
image/gif
83K - last updated 2006-08-22 02:57 by Auriea
2006-08-19 birds on wire
image/jpeg
67K - last updated 2006-08-20 17:07 by Auriea
2006-08-19 do you like my new dress
image/jpeg
88K - last updated 2006-08-20 16:54 by Auriea
2006-08-19 fountain
image/jpeg
159K - last updated 2006-08-20 17:06 by Auriea
2006-08-19 larrys wall
image/jpeg
197K - last updated 2006-08-20 17:11 by Auriea
2006-08-20 baloon race
image/jpeg
89K - last updated 2006-08-22 02:51 by Auriea
2006-10-10 mediteranian sea
image/jpeg
202K - last updated 2006-10-12 15:15 by Auriea
2006-11-23
http://www.bigproductions.fr/video_promo/doncavalli/video1.flv . . .
1K - last updated 2006-11-23 14:57 by Auriea
2006-11-24 00h13 dry vine
image/jpeg
46K - last updated 2006-11-24 01:13 by Auriea
2006-11-24 00h16 wolf
image/png
85K - last updated 2006-11-24 01:16 by Auriea
2006-11-30 Bonnie and Clyde
image/jpeg
28K - last updated 2006-11-30 13:14 by Auriea
2006-12-14 15h00 girlhead
image/jpeg
63K - last updated 2006-12-29 16:30 by Auriea
2006-12-16
went today to a long brunch. in aalst. no, not aalst but morsel. so many klein dorpkes in vlaanderen. . . .
1K - last updated 2006-12-16 20:01 by d54C1A28A.access.telenet.be
2006-12-23 cats and dogs
image/jpeg
81K - last updated 2006-12-23 14:12 by Auriea
2006-12-26
patience patience patience patience patience patience patience patience patience patience patience patience . . .
3K - last updated 2006-12-26 17:35 by Auriea
2007-01-06
image/jpeg
39K - last updated 2007-01-07 15:59 by Auriea
2007-01-17
[[image:BlowUp]] the plan worked. i set my alarm months ago to go off tonight. went to see BlowUp at . . . this film, a lot. And it was a fine way to see 60's cinema... large. the plot happens as part of his . . .
2K - last updated 2007-01-18 00:41 by Auriea
2007-02-06
image/jpeg
120K - last updated 2007-02-06 22:32 by Auriea
2007-02-26
image/gif
12K - last updated 2007-02-26 19:48 by Auriea
2007-03-26
I belong in this other place. . . .
1K - last updated 2007-03-26 20:44 by Auriea
2007-04-26
image/jpeg
78K - last updated 2007-04-26 11:53 by Auriea
2007-06-02
image/jpeg
81K - last updated 2007-06-04 15:56 by Auriea
2007-06-11
image/jpeg
140K - last updated 2007-06-11 16:47 by Auriea
2007-06-13
image/jpeg
254K - last updated 2007-06-13 01:51 by Auriea
2007-06-30
image/png
9K - last updated 2007-06-30 19:46 by Auriea
2007-07-16
image/jpeg
81K - last updated 2007-07-16 20:35 by Auriea
2007-09-26
image/jpeg
130K - last updated 2007-09-26 19:24 by Auriea
2007-09-26 21h58 sleeeeeeep
image/jpeg
58K - last updated 2007-09-26 23:58 by Auriea
2007-10-06
and suddenly, its the new century. 7 years late. . . .
1K - last updated 2007-10-06 22:47 by Auriea
2008-01-16
image/jpeg
64K - last updated 2008-01-16 14:20 by Auriea
2008-01-26
image/jpeg
71K - last updated 2008-01-26 20:33 by Auriea
2008-03-29 18h36 SomewhereInTheMiddleLiesTheTruth
image/jpeg
207K - last updated 2008-03-29 21:06 by d54C6FF9F.access.telenet.be
2008-04-16
image/jpeg
83K - last updated 2008-04-16 18:20 by Auriea
2008-05-06
image/png
69K - last updated 2008-05-06 12:16 by Auriea
2008-05-16
image/jpeg
29K - last updated 2008-05-16 23:12 by Auriea
2008-06-02
image/jpeg
131K - last updated 2008-06-04 12:47 by Auriea
2008-06-06 today
image/jpeg
75K - last updated 2008-06-06 22:36 by Auriea
2008-06-06 today2
image/jpeg
54K - last updated 2008-06-06 22:37 by Auriea
2008-06-12
image/jpeg
95K - last updated 2008-06-12 14:47 by Auriea
2008-06-12 2
image/jpeg
163K - last updated 2008-06-12 21:32 by Auriea
2008-06-12 3
image/png
115K - last updated 2008-06-12 21:32 by Auriea
2008-06-13
image/jpeg
69K - last updated 2008-06-13 19:05 by Auriea
2008-06-19
image/jpeg
108K - last updated 2008-06-19 19:08 by Auriea
2008-06-21
image/jpeg
18K - last updated 2008-06-21 20:40 by d54C6FF9F.access.telenet.be
2008-06-22
image/jpeg
170K - last updated 2008-06-22 22:20 by Auriea
2008-06-26
image/jpeg
70K - last updated 2008-06-26 15:41 by Auriea
2008-09-16
image/png
114K - last updated 2008-09-16 14:34 by Auriea
2008-09-16 2
image/jpeg
76K - last updated 2008-09-16 19:58 by Auriea
2008-09-26
image/png
9K - last updated 2008-09-26 11:02 by Auriea
2008-10-16
image/jpeg
180K - last updated 2008-10-18 16:49 by Auriea
2008-11-26
image/jpeg
82K - last updated 2008-11-26 18:51 by Auriea
2008-11-26 toys
image/jpeg
53K - last updated 2008-11-26 19:56 by Auriea
2009-01-16
image/jpeg
107K - last updated 2009-01-16 01:28 by Auriea
2009-03-30 gdc notes
<html><object width="480" height="295"><param name="movie" value="http://www.youtube.com/v/UcC9-HYX1Ek&hl=en&fs=1&color1=0x5d1719&color2=0xcd311b"></param><param . . . his slide: http://farm4.static.flickr.com/3426/3391916861_5ae5d64235.jpg Indeed it was a big theme . . . this is a goal. http://farm4.static.flickr.com/3618/3391916775_0ed0bf1bf4.jpg . . .
2K - last updated 2009-03-30 11:41 by Auriea
2009-04-06
image/jpeg
134K - last updated 2012-06-07 14:41 by Auriea
2009-04-16
image/jpeg
34K - last updated 2009-04-16 20:59 by Auriea
2009-06-03
image/jpeg
47K - last updated 2009-06-03 23:41 by Auriea
2009-06-07
image/jpeg
95K - last updated 2009-06-07 20:48 by Auriea
2009-06-27
image/jpeg
244K - last updated 2009-06-27 21:34 by Auriea
2009-08-16
image/jpeg
133K - last updated 2009-08-20 15:14 by Auriea
2009-08-26
image/jpeg
54K - last updated 2009-08-27 13:58 by Auriea
2009-10-06 the morning after
image/jpeg
161K - last updated 2009-10-06 11:50 by Auriea
2010-02-06
ProofOfMyExistence http://home.zuper.com/---2010/2010-02-06.jpg http://home.zuper.com/---2010/2010-02-06b.jpg . . .
1K - last updated 2010-02-09 20:06 by Auriea
2010-05-06
image/jpeg
251K - last updated 2010-05-06 15:20 by Auriea
2010-05-06 18h54 now
image/jpeg
117K - last updated 2010-05-06 20:55 by Auriea
2010-06-02 at 16-26-50
image/jpeg
63K - last updated 2010-06-18 13:01 by Auriea
2010-06-13 at 2009-47-36
image/jpeg
182K - last updated 2010-06-13 10:00 by Auriea
2010-06-17 at 15-17-17
image/jpeg
88K - last updated 2010-06-18 13:02 by Auriea
2010-06-24 io and jupiter
image/jpeg
168K - last updated 2010-06-24 14:13 by Auriea
2010-06-24 io and jupiter icons
image/jpeg
180K - last updated 2010-06-24 15:13 by Auriea
2010-06-24 silver
image/jpeg
287K - last updated 2010-06-24 17:59 by Auriea
2010-06-28
my love turns 42 today. . . .
1K - last updated 2010-06-28 12:23 by Auriea
2010-06-30 myjrockfandom
image/jpeg
122K - last updated 2010-06-30 20:35 by Auriea
2010-08-06 newpaintbox
image/jpeg
144K - last updated 2010-08-06 17:34 by Auriea
2010-10-26 sketchbookipod
image/jpeg
191K - last updated 2010-10-26 14:06 by Auriea
2011-01-24
http://farm6.static.flickr.com/5217/5384081289_0c2f98d18c.jpg http://farm6.static.flickr.com/5220/5384685608_f29334f390.jpg . . .
1K - last updated 2011-01-24 18:09 by Auriea
2012-03-12
sunny :) getting back to organized existence after the trip to trouville last week, which threw my schedule . . . http://www.flickr.com/photos/entropy8/sets/72157629203803128/ . . .
1K - last updated 2012-03-16 19:57 by Auriea
2012-04-02
https://p.twimg.com/Apd0bKECAAAvX6j.jpg https://p.twimg.com/ApeSOyhCIAARAQh.jpg . . .
1K - last updated 2012-04-02 16:15 by Auriea
2012-06-01
image/jpeg
135K - last updated 2012-06-12 10:56 by Auriea
2012-06-02 hospital drawing
image/jpeg
143K - last updated 2012-09-18 11:27 by Auriea
2012-06-06 Transit of Venus
[[image:Book43_transit]] . . .
1K - last updated 2012-06-07 13:40 by Auriea
2012-12-06
image/jpeg
437K - last updated 2013-01-01 16:49 by Auriea
2014-06-12
image/jpeg
2145K - last updated 2014-06-22 20:19 by Auriea
2014-06-14
image/jpeg
3517K - last updated 2014-06-22 20:20 by Auriea
2014-06-21
image/jpeg
3525K - last updated 2014-06-22 20:21 by Auriea
2014-06-22
image/jpeg
1973K - last updated 2014-06-22 20:19 by Auriea
2014-06-27
image/gif
1776K - last updated 2014-06-27 13:49 by Auriea
2015-06-17 souvenir
image/jpeg
594K - last updated 2015-06-17 16:34 by Auriea
2016-12-23-SelfPortrait
image/jpeg
60K - last updated 2018-09-29 18:13 by Auriea
2019-03-16
image/jpeg
521K - last updated 2019-04-03 16:52 by Auriea
2020-04-06
image/jpeg
2442K - last updated 2020-04-06 15:17 by Auriea-Mercury
2046Poster
image/jpeg
73K - last updated 2005-06-28 16:20 by Auriea
35
She who is centered in the Tao can go where she wishes, without danger. She perceives the universal harmony, . . . inexhaustible. <center><--[[34]] - [[36]]--></center> . . .
1K - last updated 2014-05-30 12:47 by Auriea
36
That which shrinks Must first expand. That which fails Must first be strong. That which is cast down . . .
1K - last updated 2014-05-30 12:47 by Auriea
37
Tao abides in non-action, Yet nothing is left undone. If kings and lords observed this, The ten thousand . . . things would be at peace. <center><--[[36]] - [[38]]--></center> . . .
1K - last updated 2014-05-30 12:46 by Auriea
3dPrinting
DigitalSculpture <center>[[thumb:TestPrints.jpg|600px]]</center> ==3d Printers== # FDM [[Ultimaker3]] . . . tips and tricks== * Keys [[tube:Mz4ztiZDUt8 640 360 0]] . . .
1K - last updated 2020-10-11 11:12 by 93-39-148-182.ip76.fastwebnet.it
3dsMax
[[Reference]] 3 point lighting tutorial: http://www.3dtotal.com/team/Tutorials/Jenns3pt_tut/3ptlighting.asp . . . http://forum.onmac.net/archive/index.php/t-965.html <source> McCloud 6th January 2007, 07:25 . . . Manuliscious 6th January 2007, 08:43 PM This is great man ! it seems . . .
2K - last updated 2008-08-05 14:37 by Auriea
45
The most complete seems lacking. Yet in use it is not exhausted. The most abundant seems empty. Yet in . . . the world. <center><--[[44]] - [[46]]--></center> . . .
1K - last updated 2017-11-25 11:25 by Au-Mercury
46
When the Way governs the world, The proud stallions drag dung carriages. When the Way is lost to the . . .
1K - last updated 2017-11-25 11:26 by Au-Mercury
47
Without going outside, you may know the whole world. Without looking through the window, you may see . . . He works without doing. <center><--[[46]] - [[48]]--></center> . . .
1K - last updated 2019-06-14 22:06 by Au-Roma
6
The valley spirit never dies; It is the woman, primal mother. Her gateway is the root of heaven and Earth. . . .
1K - last updated 2004-08-16 19:29 by wof
80sVideoGameResearch
[[Research]] http://www.stadtmuseum-ks.de/index.php/ausstellungen/aktuelle-sonderausstellung Mi, 5.2.2020, . . . Adventure games Muds The covers vs how they really . . . ==Research links== * Giant list of Classic . . .
3K - last updated 2020-01-31 03:03 by Au-Elektra
96
image/gif
13K - last updated 2006-07-09 22:25 by Auriea
AShortHistoryOfMyth
FiftyBooks Notes, since i bought the book. * Like science and technology, mythology... is not about opting . . . [http://www.amazon.com/gp/product/184195716X/104-6287722-9418308?v=glance&n=283155] '''What . . .
14K - last updated 2012-06-07 16:15 by Auriea
About
<table/about A, B> A/abouttd:[[thumb:2020-04-06|500px]] B/abouttd:http://auriea.art ------ <center> . . . to my homepage.'' This site began on [[2004-06-20]] is Auriea's EncyclopediaOfEverything, where . . .
1K - last updated 2023-10-25 14:19 by 93-42-66-246.ip85.fastwebnet.it
Abraxas
[[mythology]] A term used by the Basilideans, a Gnostic sect of the second century, designating the Supreme . . . when computed numerically equaled the number 365, which is the number of days in the year. It was . . . further believed that Abraxas commanded 365 gods, each possessing a virtue, so there was a virtue . . . Also, a favorite amulet bore the number 365. Later Gnostic symbols were adopted by many societies . . .
2K - last updated 2005-10-22 12:53 by Auriea
AllYouEverWantedToKnowAboutTempest
[[Tempest]] ==== All you Ever Wanted to Know About TEMPEST ==== from http://library.psyon.org/tempest.txt . . . standard was called NAG1A. During the 1960s it was revised and reissued as FS222 and later . . . Security Committee Directive 4, dated January 16, 1981. It instructs federal agencies to protect classified . . . several interesting patents: Patent number 4965606 - Antenna shroud tempest armor (1989 Patent number . . . 5165098 - System for protecting digital equipment against . . .
44K - last updated 2008-05-02 21:50 by Auriea
AltLJAlt
LiveJournal ==ways to backup lj== http://www.mirrorservice.org/sites/download.sourceforge.net/pub/sourceforge/l/lj/ljarchive/ . . . ===== Leaving LiveJournal?===== [new:Auriea:2006-03-14 16:26 UTC] So, I'm seriously considering leaving . . .
4K - last updated 2009-01-08 13:49 by Auriea
AmaryllisFlower
TuinPlanten Ours didn't flower this year so I am thining I didn't let it hybernate properly: ''Advice . . . Rinse & repeat. . . .
1K - last updated 2005-06-05 11:10 by Auriea
Ana
CastOfThousands http://profile.myspace.com/index.cfm?fuseaction=user.viewProfile&friendID=227408394 . . . http://farm3.static.flickr.com/2463/3722815466_35162e7cdc_b.jpg . . .
1K - last updated 2010-04-14 23:40 by Auriea
AnimalCrossing
[[Games]] http://www.communauteanimalcrossing.fr/jukebox.php <source> Animal Crossing: Wild World . . . Feather - 1,400,000 bells Rainbow Feather - 6,400,000 bells Don't go...ever: If you have a favorite . . . Watering Can Upkeep a perfect environment for 16 days straight. Then Pelly or Phyllis will give it . . . 25,000 Bells in Nook's store. Nookway Spend 65,000 Bells in Nook's store. Nookington's Spend 240,000 . . . June-August, 4pm-9am (pond) Giant Snakehead -- 6,500 -- June-August, 9am-4pm (pond) Goldfish -- 1,300 . . .
10K - last updated 2009-01-14 12:16 by Auriea
Anime
[[Movies]] http://www.animenewsnetwork.com/encyclopedia/anime.php?id=6733 the girl who lept through time . . .
1K - last updated 2007-04-02 22:46 by Auriea
AnnaKarenina
FiftyBooks [http://www.bartleby.com/316/] . . .
1K - last updated 2006-05-31 17:39 by Auriea
Aphrodite
<html><iframe id='embed3DViewer' src='http://www.123dapp.com/fullpreview/embedViewer?assetId=1950236&size=small' . . .
1K - last updated 2014-01-08 12:20 by Auriea
Apollo
[[mythology]] ==== This is copied from Mythica:Apollo ==== The son of Zeus and Leto, and the twin brother . . . http://www.uwm.edu/Course/mythology/0600/apollo.htm . . .
10K - last updated 2007-05-03 09:59 by Auriea
ApprenticeBookbinder
RandomIdeas http://www.geocities.com/SoHo/Lofts/2123/coperta_08.html seriously, I want to learn a craft. . . . contact me earlyer you can phone me 0475/47.23.65 greetings Josée -- Josee Van Loon - Atelier Coperta, . . . Gent-Belgium Tel. & Fax: 32-(0)9-221.33.68 Email: josee.vanloon@skynet.be Internet: http://users.skynet.be/coperta . . .
3K - last updated 2005-04-29 09:52 by Auriea
ArtSupplies
CurrentObsession ===making paint=== http://www.paintmaking.com/index.html ===Pastels=== * sudden, uncontrollable . . . http://farm4.static.flickr.com/3102/2664426137_6ccf6b1874.jpg ----- http://www.stutler.cc/other/sketchbook/images/waterbrushes.jpg . . . http://jamesjean.com/bound_images/D76B89_thumb.JPG ==Local== http://www.schleiper.com/ . . .
1K - last updated 2010-08-08 12:21 by Auriea
ArtistStatement old
[[About]] An engagement with images of things/people/stories which don’t exist but are believed to . . . We wrote the Realtime Art Manifesto in 2006 based on our desire to see more artists using the . . .
13K - last updated 2020-05-07 17:23 by Auriea-Mercury
Astronaut
SongBook http://blog.amandapalmer.net/post/185458467/the-writing-filming-of-the-song-astronaut . . .
1K - last updated 2009-09-12 21:29 by 78-21-206-50.access.telenet.be
Athens
OutsideSomeplace If I ever get back to Athens, go to the Museon Hill. Monument to "Uncle Phil" and fabulous . . . ear me, and they ask me whether On 7 Jul 2006, at 20:56, Auriea wrote: >> On 2006/07/07, . . .
2K - last updated 2011-01-11 00:24 by Auriea
AugmentedReality
DigitalSculpture ==Tools I can use== * ARToolkit https://artoolkit.org/download-artoolkit-sdk ** ARToolkit . . . . . . type="application/x-shockwave-flash" . . .
2K - last updated 2017-03-09 16:39 by Au-Mercury
August2006Travel
DarkSecret SALES PERSON: WM ITINERARY DATE: 25 MAY 06 CUSTOMER NBR: CREATIVE00 LRKYSE PAGE: 01 TO: CREATIVE . . . CAPITAL 65 BLEECKER STREET 7TH FLOOR NEW YORK NY 10012 FOR: . . . HARVEY/AURIEA 31 JUL 06 - MONDAY AIR DELTA AIR LINES INC FLT:141 COACH LUNCH . . . LV BRUSSELS 1130A EQP: BOEING 767 08HR 10MIN AR NEW YORK JFK 140P NON-STOP ARRIVE: . . . 3 REF: PVVLPE HARVEY/AURIEA SEAT-22F 14 AUG 06 - MONDAY AIR DELTA AIR LINES INC FLT:5372 COACH NEW . . .
2K - last updated 2006-06-19 10:16 by Auriea
AutopsyFAQ
[[autopsy]] From: Ed Uthman <uthman@neosoft.com> Newsgroups: sci.med.pathology,sci.med,sci.answers,news.answers . . . Organization: Pathanarchy, Inc Message-ID: <6dkass$fl3$1@uuneo.neosoft.com> Summary: This is . . . Nuntius 2.0_PPC X-XXMessage-ID: <B1230C586501092E@scooter-ppp-port-23.neosoft.com> X-XXDate: . . . Version: 1.004 Last-modified: September 2, 1996 Archive-name: pathology/autopsy-screenwriters-guide . . . <uthman@neosoft.com>. Copyright (c) 1994-96, Edward O. Uthman. This material may be reformatted . . .
27K - last updated 2007-05-18 12:10 by Auriea
BBCOresteia
<img src="http://auriea.com/wp-content/uploads/Screenshot-2015-06-08-18.57.28.png" alt="Screenshot . . . 2015-06-08 18.57.28" width="622" height="472" class="alignnone . . . alt="agamemnon_musing" width="840" height="525" . . . class="aligncenter size-full wp-image-638" /> </center> . . .
5K - last updated 2017-02-12 14:48 by Auriea
Barcelona
OutsideSomeplace ==some places== * fabra observatory http://www.observatorifabra.com/es/ ----- ==net . . . 109; (34-93) 424-1505. La Cova Fumada, Baluard 56; (34-93) 221-4061. Hidden in the wafer-thin buildings . . . Sundays. Nubius, Espaseria 7; (34-93) 319-1006; and Avinyó 21; (34-93) 304-2420; www.nubius.es. . . . pastry I've ever had.... First they deep fry a 6 inch churro that has a 2.5 inch diameter. After it . . .
3K - last updated 2008-07-19 20:49 by Auriea
BargueDrawings
[[Drawing]] [[thumb:FloweringStaircase|frame|300px|the master teacher and student relationship in classical . . . Charles Bargue Et Jean-Leon Gerome: Drawing . . .
4K - last updated 2012-02-11 14:41 by Auriea
Barry
CastOfThousands [[background:TheHangedMan|repeat #000000]] http://farm3.static.flickr.com/2446/3714923618_1c449775d3_b.jpg . . .
1K - last updated 2010-04-14 23:38 by Auriea
Bauhaus
ElegantMedia <html> <img src="http://www.auriea.org/index.pl/download/BauhausPhoto" USEMAP="#meisterfoto" . . . <AREA SHAPE=RECT COORDS="0,16,17,113" HREF="http://images.google.com/images?q=Josef . . . return true"> <AREA SHAPE=RECT COORDS="67,8,94,131" HREF="http://images.google.com/images?q=Georg . . . <AREA SHAPE=RECT COORDS="120,31,143,126" HREF="http://images.google.com/images?q=Laszlo Moholy-Nagy" . . . true"> <AREA SHAPE=RECT COORDS="149,19,167,59" HREF="http://images.google.com/images?q=Herbertt . . .
4K - last updated 2005-11-15 14:15 by Auriea
BeautyInTheAgeOfDigitalArt
ElegantMedia moderators: Maja Kuzmanovic (FoAM) and Michael Samyn (Tale of Tales) wednesday may 24, 2006 . . . Beauty in the age of digital art Date: 2006年5月18日 18:15:35 GMT+02:00 To: me Hi, Thank you . . .
10K - last updated 2018-09-11 10:24 by Au-Mercury
BenjaminCoopersmith
CastOfThousands one day when i have the time... such stories to tell. http://bencoopersmith.com photographer . . . new york friend. ------ ------ 2007-05-08 22:06 ben is finally coming to visit me in europe. he will . . .
1K - last updated 2010-12-07 12:42 by Auriea
BientotlEte
[[Games]] http://farm9.staticflickr.com/8351/8290258741_f2dea181b6_b.jpg http://farm9.staticflickr.com/8492/8291317362_c12fef80e5_b.jpg . . .
1K - last updated 2013-01-14 14:11 by Auriea
BillViola
CastOfThousands ''see also: ElegantMedia'' much more to mention here later * http://www.museumca.org/exhibit/exhi_viola.html . . . http://farm3.static.flickr.com/2787/4382767139_9457d3faf6.jpg . . .
2K - last updated 2010-02-24 16:38 by Auriea
Biography
'''AURIEA HARVEY''' digital sculptor / videogame designer b. 1971 Indianapolis, IN 1989-1999 New York . . . Biography + . . .
2K - last updated 2021-07-09 09:52 by Auriea
Blender
DigitalSculpture ''see also, [[topology]]'' * Creating Blendshapes for facial animation [https://cgi.tutsplus.com/tutorials/create-a-facial-animation-setup-in-blender-part-1--cg-32251] . . . http://www.fourmadmen.com/blender/scripts/4mm_layer_manager/screenshots/v13/menus.jpg . . . buttons click on make Multires divide to about 6 enjoy. [[image:Blender-SculptToolShortcuts]] ===Sculpt/Retopo=== . . . [[vimeo:1221926 400 225 0]] [[vimeo:1227660 400 225 0]] ==Material== . . .
7K - last updated 2018-11-22 18:08 by Auriea.
BlenderAnimation
[[Blender]] ==Morph Targets== Morph targets in Blender are also known as relative vertex keys. On the . . . http://www.elysiun.com/forum/viewtopic.php?t=38685 http://perso.wanadoo.fr/jb.perin/Mocap/MocapAnimation.html . . .
6K - last updated 2010-03-25 17:25 by Auriea
BlenderGameEngine
[[Blender]] http://tba-creations.leveluphost.com/index.php/Tutorials/using-the-mouse-in-the-ge-theory.html . . . - http://www.blender.org/forum/viewtopic.php?t=7869 * [http://www.ingiebee.com/tutorials/Blender%202%20tutorial%20The%20Blender%20Game%20Engine.htm . . . [http://www.elysiun.com/forum/viewtopic.php?t=45163 2D camera following thread on elYsiun] * [http://blender3d.org/cms/3D_Walkthrough.340.0.html . . . * [http://www.elYsiun.com/forum/viewtopic.php?t=56976&sid=c9c67def96ca13646af68932dc134465 on radiosity . . .
3K - last updated 2009-04-22 18:34 by 78-21-206-53.access.telenet.be
BlenderHA
[[Blender]] BPy script repository (sometimes you will get an error message that one or the other of these . . . * http://www.elysiun.com/forum/viewtopic.php?t=36714 * and more by the same guy (hes pretty good) http://kokcito.tk/ . . . * http://www.museum.state.il.us/ismdepts/library/linuxguides/blender/blender_faq_18.html#7 . . . * [http://www.cgtalk.com/showthread.php?t=52560 Cool things in Blender that aren't so obvious.] . . .
3K - last updated 2007-02-24 20:00 by Auriea
BlenderKeys
[[Blender]] ==Basic editing== Quit Q Abort command ESC Erase CTRL-X all X selected Editmode on/off TAB, . . . File save, F3 Image save, F4 Lamp, F5 Material, F6 Texture, F7 Animation, F8 Realtime, F9 Edit, F10 . . . with SHIFT: F1 Load lib, F4 DataView, F5 3D, F6 Ipo, F7 View Buttons, F8 Seq.Editor, F9 Oops, F10 . . . HOME, SHFT-C Rotate around axis Z-axis NUMPAD 4,6 Perp to Z and view NUMPAD 2,8 Concentrate on selected . . . verts H / ALT-H, buttons in F9, special menu W 5/6 Recalculate normals CTRL-N Clear origin ALT-O DupliFrames . . .
11K - last updated 2006-09-04 10:56 by Auriea
BlenderNormalMaps
Blender ==Step by Step== * material node tutorial and reference http://www.geneome.net/blender/writtentutorials/matnodes.html . . . <html> <object width="320" height="265"><param name="movie" value="http://www.youtube.com/v/qDOI-31jVzE&hl=en&fs=1"></param><param . . . allowfullscreen="true" width="320" height="265"></embed></object> <object width="640" . . . allowfullscreen="true" width="640" height="480"></embed></object> . . .
2K - last updated 2009-08-01 17:17 by Auriea
BoardGames
[[Games]] http://www.4colorrebellion.com/archives/2008/10/18/boardgaming-101/#more-6139 . . .
1K - last updated 2008-10-18 22:49 by Auriea
BodufSongs
http://farm4.static.flickr.com/3391/3509373923_608241d89a_o.jpg FM:Boduf+Songs seen at croxhapox on may . . . 6, 2009 with FM:To+Kill+a+Petty+Bourgeoisie talked . . .
1K - last updated 2009-05-18 14:57 by Auriea
Book12B
'''sketchbook #12-B46A6/Q''' sept 1991 - feb 1992 [[thumb:Book12B_Cover|300px]] . . .
1K - last updated 2012-09-06 13:19 by Auriea
Book16
SketchBooks <include "Book16B"> ------ <include "Book16A"> . . .
1K - last updated 2012-09-06 13:15 by Auriea
Book16A
'''for mature readers only''' sept 1992 [[thumb:Book16A_Cover|300px]] [[thumb:Book16A_BackCover|300px]] . . .
1K - last updated 2012-09-06 13:15 by Auriea
Book16A BackCover
image/jpeg
104K - last updated 2012-09-04 12:23 by Auriea
Book16A Cover
image/jpeg
80K - last updated 2012-09-04 12:22 by Auriea
Book16B
'''experiments in masochism''' sept 1992 - jan 1993 [[thumb:Book16B_Cover|300px]] . . .
1K - last updated 2012-09-06 13:15 by Auriea
Book16B Cover
image/jpeg
76K - last updated 2012-09-04 12:14 by Auriea
Book17
SketchBooks '''millions of secrets are generated every day''' january 1993 - april 1993 [[thumb:Book17_Cover|300px]] . . . next> prev/l=[[Book18|18.]] next/r=[[Book16|16.]] ----- . . .
1K - last updated 2012-09-17 14:25 by Auriea
Book19
SketchBooks '''everyday kinds of peace and violence''' july 1993 - september 1993 23.5 x 31 cm; handbound . . . [[thumb:Book19_NeverDoubt|500px]] [[vimeo:48441613 500 281 0]] [[foreground:paper_bkg2|repeat transparent|200px]] . . .
1K - last updated 2012-09-06 12:31 by Auriea
Book20
SketchBooks '''Psyche Story''' Oct 1993 - Apr 1994 20 x 25.5 cm; handbound, found cover w/collage <center>[[vimeo:3065816 . . .
1K - last updated 2020-04-09 12:01 by Auriea-Mercury
Book20 6
image/jpeg
110K - last updated 2006-05-25 14:32 by Auriea
Book22B
SketchBooks '''Chinese Wedding'' summer - winter 1995 [[thumb:Book22B_Cover|350px]] [[thumb:Book22B_BackCover|350px]] . . . [[thumb:Book22B_img5|200px]] [[thumb:Book22B_img6|200px]] [[thumb:Book22B_img7|200px]] [[vimeo:3061212 . . . 600 382 0]] . . .
1K - last updated 2012-09-06 12:49 by Auriea
Book22B img6
image/jpeg
255K - last updated 2012-09-06 12:50 by Auriea
Book23B
'''''Like Being Awake Sleeping And Hearing Seeing''''' Oct. 1995 - June 1996 [[thumb:Book23B_Cover|250px]] . . . Dover http://farm4.staticflickr.com/3492/3220016947_6592702ddb_z.jpg Iceland http://farm4.staticflickr.com/3403/3220856292_ee834ca8c2.jpg . . . first ever trip to London http://farm4.staticflickr.com/3494/3220003661_a98e4b51a4_z.jpg . . .
1K - last updated 2012-09-06 13:59 by Auriea
Book24
SketchBooks '''illustrated encyclopedia of the modern world''' july 1996 - july 1997 [[thumb:Book24_Cover|300px]] . . .
1K - last updated 2012-09-07 15:01 by Auriea
Book25
SketchBooks 16 july 1997 - jun 1999 '''2 million year-old light''' [[image:Book25_Cover]] [[vimeo:48442206 . . . http://farm4.staticflickr.com/3436/3260683536_227165209e_z.jpg http://farm4.staticflickr.com/3428/3277767783_c5d8e60b4a_z.jpg . . .
1K - last updated 2012-11-20 18:27 by Auriea
Book26
TableOfContents used briefly in 1999 [[thumb:Book26_Cover|400px]][[thumb:Book26_BackCover|400px]] . . .
1K - last updated 2012-09-03 14:15 by Auriea
Book26 BackCover
image/jpeg
176K - last updated 2012-09-03 14:15 by Auriea
Book26 Cover
image/jpeg
194K - last updated 2012-09-03 14:58 by Auriea
Book31
SketchBooks '''"In case of loss, please return to: THAT PLACE IN YOUR HEART WHERE ALL THINGS ARE REAL"''' . . . Moleskine Sketchbook, January 2006 - June 2006 [[thumb:Book31_Cover|300px]][[thumb:Book31_BackCover|300px]] . . . [[thumb:Book31_Roma06|200px]] [[thumb:Book31_Roma07|200px]] [[thumb:Book31_Roma08|200px]] . . . [[thumb:Book31_Roma16|200px]] These were drawn on location in The Eternal . . . City from 20060508-20060511. Michael and I went there for a good, . . .
2K - last updated 2018-09-09 21:17 by Auriea
Book31 Roma06
image/jpeg
212K - last updated 2006-05-14 21:14 by Auriea
Book31 Roma16
image/jpeg
115K - last updated 2006-05-28 23:08 by Auriea
Book32
SketchBooks '''Beautiful Lightside/Beautiful Darkside''' June 2006 - March 2007 16.3 x 24.3 cm; handbound, . . . [[thumb:Book32_Page26-27|300px]] [[thumb:Book32_Page30|140px]] [[thumb:Book32_Page34|140px]] . . . [[thumb:Book32_Page36-37|300px]] [[thumb:Book32_Page38-39|300px]] [[thumb:Book32_Page40-41|300px]][[thumb:Book32_Page44-45|300px]] . . . [[thumb:Book32_Page53|150px]][[thumb:Book32_Page60-61|300px]] ------ [[thumb:Book32_Cover_Darkside|300px]] . . .
2K - last updated 2018-09-09 21:17 by Auriea
Book32 Page26-27
image/jpeg
91K - last updated 2007-01-10 11:56 by Auriea
Book32 Page36-37
image/jpeg
223K - last updated 2006-08-22 09:08 by Auriea
Book32 Page60-61
image/jpeg
197K - last updated 2007-02-06 15:39 by Auriea
Book35
SketchBooks '''talking to myself''' [[thumb:Book35_Cover|300px]] [[thumb:Book35_Untitled1|200px]][[thumb:Book35_Untitled2|200px]][[thumb:Book35_Untitled3|200px]][[thumb:Book35_Untitled4|200px]] . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Ftags%2Ftesters%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Ftags%2Ftesters%2F&user_id=81482434@N00&tags=testers&jump_to=&start_index=" . . . <table/booknav prev, next> prev/l=[[Book36|36.]] next/r=[[Book34|34.]] ----- . . .
2K - last updated 2018-09-09 21:14 by Auriea
Book36
SketchBooks [[thumb:Book36_Cover|300px]] [[thumb:2008-12-31_00h07_done|200px]] <table/booknav prev, . . .
1K - last updated 2018-09-09 21:13 by Auriea
Book36 Cover
image/jpeg
109K - last updated 2012-09-01 14:02 by Auriea
Book37
SketchBooks [[thumb:Book37_Cover|300px]] <table/booknav prev, next> prev/l=[[Book38|38.]] next/r=[[Book36|36.]] . . .
1K - last updated 2018-09-09 21:13 by Auriea
Book38
SketchBooks '''Der Geist Des Rokoko''' spring 2010 - october 2010 9 x 13 cm [[thumb:Book38_Cover|300px]] . . . [[thumb:Book38_page4-5|200px]] [[thumb:Book38_page1|200px]] . . .
2K - last updated 2018-09-09 21:13 by Auriea
Book39
SketchBooks '''sketchbookipod''' october 2010 - not finished (may use it again sometime) 8.5 x 14.8 cm . . . [[thumb:Book39_body|200px]] [[thumb:2010-10-26_sketchbookipod|400px]] <table/booknav prev, next> . . .
1K - last updated 2018-09-09 21:12 by Auriea
Book40
SketchBooks '''#planV''' 2011 april 2011 - 17 Aug 2011 16 x 24.4 cm [[thumb:Book40_Cover|300px]] [[thumb:Book40_MapOfPlanV|300px]] . . .
1K - last updated 2018-09-09 21:12 by Auriea
Book41
SketchBooks '''BELGIË/BELGIQUE''' 18 Aug 2011 - 17 feb 2012 25.5 x 20 cm [[thumb:Book41_Cover|300px]] . . . [[thumb:Book41_page68-69|300px]] [[thumb:Book41_page70-71|300px]] [[thumb:Book41_page80-81|300px]] . . . <html><iframe width="100%" height="166" scrolling="no" frameborder="no" src="http://w.soundcloud.com/player/?url=http%3A%2F%2Fapi.soundcloud.com%2Ftracks%2F23627412&show_artwork=true"></iframe></html> . . .
1K - last updated 2018-09-09 21:12 by Auriea
Book41 page68-69
image/jpeg
1220K - last updated 2012-09-11 12:11 by Auriea
Book42
SketchBooks '''GLAMOUR''' December 20, 2011 - February 29, 2012 12 x 18.5 [[thumb:Book42_Cover|300px]] . . . [[thumb:Book42_page3|100px]] [[thumb:Book42_page6-7|200px]] [[thumb:Book42_page8-9|200px]] [[thumb:Book42_page11|100px]] . . . [[thumb:Book42_page35-36|200px]] [[thumb:Book42_page57-58|200px]] [[thumb:Book42_page66|100px]] . . . [[thumb:Book42_page67-68|200px]] [[thumb:Book42_page69|100px]] [[thumb:Book42_page88|100px]] . . .
1K - last updated 2018-09-09 21:11 by Auriea
Book42 page35-36
image/jpeg
168K - last updated 2012-09-07 14:11 by Auriea
Book42 page6-7
image/jpeg
152K - last updated 2012-09-07 13:05 by Auriea
Book42 page66
image/jpeg
115K - last updated 2012-09-07 14:14 by Auriea
Book42 page67-68
image/jpeg
165K - last updated 2012-09-07 14:14 by Auriea
Book42 page69
image/jpeg
88K - last updated 2012-09-07 14:15 by Auriea
Book43
SketchBooks '''De Rerum Natura''' March 18, 2012 - June 25, 2012 17 x 25.5 cm; handbound cover: canvas, . . . TransitOfVenus in 2012. ------ [[vimeo:48441029 640 360 0]] <table/booknav prev, next> prev/l=[[Book44|44.]] . . .
3K - last updated 2018-09-09 21:08 by Auriea
Book44
SketchBooks '''FEU ET FLAMME''' June 26, 2012 - November 12, 2012 16x24 cm.; handbound, found cover w/collage . . .
3K - last updated 2018-09-09 19:25 by Auriea
Book45
SketchBooks [[thumb:Book45_Cover|400px]] '''Mars Black''' 13 November 2012 - 5 March 2013 ----- [[thumb:Book45_InsidePortrait|200px]] . . . <table/booknav prev, next> prev/l=[[Book46|46.]] next/r=[[Book44|44.]] ----- . . .
1K - last updated 2018-09-09 21:07 by Auriea
Book46
SketchBooks '''Σκύρος''' 06 March 2013 - 26 July 2013 14 x 25 cm handmade, canson mi-tientes paper, . . . ink, watercolor, colored pencil [[thumb:Book46_Cover|300px]] [[thumb:Book46_frontpiece-AEStallings|300px]] . . . ----- [[thumb:Book46_1|200px]][[thumb:Book46_2|200px]][[thumb:Book46_3|200px]][[thumb:Book46_4|200px]][[thumb:Book46_5|200px]][[thumb:Book46_6|200px]][[thumb:Book46_7|200px]][[thumb:Book46_8|200px]][[thumb:Book46_9|200px]][[thumb:Book46_10|200px]][[thumb:Book46_11|200px]][[thumb:Book46_12|200px]] . . . [[thumb:Book46_theaudience|200px]] [[thumb:Book46_metsculpture|200px]] . . . [[thumb:Book46_crouchingvenus|200px]] [[thumb:Book46_sintpietersabdij|200px]] . . .
1K - last updated 2018-09-09 21:06 by Auriea
Book46 1
image/jpeg
1281K - last updated 2014-09-01 23:40 by Auriea
Book46 10
image/jpeg
1419K - last updated 2014-09-01 23:44 by Auriea
Book46 11
image/jpeg
1579K - last updated 2014-09-01 23:44 by Auriea
Book46 12
image/jpeg
1334K - last updated 2014-09-01 23:45 by Auriea
Book46 2
image/jpeg
1400K - last updated 2014-09-01 23:41 by Auriea
Book46 3
image/jpeg
1573K - last updated 2014-09-01 23:41 by Auriea
Book46 4
image/jpeg
1285K - last updated 2014-09-01 23:42 by Auriea
Book46 5
image/jpeg
1489K - last updated 2014-09-01 23:42 by Auriea
Book46 6
image/jpeg
1701K - last updated 2014-09-01 23:42 by Auriea
Book46 7
image/jpeg
1547K - last updated 2014-09-01 23:43 by Auriea
Book46 8
image/jpeg
1579K - last updated 2014-09-01 23:43 by Auriea
Book46 9
image/jpeg
1284K - last updated 2014-09-01 23:44 by Auriea
Book46 Cover
image/jpeg
417K - last updated 2013-07-21 13:19 by Auriea
Book46 crouchingvenus
image/jpeg
717K - last updated 2014-09-01 23:50 by Auriea
Book46 frontpiece-AEStallings
image/jpeg
885K - last updated 2014-09-01 23:53 by Auriea
Book46 maria
image/jpeg
640K - last updated 2014-09-01 23:51 by Auriea
Book46 metsculpture
image/jpeg
229K - last updated 2013-07-21 13:37 by Auriea
Book46 orchidsbarelyopen
image/jpeg
975K - last updated 2014-09-01 23:51 by Auriea
Book46 selfsketchwithskull
image/jpeg
636K - last updated 2014-09-01 23:51 by Auriea
Book46 sintpietersabdij
image/jpeg
909K - last updated 2014-09-01 23:50 by Auriea
Book46 theaudience
image/jpeg
718K - last updated 2013-07-21 13:36 by Auriea
Book46 thedance
image/jpeg
847K - last updated 2014-09-01 23:52 by Auriea
Book46 theview
image/jpeg
1060K - last updated 2014-09-01 23:52 by Auriea
Book47
SketchBooks '''Costumes Anciens et Modernes''' 26 July 2013 - 25 Sept 2013 14.5 x 23 cm handmade, found . . . . . . next> prev/l=[[Book48|48.]] next/r=[[Book46|46.]] ----- . . .
1K - last updated 2018-09-09 21:05 by Auriea
Book47 6
image/jpeg
413K - last updated 2014-09-08 19:22 by Auriea
Book48
SketchBooks [[thumb:Book48_Cover|300px]] [[thumb:Book48_BackCover|300px]] '''Paris''' 25 Sept 2013 - . . . [[thumb:Book48_5|200px]] [[thumb:Book48_6|200px]] [[thumb:Book48_7|200px]] [[thumb:Book48_8|200px]] . . . [[thumb:Book48_15|200px]] [[thumb:Book48_16|200px]] [[thumb:Book48_17|200px]] [[thumb:Book48_18|200px]] . . . [[thumb:Book48_25|200px]] [[thumb:Book48_26|200px]] [[thumb:Louvre_AphroditeChalk|300px]] [[thumb:Louvre_BorgheseGladiator|300px]] . . .
2K - last updated 2018-09-09 21:05 by Auriea
Book48 16
image/jpeg
305K - last updated 2014-09-09 13:38 by Auriea
Book48 26
image/jpeg
193K - last updated 2014-09-09 13:42 by Auriea
Book48 6
image/jpeg
332K - last updated 2014-09-09 13:35 by Auriea
Book49
SketchBooks [[thumb:Book49_Cover|400px]] [[thumb:Book49_BackCover|400px]] '''La salle des Caryatides''' . . . [[thumb:Book49_5|200px]] [[thumb:Book49_6|200px]] [[thumb:Book49_7|200px]] [[thumb:Book49_8|200px]] . . . [[thumb:Book49_15|200px]] [[thumb:Book49_16|200px]] [[thumb:Book49_17|200px]] [[thumb:Book49_18|200px]] . . . [[thumb:Book49_25|200px]] [[thumb:Book49_26|200px]] [[thumb:Book49_27|200px]] [[thumb:Book49_28|200px]] . . . [[thumb:Book49_35|200px]] [[thumb:Book49_36|200px]] <table/booknav prev, next> prev/l=[[Book50|50.]] . . .
2K - last updated 2018-09-09 21:04 by Auriea
Book49 16
image/jpeg
242K - last updated 2014-09-09 14:15 by Auriea
Book49 26
image/jpeg
180K - last updated 2014-09-09 14:17 by Auriea
Book49 36
image/jpeg
361K - last updated 2014-09-09 14:20 by Auriea
Book49 6
image/jpeg
217K - last updated 2014-09-09 14:12 by Auriea
Book6
SketchBooks 8 may 1990 - 20 aug 1990 '''sex, life, and the cosmos''' [[thumb:Book6_Cover|300px]] [[thumb:Book6_SecretWriting|200px]] . . . [[thumb:Book6_SecretWriting2|200px]] [[thumb:Book6_SpareParts|200px]] . . . [[thumb:Book6_SpareParts2|200px]] <table/booknav prev, next> . . .
1K - last updated 2012-09-25 11:12 by Auriea
Book6 Cover
image/jpeg
116K - last updated 2012-09-04 13:46 by Auriea
Book6 SecretWriting
image/jpeg
134K - last updated 2012-09-25 11:48 by Auriea
Book6 SecretWriting2
image/jpeg
71K - last updated 2012-09-25 11:48 by Auriea
Book6 SpareParts
image/jpeg
186K - last updated 2012-09-25 11:48 by Auriea
Book6 SpareParts2
image/jpeg
126K - last updated 2012-09-25 11:48 by Auriea
Book7
TableOfContents '''chaos is my life''' 20 aug 1990 - 26 sept 1990 [[image:Book7_Cover]] . . .
1K - last updated 2007-05-19 15:49 by Auriea
Book8
TableOfContents '''Fragile''' 26 Sept 1990 - 19 Dec 1990, store bought 9x12 [[thumb:Book8_Cover|110px]][[vimeo:2783622 . . . 600 338 0]] covers part of the year in college, when . . .
1K - last updated 2009-01-10 23:38 by Auriea
BorisVian
CastOfThousands [[image:BorisVianAaZ]] books: [http://www.artworldbooks.com/pages/search.php?words=Vian&theme=0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16] . . . (1947) and J'irai cracher sur vos tombes (1946, I Shall Spit on Your Graves). Vian's collected works . . . (James Baldwin in The Devil Finds Work, 1976) Boris Vian was born at Ville d'Avray into a wealthy . . . It was written in 1943, but published in 1946. After the war he played trumpet in the Left Bank . . . sur vos tombes was written in ten days in 1946 under the pseudonym Vernon Sullivan. Vian had made . . .
8K - last updated 2012-07-02 13:21 by Auriea
BrownieBox
http://farm4.static.flickr.com/3220/2511129142_6526e97e16.jpg . . .
1K - last updated 2009-01-05 00:37 by Auriea
CCpresentation2006
[[CCretreat2006]] # introduction '''''slide 01 - ToT''''' ## Hi, I am Auriea Harvey. # ToT ## I have . . . 05 - 144''''' ## The charcters are the 6 Red Girls who one by one will become your avatar, . . . 6 wolves, one Grandmother and the same Girl dressed . . . structure; This is a game played in 3 Acts and 6 episodes. 3 acts because there are only 3 environments . . . in the whole game. 6 episodes because you will play the game 6 times. . . .
7K - last updated 2009-06-29 11:09 by Auriea
CCpresentation2009
[[CCretreat2009]] '''''slide 01 - ToT''''' # Hello, I am Auriea Harvey he is Michael Samyn, we are Tale . . . in a magical idyllic forest. '''''slide 03 - 6sisters''''' # But our most devisive game to date . . . fairy tale. # The main charcters are the 6 Red Girls, sisters, who one by one will become your . . . avatar, 6 wolves, one Grandmother and the a Girl dressed In . . .
3K - last updated 2009-07-23 22:58 by Auriea
CCretreat2006
OutsideSomeplace ''see also ToDo, [[August2006Travel]], nyc, [[CCpresentation2006]]'' ==Contacts== Connor . . . Kalista: 315-560-9307 Katrina Grigg-Saito: 315-560-9223 ==things . . . 5. Karen Marta & Ricky Lee - gsm marketing 6. Anne Barlow - new museo 7. Lauren Cornell - rhizome . . .
2K - last updated 2009-06-29 11:10 by Auriea
CaproniCasts
SketchBook [[thumb:CaproniCasts-Cover|right|300px|frame| Not sure where I got the catalog anymore but . . . Clay my art teacher at Attucks High School in 1986]] ==Caproni Casts: Plaster Reproductions of Sculpture . . .
2K - last updated 2006-06-17 20:54 by Auriea
CastOfThousands
CastOfThousands any proper account of my life will have to include all of the following people. <list . . . <html><object width="480" height="360"><param name="movie" value="http://www.dailymotion.com/swf/video/x7y80w_1914_creation?additionalInfos=0"></param><param . . . width="480" height="360" allowfullscreen="true" allowscriptaccess="always"></embed></object><br . . .
1K - last updated 2010-08-01 14:24 by Auriea
CatIdeas
[[Ling]] ==Catification== * plank above michael's desk -> 1m x 30cm ** connect to the projector platform . . . * http://www.zooplus.nl/shop/katten/krabpaal_krabmeubels/krabtonnen/krabtonnen/277865 . . . http://www.scratchycats.com/kitten_sisal_cat_scratching_post.html . . . http://www.dierenvilla.be/krabton-dasha-iii-grijs.html . . . Expensive: http://www.purrfectdesign.net/en/nekozen-bamboo.html?id=13891499 . . .
4K - last updated 2014-10-29 18:32 by Auriea
CatcherInTheRye
[[FiftyBooks]] almost didn't want to finish it. really was not something for me i guess. a novel written . . . in the voice of a 16 year old boy, boarding school refugee, not especially . . . probably just amatter of time passing and for me 60 years later this boy's reasons are unclear. And . . .
3K - last updated 2005-08-09 17:36 by AurieaHarvey
Celtic Holidays
[[Research]] ==Samhain== (sow-een or sow'-inn) Traditional date: October 31 to November 1 Actual astrological . . . date: Nov 6 in 2006 and 2007 Midpoint between Autumn Equinox . . . 21 Actual astrological date: December 21 in 2006, and December 22 in 2007 Winter Solstice, first day . . . Feb 1 or 2 Actual astrological date: Feb 4 in 2006 and 2007 Midpoint between Winter Solstice and Spring . . . 21 Actual astrological date: March 20 in 2006 and 2007 First day of Spring, actual Vernal or Spring . . .
6K - last updated 2007-08-19 10:25 by Auriea
CeremonyOfInnocence
[[Games]] <html> <object width="700" height="525"><param name="allowfullscreen" value="true" . . . value="http://vimeo.com/moogaloop.swf?clip_id=6743011&server=vimeo.com&show_title=1&show_byline=1&show_portrait=1&color=00adef&fullscreen=1" . . . src="http://vimeo.com/moogaloop.swf?clip_id=6743011&server=vimeo.com&show_title=1&show_byline=1&show_portrait=1&color=00adef&fullscreen=1" . . . on [http://www.amazon.com/exec/obidos/ASIN/0811806960/ref=sib_rdr_dp/002-8127150-9030436 Amazon]! ;)}} . . .
10K - last updated 2009-10-29 13:04 by Auriea
ChrisOfili
CastOfThousands Mary Magdalene (Infinity), 2006 Annunciation, 2006 giving her something to reflect . . .
1K - last updated 2020-02-06 15:36 by Au-Elektra
ClipStudioPaint
[[Reference]] ==using vector tools== [[tube:deb3wLpjQTg 640 480 0]] . . .
1K - last updated 2014-06-18 15:27 by Auriea
ComputerAssistedDrawing
ElegantMedia ==you-can't-have-it-ware== Moxi (watercolor/ink simulation) http://visgraph.cse.ust.hk/MoXi/ . . . * http://velluminous.org/portfolio/detail/?16 I'd love a full featured version of any of these. . . .
2K - last updated 2009-11-16 19:19 by Auriea
ConfigPage
package OddMuse; $CookieName = 'akiw'; $SiteName = 'Auriea L'; $HomePage = 'AurieaL'; $RCName = 'About'; . . . $KeepDays = 365; $defaultTZ = 2; $UploadAllowed = 1; @UploadTypes . . . = 100; $MaxPost = 10000 * 4096; $PageCluster = ''; $PageTypesName = 'Cluster'; $UseQuestionmark . . . $MarkupQuotes = 1; my %RecurringDays = ( '1971-06-02'=>"Auriea, it is your birthday! %s years", . . . '1968-06-28'=>"Today is Michaels birthday! – %s years", . . .
6K - last updated 2023-10-25 14:36 by au
Contact
==EMAIL ME== <center>For direct inquiries please contact: studio@auriea.art</center> ==FIND . . . IS OUT THERE== [https://vimeo.com/showcase/7076574|SIMULATIONS] http://song-of-songs.org * [http://cathedral-in-the-clouds.net . . .
2K - last updated 2025-02-17 10:10 by AuOG
Context
* [http://instagram.com/auriea.harvey.studio|SCULPTURE] * [https://vimeo.com/showcase/7076574|SIMULATIONS] . . .
1K - last updated 2020-12-28 18:30 by Auriea
CountessTheWorldHasChanged
[[TheLessonOfNN]] [http://amsterdam.nettime.org/Lists-Archives/nettime-bold-0106/msg00183.html Countess, . . .
2K - last updated 2008-01-21 16:20 by Auriea
CraterLake
OutsideSomeplace [[background external:http://farm4.static.flickr.com/3311/3220926576_c92fc88cbc_b.jpg|repeat . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Ftags%2Fcraterlake%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Ftags%2Fcraterlake%2F&user_id=81482434@N00&tags=craterlake&jump_to=&start_index=" . . .
1K - last updated 2010-04-06 00:16 by Auriea
CureForCancer
[[Research]] It sounds almost too good to be true: a cheap and simple drug that kills almost all cancers . . . then withered and died (Cancer Cell, DOI: 10.1016/j.ccr.2006.10.020). Michelakis suggests that the . . .
4K - last updated 2008-12-13 23:07 by Auriea
CurrentObsession
[[Projects]] I like things to be super clear. I like them to be -rich. I like JazzStandards and FairyTales. . . . * [[kHkGames]] * [[Form2]] ----- [[2018-02-16]] * [[Clay3dPrinting]] * [[3dPrinting]] * OldMasters . . .
4K - last updated 2019-05-18 16:46 by Auriea
Cyclops
[[Projects]] <center>[[thumb:2008-10-12|600px]]</center> <tt>"Here is a defense of . . . would be certain that they had all died off some 65 million years ago. Also, if Troy, Babylon and other . . . from: http://www.strangehistory.net/2011/06/07/cyclops-origins/'' ----- [[image:Cyclops_reference.png]] . . .
3K - last updated 2018-11-24 17:36 by Auriea.
DHTML
[[Reference]] ==css== Listamatic - http://css.maxdesign.com.au/listamatic/ make a list look "different" . . . a DIV] * [http://www.allinthehead.com/retro/69 PNG in IE with sleight] [[download:sleight_au.js]] . . . Ten CSS Tricks You May Not Know] * http://www.smashingmagazine.com/2007/01/19/53-css-techniques-you-couldnt-live-without/ . . .
2K - last updated 2007-05-14 13:54 by Auriea
DSBrowserTranslation
[[Games]] ===== ===== NINTENDO DS OPERA WEB BROWSER FAQ (INCLUDES A SETTINGS MENU TRANSLATION) 4.05 ===== . . . ===== August 19, 2006 Disclaimer: I have tried my best to verify the information . . . Menu Translation [SEC4] 5. Credits [SEC5] 6. Legal Info [SEC6] ===== 1. Introduction [SEC1] ===== . . . The Japanese version of the browser was released . . . in Japan on July 24, 2006 and the European version will be released in Europe . . .
27K - last updated 2007-01-10 13:03 by Auriea
DancingDrawing
[[Writing]] DrawingDancing [[background:DancingDrawing-image2|repeat #00FF00 scroll top]] '''A report . . . https://c1.staticflickr.com/1/649/23386951742_41aa815b47_b.jpg . . . a next step. https://c1.staticflickr.com/1/716/23413091441_f9d8573256_z.jpg I am an artist who Draws. . . . Andros Zins-Browne [https://vimeo.com/123096981]. Upon reflection, when I am looking at performances . . . [https://www.youtube.com/watch?v=0CufiBOh6mc]. Similarly in the drawings I admire there is a . . .
13K - last updated 2017-02-12 14:58 by Auriea
DasLook
TuinPlanten [[Gog:Allium Ursinum]] http://www.bioimages.org.uk/HTML/R140989.HTM basically, it's wild . . . Height: 12-18 in. (30-45 cm) 18-24 in. (45-60 cm) Spacing: 3-6 in. (7-15 cm) Sun Exposure: Light . . .
1K - last updated 2005-12-21 12:23 by Auriea
DavidBowie
CastOfThousands http://womanonfire.livejournal.com/823684.html . . .
1K - last updated 2007-11-12 14:25 by Auriea
DeepPaint
[[Reference]] I've chosen to learn DeepPaint3d instead of BodyPaint3d because it has '''less''' features. . . . Menu</p> <table width="516" cellpadding="2" cellspacing="0" style = "border-collapse:collapse" . . . Menu</p> <table width="516" cellpadding="2" cellspacing="0" style = "border-collapse:collapse" . . . <table width="516" cellpadding="2" cellspacing="0" style = "border-collapse:collapse" . . . Painting</p> <table width="516" cellpadding="2" cellspacing="0" style = "border-collapse:collapse" . . .
23K - last updated 2006-07-15 13:35 by Auriea
DigitalPainting
SketchBook ''see also: [[Painter]] (software) ==How detailed is detailed== close up of leaves, photos . . . - http://forums.cgsociety.org/showthread.php?t=236250 * http://features.cgsociety.org/story_custom.php?story_id=3275&page=1 . . .
2K - last updated 2014-09-29 13:27 by Auriea
DigitalPhotography
[[photography]] ===Problems=== # Digital photography is too beholden to past paradigms ## the framing . . . #http://flickr.com/photos/duchamp/2643457119/in/set-72157605106384679/ . . .
4K - last updated 2008-11-11 22:55 by Auriea
DigitalPrinting
ElegantMedia Print labs in [[Rome2017]] * This place [http://www.soluzioniarte.it/contatti-2/?lang=en] . . . printer look for and Epson: Epson SureColor SC-P6000 * carbon ink for such a printer [https://www.farbenwerk.com/Carbonprint-Pearl-Ink] . . .
1K - last updated 2017-09-13 12:28 by Au-Danae
DigitalPuppetry
ElegantMedia I'm not a big fan of machinima... or at least what people have done with it thus far... . . . altijd) [http://www.linuxdevices.com/articles/AT6435065918.html How the Hensons use computers to control . . . . . .
1K - last updated 2007-05-23 22:30 by Auriea
DigitalSculpture
[[Sculpture]] <center><html><iframe width="240" height="480" src="https://sketchfab.com/models/43253ee0013a4603a7af20069a7c9383/embed?autostart=1&ui_infos=0" . . .
2K - last updated 2017-08-24 00:42 by Au-Danae
DigitalSketchBook
SketchBook images drawn on a HomebrewDS using http://www.collectingsmiles.com/colors/ <html><object . . . . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157605335422304%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157605335422304%2F&set_id=72157605335422304&jump_to=" . . .
1K - last updated 2009-02-01 14:14 by Auriea
Dimensions360Render
application/pdf
490K - last updated 2017-02-28 15:39 by Auriea
DontReadComments
<html><blockquote class="twitter-tweet" lang="en"><p>You have time to create something . . . 10, 2014</a></blockquote> . . .
1K - last updated 2015-02-24 16:07 by Auriea
Drawing
ElegantMedia ''see also: Projects, ElegantMedia, RandomIdeas, Books, Raphael, DancingDrawing, TheLivingLine'' . . . [[thumb:2014-09-24|200px]] [[vimeo:49597331 160 120 0]] [[thumb:AurieaDrawing2|200px]] [[thumb:AurieaDrawing3|200px]] . . . Art Collections – . . .
2K - last updated 2017-08-23 13:18 by Au-Mercury
DrawingDay
[[Drawing]] '''DrawingDay is currently Saturday.''' ==The Rules of Drawing Day== # Feel like you can . . . waste time. [https://www.goodreads.com/quotes/51360-draw-antonio-draw-antonio-draw-and-don-t-waste-time] . . .
1K - last updated 2014-05-08 18:17 by Auriea
DrawingHardware
[[Research]] ''...artists can stylize their curves while drawing by dynamically adjusting line thickness . . . features.'' http://www.physorg.com/news109425896.html http://www-users.cs.umn.edu/~keefe/dfk_iweb/Home.html . . .
1K - last updated 2010-10-19 00:43 by Auriea
EagleCreek
[[park]] [[image:EagleCreek-imgFromMomsCellPone]] [[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060815-eaglecreektrees1.flv&repeat=true|320|240|#000000|high|noscale]] . . . . . . [[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/MOL005.ASF.ff.flv&repeat=true&clicktext=2.|176|144|#000000|high|noscale]][[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/MOL006.ASF.ff.flv&repeat=true&clicktext=3.|176|144|#000000|high|noscale]] . . .
1K - last updated 2007-08-25 19:03 by Auriea
ElectronicPaper
ElegantMedia ''see also: DigitalBookBinding, handscroll, ProsperosBooks'' <html><object width="586" . . . height="400" id="aexternal" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000"><param name="movie" . . . value="config=/video3/201005/10-0526/config.xml&lang=en"></param><param . . . flashVars="config=/video3/201005/10-0526/config.xml&lang=en" allowFullScreen="true" allowScriptAccess="always" . . . width="586" height="400"></embed></object></html> . . .
2K - last updated 2010-05-27 12:17 by Auriea
ElegantMedia
[[background:TheZone|repeat #000000]] all the things i wouldn't throw away ''related: beauty, romance, . . . but only if it can be made beautifully. ---20060605 ------ Where is the elegant art of our age? I . . .
3K - last updated 2020-04-08 17:46 by Auriea-Mercury
ElementsOfDrama
[[Research]] Story does not equal plot. According to Aristotle drama has 6 main elements: Plot (''mythos'') . . .
1K - last updated 2005-06-18 11:16 by Auriea
EllaFitzgerald
CastOfThousands [[tube:6m6vtHIXzF8 600 400 0]] . . .
1K - last updated 2007-12-27 14:03 by Auriea
Empire
''see also: ComputerHistory'' ==DOMAINS.== <center>'''''Because [http://art.teleportacia.org/Location_Yes|Location . . . * http://www.goodreads.com/user/show/5685418-auriea * http://www.last.fm/user/womanonfire/, . . . * http://mubi.com/users/81386 * http://mixi.jp (womanonfire) * http://sixteenpages.net . . .
4K - last updated 2019-12-11 12:59 by Auriea-Mercury
EncyclopediaOfEverything
[[Quoth]] In "TheAnalyticalLanguageOfJohnWilkins" Borges describes 'a certain Chinese Encyclopedia,' . . . that are trained, 4. suckling pigs, 5. mermaids, 6. fabulous ones, 7. stray dogs, 8. those included . . .
1K - last updated 2012-07-03 18:05 by Auriea
Entropy8.com
[[Empire]] <center> [[image:flames.gif]] http://entropy8.com/NetscapeNavigator.gif http://entropy8.com/painting/ . . . http://30.media.tumblr.com/tumblr_l6cddiftt11qzs56do1_500.gif [[image:DorianGrayPreface]]</center> . . .
1K - last updated 2018-09-10 19:42 by Auriea.
ErikSatie
CastOfThousands Erik Satie (1912–13) Memories of an Amnesiac (Fragments) 1. What I Am Everyone . . . dexterity, swimming, etc.…): from 4:21 to 6:47. Dinner is served at 7:16 and ends at . . . name="movie" value="http://www.youtube.com/v/Gyo67kdFr98&hl=en_US&fs=1&color1=0x006699&color2=0x54abd6&border=1"></param><param . . . src="http://www.youtube.com/v/Gyo67kdFr98&hl=en_US&fs=1&color1=0x006699&color2=0x54abd6&border=1" . . .
5K - last updated 2009-11-27 18:52 by Auriea
EvaHesse
CastOfThousands For the exhibition of Contingent at the Finch College Museum of Art, Eva Hesse wrote . . . plastic. Began somewhere in November-December, 1968. Worked. Collapsed April 6, 1969. I have been very . . . from back then. Statement, October 15, 1969, out of hospital, short stay this time, third time. . . .
2K - last updated 2008-12-13 23:08 by Auriea
EveryIcon
[[Empire]] <center><html> <iframe src="http://auriea.org/everyIcon.html" width="450" height="420"> . . . typical desktop computer), it will take only 1.36 years to display all variations of the first line . . .
3K - last updated 2016-08-11 14:09 by Auriea
Example No.22
[[Exhibitions]] <center>[[thumb:Example_No.22_install01|650px]]</center> '''A lecture/performance . . .
1K - last updated 2020-12-29 01:30 by Auriea
Example No.22 Installation Images
[[thumb:Example_No.22_install01|left|300px]] [[thumb:Example_No.22_install02|left|400px]] [[thumb:Example_No.22_install03|left|300px]] . . . [[thumb:Example_No.22_install06|left|300px]] [[thumb:Example_No.22_install07|left|400px]] . . .
1K - last updated 2018-11-23 21:11 by Auriea.
Example No.22 install06
image/jpeg
537K - last updated 2018-11-23 21:09 by Au-Artemis
ExoticFood
[[Food]] http://www.chefkoch.de/rezepte/2351371373904775/Bulgur-Salat.html http://www.chefkoch.de/rezepte/904381195730161/Dolmades.html . . . http://www.chefkoch.de/rezepte/259631101560945/Reitersuppe.html . . .
1K - last updated 2013-09-18 13:38 by Auriea
FataleVrouwen
[[Mythology]] == [::Eve] == [[thumb:Eve-Snake|right]] the first woman. ==TheGraeae== : Mythica:Graeae . . . a formulaic oath in the Iliad (iii.278ff; xix.260ff) invokes "those who beneath the earth punish whoever . . .
16K - last updated 2013-01-05 20:57 by Auriea
Fauna
[[thumb:Fauna-image.jpg|700px]] Fauna, 2018 3d printed plaster, 3d printed bronze, terracotta clay, natural . . . fossil, bronze paint dimensions: 16.9cm-w\20.0cm-h\14.3cm-d <center> [[model:Fauna/gltf/scene.gltf|Fauna/Fauna.usdz|Fauna|width:300px;height:500px;]] . . .
1K - last updated 2020-11-16 14:44 by Auriea-Mercury
FavoriteApps
[[Empire]] * = not for iPad but i use it on iPad anyway ! = Don't know what I would do without it. Convert* . . . Tweetbot! - may absolute favorite twitter . . . https://itunes.apple.com/be/app/ifiles/id336683524?mt=8 Stuff Apple makes that I find goo to have: . . . OPlayer HD! - say you have a movie on . . . https://itunes.apple.com/be/app/the-poetry-app/id501967950?mt=8 . . .
6K - last updated 2013-01-04 14:55 by Auriea
FavoritePodcasts
[[Empire]] ===Antiquity Podcasts=== # Dan Carlin's Hardcore History - https://itunes.apple.com/be/podcast/dan-carlins-hardcore-history/id173001861?mt=2 . . . # Early Middle Ages (Yale) - https://itunes.apple.com/be/course/early-middle-ages/id519131977 . . . # Jennifer Lockett's Classical Archeology - . . . # The Roman World - http://itunes.apple.com/be/itunes-u/the-roman-world/id547152737 . . . ===Knowledge=== # The History of Philosophy . . .
3K - last updated 2013-01-07 11:59 by Auriea
FieldRecordings
MySong http://www.quietamerican.org/ a great place to contribute sounds to: http://soundtransit.nl/ http://www.arteradio.com/wai/rubrique.do?num=17057 . . . LESBROUSSART 1050 BRUSSELS BELGIUM tél. 0032 2 648.47.09 fax 0032 2 648.45.86}} ;) http://www.soundman.de/usa/usa.htm . . . . . .
2K - last updated 2009-05-27 14:03 by Auriea
FiftyBooks
''see also: http://www.goodreads.com/user/show/5685418-auriea, FavoritePodcasts, FromLibrary '' ::: Murderous . . . # The Books of Blood (various storie vols. 1-6) by Clive Barker # Sculpting in Time by Andrei Tarkovski . . . - Patrick Suskind # Fables (1-63) - Bill Willingham # TheUnbearableLightnessOfBeing . . . - Jiminez (8 volume graphic novel) ===2006=== # LadyChatterleysLover - D.H. Lawrence # [[1984]] . . . # [http://www.bibliomania.com/0/2/332/2435/28336/1/frameset.html The Wanderings of Oisin] - William . . .
5K - last updated 2015-01-03 13:37 by Auriea
FilamentList
[[3dPrinting]] <center>[[thumb:FilamentHeads|400px]]</center> <center>'''FILAMENT LIST'''</center> . . . || '''pretty much always: lower temps (+/-140-160°) are better. low heat bed, 80% print speed of . . . ||heated bed necessary @50+/-, print temp: 140-165°C to get smooth, higher temperatures (from 210°) . . . print at 160 – 210° C (tree rings if you . . .
4K - last updated 2020-11-19 14:39 by 93-39-148-182.ip76.fastwebnet.it
FinalFantasy
[[Games]] <html><embed style="width:400px; height:326px;" id="VideoPlayback" type="application/x-shockwave-flash" . . . flashvars=""> </embed></html> . . . http://tale-of-tales.com/forum/viewtopic.php?t=160 Best and Worst list made by some fans http://www.warmech.net/special/awards/awards.html . . .
1K - last updated 2007-10-15 01:13 by Auriea
FiveRiversOfHades
There were five main rivers that appear both in the real world and the underworld. Their names were meant . . . This river circles the underworld seven times.[6] * The Acheron is the river of pain. It is the river . . .
3K - last updated 2019-12-11 12:46 by Auriea-Mercury
Flash
[[Reference]] ==''"The only HTML i need is the embed tag"''== I will begin again my learning of flash. . . . * [http://whatdoiknow.org/archives/001629.shtml the "What do I know" slideshow] * [http://slideshowpro.net . . . Viewer Admin] * [http://www.iparigrafika.hu:16080/pageflip Page Flip] but even better: http://www.page-flip.com/ . . . <source> <TABLE WIDTH="100%" HEIGHT="316" BORDER=0 CELLPADDING=0 CELLSPACING=0 BGCOLOR="#000000"> . . . <OBJECT classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,0,0" . . .
2K - last updated 2007-05-05 13:47 by Auriea
FlashSettings
[[Flash]] http://livedocs.macromedia.com/flash/mx2004/main_7_2/wwhelp/wwhimpl/common/html/wwhelp.htm?context=Flash_MX_2004&file=00000484.html . . . that create HTML documents with embedded Flash content </h1> <p> Playing Flash . . . settings. This document is generated automatically by the Publish command, from HTML . . . parameters in a template document. </p> <p> The template . . . configuring a web server for Flash</a>). . . .
12K - last updated 2006-09-04 10:58 by Auriea
FlatFoot
==How to cure Flat Feet== strange because i'm sure i researched this before and there was nothing on . . . ** <html><iframe width="560" height="315" src="https://www.youtube.com/embed/QY5FW9BPbBg" . . .
3K - last updated 2016-05-14 19:05 by Auriea
Flickr
<html> <a data-flickr-embed="true" href="https://www.flickr.com/photos/entropy8/albums/72157669842528051" . . . src="https://farm8.staticflickr.com/7656/27966756936_1662544615_z.jpg" width="480" height="640" . . . title="Sunset"><img src="https://farm4.staticflickr.com/3906/14457304234_384a863716.jpg" . . .
1K - last updated 2017-08-01 22:49 by Au-Mercury
Florence
OutsideSomeplace <html><iframe width="100%" height="166" scrolling="no" frameborder="no" src="http://w.soundcloud.com/player/?url=http%3A%2F%2Fapi.soundcloud.com%2Ftracks%2F14166762&show_artwork=true"></iframe></html> . . .
1K - last updated 2012-06-07 15:50 by Auriea
FoundScripts
[[Empire]] http://www.naarvoren.nl/artikel/hover.html Pulldown Links with text description underneath . . . } // End --> </script> </head> . . .
16K - last updated 2005-08-09 17:17 by AurieaHarvey
Framelessness
[[Simulation]] ==Equirectangularity== # I’ve got a 360 camera and It’s given me complicated thoughts . . .
1K - last updated 2018-12-05 22:22 by Au-Roma
French
[[Language]] FrenchClassNotes ==words i love== * '''ainsi''' Ainsi va la vie (Such is life) Ainsi soit-il . . . 2008-2009== maandag 18.10-20.50 8/09/2008 29/6/2009 120 euro http://www.hetperspectief.net/index.php?id=198 . . .
1K - last updated 2009-01-27 00:11 by Auriea
FromLibrary
FiftyBooks ''see also: [[bibliotheek]], FiftyBooks, Books'' # [[Bib:Tintoretto]] # [[Bib:Kathe Kollwitz]] . . . * [http://www.asofterworld.com/bloody/index.php . . . Chapel Road by Louis Paul Boon] * William . . . o sci-fi: http://nymag.com/arts/books/features/66294/index2.html * [[Bib:By Grand Central Station . . .
2K - last updated 2015-10-18 12:14 by Auriea
Games
ElegantMedia == Definition == # I would say that all good art contains all the arts. # with videogames . . . (http://www.eurogamer.net/article.php?article_id=64737) cheats [http://www.mycheats.com/view/section/6153/6242/hotel_dusk_215/nintendo_ds] . . .
3K - last updated 2017-06-07 16:45 by Au-Mercury
GamesImLookingForwardTo
[[Games]] <html><object id="flashObj" width="486" height="412" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" . . . name="flashObj" width="486" height="412" seamlesstabbing="false" type="application/x-shockwave-flash" . . . a visual/sound novel of the horror genre [http://64.233.179.104/translate_c?hl=en&u=http://www.chunsoft.co.jp/games/imabikiso/whatsoundnovel.html&prev=/search%3Fq%3Dchunsoft%26hl%3Den%26sa%3DG . . .
3K - last updated 2009-09-26 22:27 by Auriea
GardenArt
[[Botany]] http://www.vvork.com/wp-content/uploads/2007/08/ga.jpg http://www.icaphila.org/exhibitions/washburn.php . . . http://imomus.livejournal.com/309161.html http://echostudiochicago.com/learn/patrick-blancs-vertical-gardens . . .
1K - last updated 2007-08-22 12:28 by Auriea
GawkerArtists
<html> <a href='http://d1.openx.org/ck.php?n=a4b76645&cb=12345' target='_blank'> <img . . . border='0' alt='' ></a> </html> . . .
1K - last updated 2009-04-08 14:39 by Auriea
GentRichards
CastOfThousands my sister Shari's husband of, i don't know, at this point, how many years, 16? 25? 200? . . .
2K - last updated 2006-06-05 20:00 by Auriea
German
[[Language]] ==Hörspiel== bayern 2 Hörspiel Pool, right now it seems they are doing a lot of novels . . . I also like „lange nacht“ (these are 2 hour or . . .
1K - last updated 2019-04-19 21:52 by Au-Roma
GoogleMaps
OutsideSomeplace <source> <script src="http://maps.google.com/maps?file=api&v=2&key=ABQIAAAA8gziLuG785smzT0a6REW3xSFtqeBGFMupH7NOyruGQrymP0yWxSFFVhoZ1mjmkxdzEiGTARy75-iVw" . . .
1K - last updated 2006-06-05 11:03 by Auriea
Graphic Novel
SketchBook ''To download in December'' Purgatory Kabuki (digital graphic novel by YasushiSuzuki] - http://www.dgnproduction.com/pk.html . . . http://forums.cgsociety.org/showthread.php?t=269091 ==hmmmm== [[thumb:22panels|frame|240px|classic . . .
2K - last updated 2006-10-22 11:40 by Auriea
GreekTragedy
CreativeWriting * [[WikiPedia:Choerilus (playwright)|Choeriluĉs]] * [[WikiPedia:Aeschylus]] (c. 525–456 . . . BCE) ** [[WikiPedia:Seven Against Thebes]] (467 BCE) ** [[WikiPedia:The Suppliants]] (463 BCE) ** . . . Fall of Miletus (c. 511 BCE) ** Phoenissae (c. 476 BCE) ** Danaides ** Actaeon ** Alcestis ** Tantalus . . . * [[WikiPedia:Achaeus of Syracuse]] (c. 356 BCE) * [[WikiPedia:Agathon]] (c. 448–400 BCE) * . . . Tantalos** * [[WikiPedia:Sophocles]] (c. 495-406 BCE): ** [[WikiPedia:Theban plays]] , or Oedipus . . .
3K - last updated 2011-01-26 01:33 by Auriea
GutaiManifesto
gutai art manifesto YOSHIHARA JIRŌ To today’s consciousness, the art of the past, which on the whole . . . Geijutsu Shinchō 7, no. 12 (December 1956), pp. 202–04. . . .
8K - last updated 2018-09-10 16:14 by 78-22-179-76.access.telenet.be
HappyBirthday
ProofOfMyExistence [[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060820-sharis_birthday_song.flv|320|240|#000000|high|noscale]] . . .
1K - last updated 2006-12-18 14:09 by Auriea
Havana
OutsideSomeplace [[image:HavanaShore-image]] Where we stayed: http://fr.bedycasa.com/bed-and-breakfast/la-havane-27030?ac=BE7Dlq87KWqHBOQl4CgNXZ6PuHJfuKy6 . . .
1K - last updated 2014-10-31 16:16 by Auriea
HemelSleutel
TuinPlanten http://www.missouriplants.com/Pinkalt/Sedum_telephium_page.html see also: Sedum [[thumb:2005-06-02 . . .
1K - last updated 2007-08-31 14:50 by Auriea
History
<center>[[thumb:2019-12-11|frame|600px]]</center> Auriea Harvey b.1971 USA (Indianapolis)/EU . . . GLOBALE: Games and Politics] * 2016-2017 ''Teaching: Parsons School of Design, Paris . . . (Drawing, Imaging, 3D)'' * '''2016 transition to [http://song-of-songs.org Song of Songs]''' . . . * 2016 [http://www.milanogamefestival.com/collection/ Milan . . . cyberlounge, Museo Tamayo, Mexico City * 2006 [https://creative-capital.org/projects/the-path/ . . .
6K - last updated 2019-12-16 13:21 by Au-Elektra
HomebrewDS
[[Games]] MakingDSGames latest firmware - http://dshere.com/ http://www.handheldsources.com/M3DS/Download_M3DSS.html . . . - http://boards.polycount.net/showthread.php?t=51691 * Blender export script - http://hackerpilot.org/dsblender.php . . . DScratch] [[tube:u6D1M_URBow 300 240 0]] * use with MaxMsp [http://www.cycling74.com/forums/index.php?t=msg&goto=102751&rid=0&S=b9bb8f6348099a59b0a3bc777c427f5c][http://mccormick.cx/] . . . [http://createdigitalmusic.com/2006/03/22/mobile-music-tracker-for-nintendo-ds-ds-homebrew-music-roundup/] . . . http://www.4colorrebellion.com/archives/2006/10/09/comic-book-ds-homebrew-impressions/ ** PictoDS . . .
5K - last updated 2010-10-06 10:27 by Auriea
HomepageContestJudging
ToDo ==2005== this year Michael and I are giving the prize for Best Homepage made by a Couple. http://art.teleportacia.org/1000$/page2.html . . . Luxembourg, 1987 * 2 dollars, banknote, USA, 1976 * 50 Piastres, banknote, Egypt * 3, 100 franc banknotes, . . .
2K - last updated 2007-05-29 13:29 by Auriea
HonorineJobert
TuinPlanten [[Gog:Honorine Jobert]] http://www.mobot.org/gardeninghelp/plantfinder/Plant.asp?code=B340 . . . rhizomes. Single flowers (2-3" diameter) with 6-9 overlapping white petaloid sepals and yellow center . . .
3K - last updated 2005-04-04 10:20 by Auriea
HorrorGameArticles
[[Games]] * interview with AkiraYamaoka and Christophe Gans about the Silent Hill Movie http://www.1up.com/do/blogEntry?bId=6605116&publicUserId=1002415 . . . of Rose http://www.gamasutra.com/features/20060607/sheffield_01.shtml * Guardian interview with . . . http://blogs.guardian.co.uk/games/archives/2006/02/07/i_call_it_subtracting_horror_project_zero_creator_speaks.html . . .
1K - last updated 2006-11-25 17:54 by Auriea
Hypnosis
[[Research]] <tt>'''Hypnotist thief hunted in Italy'''[http://news.bbc.co.uk/2/hi/europe/7309947.stm] . . . name="allowFullScreen" . . . type="application/x-shockwave-flash" allowscriptaccess="always" . . .
2K - last updated 2009-10-17 17:14 by Auriea
ICO
[[tube:SEMdx6fPkoA 640 480 0]] [[tube:F0b3sOJ6BeM 640 480 0]] . . .
1K - last updated 2007-12-18 19:48 by Auriea
IULM
[[Projects]] GAME LAB: Studio for Experimental Asset Creation Professor AURIEA HARVEY M.A. IN GAME DESIGN . . . its sights, sounds, smells. [[tube:PgCOH1W7tTg 560 315 0]] [[tube:ZYnS3kKTcGg 560 315 0]] WEEK 2: How . . . that intimacy motion capture [[tube:a_AwDv9Al28 560 315 0]] WEEK 3: Landscapes WEEK 4: Time WEEK 5: . . . Self directed project, problem solving WEEK 6: Self directed project, problem solving WEEK 7: Self . . .
4K - last updated 2017-09-22 13:55 by Au-Danae
ImageMagick
[[Reference]] The guy making the Oddmuse:Image_Thumbnails extension is working with this. I should figure . . . en Melody: file:///usr/local/share/ImageMagick-6.1.7/index.html . . .
1K - last updated 2005-06-18 11:16 by Auriea
ImmortalComputing
RandomIdeas ''see also: MemoriesWereMeantToFade, NothingEverDiesOnTheNet'' Microsoft is trying to patent . . . which would let people store . . . http://seattlepi.nwsource.com/business/300636_msftimmortal22.html E-mail from the grave? Microsoft . . . P-I reporter Todd Bishop can be reached at 206-448-8221 or toddbishop@seattlepi.com. © 1998-2007 . . .
8K - last updated 2007-05-10 15:48 by Auriea
InSearchOfLostTime
FiftyBooks == ...in Proust the present is always absent. == # SwannsWay # -- # -- # -- # -- # -- # -- . . . GoodReads http://www.goodreads.com/group/show/75460-2013-the-year-of-reading-proust Final Reading Schedule . . . http://www.goodreads.com/topic/show/1007611-reading-schedule-final Project Gutenberg copy, . . . ----- [[image:2005-10-06_remembrance_of_things_past]] . . .
1K - last updated 2013-01-07 11:50 by Auriea
In the Kingdom No.19
<html> <div style="width:100%; height: 100vh; left:0; top:0px; padding:0; margin:0; background: . . . background-color:#fff; FONT-SIZE:16PX;">A U R I E A . X L V I I I</a><BR> . . .
3K - last updated 2020-10-03 14:13 by Auriea
Indianapolis
OutsideSomeplace http://farm4.static.flickr.com/3518/3718279091_d2008057b9_b.jpg ==free wifi== * http://www.wififreespot.com/in.html . . . Coffeehouse - 825 N. Pennsylvania St. - (317) 269-8426 Ah Barista Cafe - 201 S. Capitol Ave Suite . . . 110 - 317-638-2233 Au Bon Pain - 901 Indiana Ave Bjava Coffee . . . and Tea - 5510 Lafayette Rd - 317 280 1236 Boulevard Place Caf� - Butler Tarkington - 4155 . . . Boulevard Place Broadripple (eWireless.com) - 6304 Guilford Ave. - 316-536-0400 Buffalo Wild Wings . . .
4K - last updated 2020-04-06 17:14 by Auriea-Mercury
InterMap
This is the intermap -- it lists all URL abbreviations for this site. Only the lines starting with exactly . . . . . .
2K - last updated 2015-08-07 17:35 by Auriea
InterviewsWithGameDesigners
[[Games]] * Tsutomu Kouno (Loco Roco) http://www.gamesindustry.biz/content_page.php?aid=25196 . . .
1K - last updated 2007-05-22 17:11 by Auriea
IsaacNewton
CastOfThousands ''i like the way this article reads{{clipped from: http://www.thehindu.com/opinion/op-ed/article827154.ece}}'' . . . didn't like wasting his time. Born December 25, 1642, the great English physicist and mathematician . . .
10K - last updated 2010-12-07 12:32 by Auriea
Istanbul
OutsideSomeplace <html><iframe width="100%" height="166" scrolling="no" frameborder="no" src="http://w.soundcloud.com/player/?url=http%3A%2F%2Fapi.soundcloud.com%2Ftracks%2F23627412&show_artwork=true"></iframe></html> . . .
1K - last updated 2012-06-07 15:49 by Auriea
JadePlant
TuinPlanten [[thumb:2005-06-04 JadePlant|frame|right|I bought this at the plant store around the corner. . . . scoop of bone meal added. The optimum soil ph is 6.5.Jade plants have an active and a dormant growing . . .
5K - last updated 2005-06-04 22:00 by Auriea
JamesBaldwin
CastOfThousands [[tube:hDjaqhuSqQE 640 480 0]] . . .
1K - last updated 2009-01-09 22:18 by Auriea
Jitter
MaxMsp Jitter + Ogre = [http://www.cycling74.com/forums/index.php?t=msg&goto=168555&rid=0&S=8278e7f3ba1a06d814259eea9ff20297] . . .
1K - last updated 2009-06-26 14:36 by Auriea
JosephBeuys
CastOfThousands [[thumb:2006-06-05_The_Big_German_20h25|left|frame|150px|photos taken by Mike S. at MOMA . . .
1K - last updated 2006-06-05 20:33 by Auriea
JoyouKanji
[[日本語]] These are the 常用漢字 (Jouyou Kanji), which have been specified for use in schools . . . 築 輸 績 講 謝 織 職 額 識 護 ==Grade 6== 亡 寸 己 干 仁 尺 片 冊 収 処 幼 庁 . . .
10K - last updated 2005-06-22 11:37 by Auriea
JudasPenning
TuinPlanten [[Gog:Lunaria]] ooh, it turns into this! [[image:lunaria]] Family: Brassicaceae (brass-ih-KAY-see-ee) . . . biennis Category: Biennials Height: 24-36 in. (60-90 cm) Spacing: 15-18 in. (38-45 cm) Sun . . . seedlings next season Soil pH requirements: 5.6 to 6.0 (acidic) 6.1 to 6.5 (mildly acidic) 6.6 to . . .
1K - last updated 2007-01-05 12:32 by Auriea
KanjiSKIP
[[日本語]] The SKIP method of identifying a Kanji that you can see but don't know how to pronounce. . . . First heard of it from this guy LJ:tithonus/525276.html ===Websites about it=== http://linear.mv.com/cgi-bin/j-e/tty/skip?SASE=/cgi-bin/j-e/tty/kanjidoc.html . . .
1K - last updated 2005-10-01 10:14 by Auriea
KasselDokFest-ArtistStatement
[[Example_No.22]] I was born in Indianapolis Indiana in 1971. After graduating high school, at age 18 . . . day. We wrote the Realtime Art Manifesto in 2006 based on our desire to see more artists using the . . . and physical installations. I teach. In 2016-2017 at Parsons Paris I taught drawing and digital . . .
13K - last updated 2018-11-15 02:51 by Auriea.
Kinect
DigitalSculpture in addition to the main microsoft SDK you can install: * [https://developer.leapmotion.com/get-started . . . Language packs] . . .
1K - last updated 2017-08-24 00:41 by Au-Danae
KrzesloKantora
<center>[[vimeo:229539717 160 120 0]][[vimeo:229539724 160 120 0]][[vimeo:229539728 160 120 0]][[vimeo:229539735 . . . 160 120 0]][[vimeo:229539738 160 120 0]][[vimeo:229539744 . . . 160 120 0]][[vimeo:229539751 160 120 0]][[vimeo:229539754 . . . 160 120 0]][[vimeo:229539763 160 120 0]][[vimeo:229539774 . . . 160 120 0]][[vimeo:229539783 160 120 0]][[vimeo:229539616 . . .
1K - last updated 2017-09-06 19:12 by Au-Mercury
KunstendecreetVisieMateriaal
||''P A S T''' || || <center>[[thumb:ToTGames|1020px]]</center> || ||My work with Tale of . . . ||More images: Minorinth Development Log: . . . ||'''EXHIBITIONS'''|| ||''V&A Museum, London . . . (2018-2020)''|| ||[[thumb:VandA_exhibition1|600px]]|| ||https://www.vam.ac.uk/articles/about-videogames-exhibition|| . . . experiments|| ||[[thumb:Example_No.22_install01|160px]] [[thumb:Example_No.22_install02|160px]] [[thumb:Example_No.22_install03|160px]] . . .
5K - last updated 2019-02-26 00:56 by Auriea
LJCustomization
[[Reference]] Learning S2 http://www.livejournal.com/support/faqbrowse.bml?faqid=172 Tags http://www.livejournal.com/manage/tags.bml . . . http://www.livejournal.com/community/lj_style/369738.html Journal (lastn) -> styleid=596008 Day . . . -> styleid=596315 Other People (friends) -> styleid=596256 Time . . . (calendar) -> styleid=596247 . . .
1K - last updated 2005-10-04 13:47 by Auriea
LaVitaNova-6
image/png
832K - last updated 2021-02-23 12:43 by Auriea
La Vita Nova
[[thumb:LaVitaNova-1|700px]] [[thumb:LaVitaNova-2|700px]] [[thumb:LaVitaNova-3|700px]] [[thumb:LaVitaNova-4|700px]] . . . [[thumb:LaVitaNova-5|700px]] [[thumb:LaVitaNova-6|700px]] . . .
1K - last updated 2021-02-23 12:42 by Auriea
LambdaMOO
[[MOO]] telnet://lambda.moo.mud.org:8888 <pre> Store | West Bank---LambdaSt.---Street... | | Landing . . . Reduction Feature Object of Godlike Powers" (#26787), which attempts to minimize their resource use . . . information on this feature object, type 'help #26787'. One last comment about lag. You should think . . .
4K - last updated 2019-10-21 19:32 by Auriea.
LastFM
RssFeeds http://loczek.webd.pl/cover/?u=womanonfire&i=10&s=100 <html> <a href="http://www.last.fm/user/womanonfire/?chartstyle=basicrt10"><img . . . classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" width="184" height="284" . . . + '&shrink=0', 'lastfm_popup', 'height=364, width=224, location=no, toolbar=no, menubar=no, . . .
4K - last updated 2010-05-21 13:48 by Auriea
LastLifeInTheUniverse
[[Quoth]] http://film.indiefilipino.com/item.php?id=93 http://filmbrain.typepad.com/filmbrain/2004/05/found_in_transl.html . . . 1:47:41 Resolution: 704x400 Aspect Ratio: 16:9 Frame Rate: 23.976 fps Video Bitrate: 908 kbps . . . Video Codec: XviD Audio: 48000hz, 16bps, 2ch MP3 VBR File Size: 716.7 MB Genre: Thriller . . . Thai, Japanese, English iMDB Rating: 8.0/10 (361 votes) iMDB Link: http://www.imdb.com/title/tt0345549/ . . . English title) 1 00:01:24,781 --> 00:01:27,614 My name is Kenji. 2 00:01:27,701 --> 00:01:32,491 . . .
27K - last updated 2005-07-24 13:56 by Auriea
LeNombril
<html><iframe width="560" height="315" src="https://www.youtube.com/embed/Pw9ARZJf75U?ecver=1" . . .
1K - last updated 2017-07-31 23:50 by Au-Mercury
LearningToDrive
ProofOfMyExistence ==internationaal rijbewijs== * http://www.gent.be/eCache/THE/412.cmVjPTM3NzYw.html . . . ==Rijbewijs== http://www.gent.be/eCache/THE/1/265.cmVjPTM4NDgx.html http://www.goca.be/nl/p/rijbewijs . . .
1K - last updated 2014-09-16 15:45 by Auriea
Lendelede
OutsideSomeplace where Michael's parents live http://farm5.static.flickr.com/4147/4982248862_b69c67199a_b.jpg . . .
1K - last updated 2010-09-13 10:07 by Auriea
LifeDrawing
[[Drawing]] ''see also: drawing, anatomy, LeonardoDaVinci, CaproniCasts, SightSize'' ''also! also!: http://atelierauriea.tumblr.com/'' . . . door de aanwezigen. . Vooraf aanmelden (0475.65.39.11) maakt het ons organisatorisch makkelijk. . . . [http://forums.cgsociety.org/showthread.php?p=3622448 anatomy thread] on CGTalk. (terribly outdated . . . . . .
4K - last updated 2014-09-29 17:47 by Auriea
Ling
'''Nicci-Ling Levka Almere de la Perla de las Esmereldas van Gent''' b. [[04-15-2014]] to [http://www.katten-enzo.nl/2014-Delphine-Vladimir.htm . . . src="//instagram.com/p/qcQhjsFiQk/embed/" width="612" height="710" frameborder="0" scrolling="no" allowtransparency="true"></iframe></html> . . . width="600" height="600" frameborder="0"></iframe><script . . . width="600" height="600" frameborder="0"></iframe><script . . . width="600" height="600" frameborder="0"></iframe><script . . .
2K - last updated 2014-11-13 15:33 by Auriea
Links
A traditional links page. More to this when I have time and inspiration. * http://stanleylieber.com * . . . She Who Sees the Unknown]'' I am eager to experience . . . confidence. http://woodlandsecrets.co/episode/26 . . .
2K - last updated 2018-04-06 17:40 by Au-Mercury
LocalNames
These are LocalNames for external links. whenever your use them they will be automatically linked. <tt> . . . . . .
2K - last updated 2014-01-21 13:54 by Auriea
Lodewijk
[[thumb:2014-11-12|500px]] Lodewijk Casper Khalo van Gent a.k.a. Louis (quatorze) a.k.a. Leo or Lou a.k.a. . . . figure out what we want to call him. b. 2014-08-06 to Cassandra & Bacchus Khalo . . .
1K - last updated 2014-11-13 15:35 by Auriea
Louvre-BoulogneReview
[[Paris]] # After class that day, shared a great bottle of Langudoc with Della and Ed whom Ive not seen . . . ''le martyre des saintes Proces et Martineien'' 1629-1630 ## i love painting tht speaks it's story plain. . . .
2K - last updated 2017-03-02 19:18 by Au-Mercury
MacBookPro
[[Empire]] ''see also: OsX, emulation'' [http://www.ifixit.com/Guide/Repair/MacBook-Pro-15-Inch-Core-2-Duo-Model-A1211-Hard-Drive-Replacement/459/1 . . . http://forum.parallels.com/showthread.php?t=6768&page=5&highlight=Tools+Boot+Camp [[image:2006-11-30_Bonnie_and_Clyde]] . . . [[image:2010-06-24 io and jupiter_icons]] . . .
1K - last updated 2010-06-24 15:17 by Auriea
Madagascar
OutsideSomeplace some links about the place we will most likely retire to ;) * http://en.wikipedia.org/wiki/Madagascar . . . * http://valamaty.blogspot.com/2006_03_01_archive.html . . .
1K - last updated 2007-09-04 10:44 by Auriea
MakeClothes
Blender3D http://workflows.grailmedia.com/makeclothes/ Step 1: Set up MakeClothes Open Blender Press . . . only; leave meshes for other meshes intact) Step 6: Unwrap your clothing Select various edges of the . . .
3K - last updated 2017-07-17 20:07 by Au-Roma
MakingDSGames
HomebrewDS http://forums.cgsociety.org/showthread.php?p=4727543 <source> Polycount per character . . . frame is about 2000. You can have texture size 256 but its not worth it because usually characters wont . . . big enough on the DS screen due to its size so, 64 or 128 texture plus 300-500 tris, 20-24 bones per . . .
2K - last updated 2007-10-23 22:04 by Auriea
MamaDoris
CastOfThousands [[flash:http://auriea.com/live.swf?thePic=http://keystrokes.org/Webcam.jpg&|160|120|#000000|best|exactfit]] . . . offkey but..) Made a wikisite for her 2005-04-06 http://keystrokes.org/index.pl . . .
1K - last updated 2010-05-21 13:37 by Auriea
MamasHouse
[[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060817-mamashallway.flv|240|320|#ff0000|high|noscale]] . . .
1K - last updated 2006-12-27 23:53 by Auriea
MamiyaC3
[[photography]] http://farm3.static.flickr.com/2134/2509929964_44896b16bc.jpg . . .
1K - last updated 2009-01-05 00:31 by Auriea
MargueriteDuras
CastOfThousands [[thumb:MD|left]] from:http://www.france.diplomatie.fr/label_france/ENGLISH/LETTRES/DURAS/duras.html . . . Marguerite Duras died in Paris, on March 3, 1996. Throughout her life and to her dying breath, this . . . absolute love (The Ravishing of Lol Stein, 1964; The Vice-Consul, 1966), crime or insanity (Moderato . . . cantabile, 1958; L'Amante anglaise, 1967). These heroines, incapable of truly communicating, . . . expectation (Afternoon of Monsieur Andesmas, 1962), suggest "these ambiguous and inextricable situations" . . .
11K - last updated 2010-04-15 09:56 by Auriea
MarmosetToolbag
[https://marmoset.co/posts/the-toolbag-baking-texturing-and-rendering-handbook/?utm_source=Marmoset+Newsletter&utm_campaign=74be762255-Email_Newsletter_22_Steph_Handbook&utm_medium=email&utm_term=0_5665c2c57f-74be762255-318423917&ct=t(Email_Newsletter_22_Steph_Handbook)&mc_cid=74be762255&mc_eid=81735d17a5 . . .
1K - last updated 2022-06-13 13:49 by Auriea
Martha
CastOfThousands [[background external:http://farm4.static.flickr.com/3182/2910930013_cb3490c72b.jpg|repeat . . . #fe62c9]] http://farm4.static.flickr.com/3169/2837461044_214dd5e8aa_b.jpg . . . http://farm4.static.flickr.com/3200/2836838413_11cb9c931f_b.jpg http://farm4.static.flickr.com/3217/2760938362_e34b452333_b.jpg . . . http://farm4.static.flickr.com/3092/2636567843_6ef05fd885_b.jpg http://farm4.static.flickr.com/3211/2711744348_8afe7809be_b.jpg . . . . . .
1K - last updated 2010-04-15 09:53 by Auriea
MarvelsOfThingsCreatedAndMiraculousAspectsOfThingsExisting
[[mythology]] A large animal, possibly big as an elephant which roams the perimeter of the world. His . . . Mughal India, possibly Punjabi. NLM MS P2, fol. 169a [http://www.nlm.nih.gov/exhibition/islamic_medical/catalog_07.html]'' . . . [http://www.nlm.nih.gov/hmd/arabic/images2/p2169a.jpg . . .
4K - last updated 2006-07-09 23:14 by Auriea
MaryMagdalene
ThreeMarys [https://www.biblegateway.com/passage/?search=Luke%208:2 Luke 8:2], [https://www.biblegateway.com/passage/?search=Mark+16%3A9&version=NIV . . . Mark 16:9] (casting out seven demons, first to see Jesus . . . [https://en.wikipedia.org/wiki/Matthew_27:55-56 Matthew 27:56], [https://www.biblegateway.com/passage/?search=Mark+15%3A33-40&version=NIV . . . Matthew 27:61], [https://www.biblegateway.com/passage/?search=Mark+15%3A47&version=NKJV . . . Luke 7:36-50] (sinful woman washing . . .
6K - last updated 2017-03-28 18:58 by Au-Danae
MassExtinction
[[Reference]] Earth’s five previous mass extinctions End-Ordovician, 443 million years ago A severe . . . age led to sea level falling by 100m, wiping out 60-70% of all species which were prominently ocean . . . the oceans starved of oxygen. Late Devonian, c 360 million years ago A messy prolonged climate change . . . for dinosaurs to flourish. Cretaceous-Tertiary, 65 million years ago An giant asteroid impact on Mexico, . . .
2K - last updated 2017-07-11 02:06 by Au-Roma
MaxMspJitter
VisualProgramming realtime audiovisual programming. ''see also: MySong, DigitalSculpture, RealTime'' . . . http://www.mat.ucsb.edu/~whsmith/xray.html . . . . . . * atari emulator [http://www.mmonoplayer.com/jit2600.php] * the all important [http://www.jmcouturier.com/download.html . . .
4K - last updated 2017-04-18 19:34 by Au-Mercury
MediumFormat
[[photography]] http://farm4.static.flickr.com/3220/2511129142_9f8bf66ac0_o.jpg http://farm3.static.flickr.com/2321/2539059861_0ace5a9b75.jpg . . . http://farm3.static.flickr.com/2134/2509929964_70090a1737_o.jpg http://silverbased.org/load-120-film/ . . .
1K - last updated 2010-07-05 17:49 by Auriea
MedusasMirror
[[Projects]] project where i make a webcam application in max.msp.jitter. on second version already: . . . [http://www.renaissanceastrology.com/chartweek6-15-07.html Magic Mirrors], Gog:Spiritus+Mundi, etc. . . .
1K - last updated 2007-06-04 19:31 by Auriea
MemoriesWereMeantToFade
RandomIdeas ''see also: abyss, ImmortalComputing, NothingEverDiesOnTheNet'' * http://www.vmsweb.net/attachments/pdf/Useful_Void.pdf . . . EU | News | PC Pro http://www.pcpro.co.uk/news/362527/people-have-right-to-be-forgotten-online-says-eu#ixzz14QaGssYY . . .
4K - last updated 2010-11-05 18:53 by Auriea
Metropolis
<html><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/DukMPx6Fn_c&hl=en&fs=1&color1=0x2b405b&color2=0x6b8ab6"></param><param . . . src="http://www.youtube.com/v/DukMPx6Fn_c&hl=en&fs=1&color1=0x2b405b&color2=0x6b8ab6" . . .
1K - last updated 2009-06-11 11:38 by Auriea
MexicoCity
OutsideSomeplace ==2014== In Mexico City there are a number of activities that may be appealing to them. . . . . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157601264837454%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157601264837454%2F&set_id=72157601264837454&jump_to=" . . .
2K - last updated 2014-09-29 11:55 by Auriea
Minorinth
[[Simulations]] <center>[[vimeo:302579640 640 360 0]] '''VR Labyrith exploration, for a 4x4 meter . . . [[thumb:Minorinth-scrn6|400px]] [[thumb:Minorinth-scrn7|400px]] [[thumb:Minorinth-scrn8|400px]] . . .
2K - last updated 2020-12-29 00:57 by Auriea
Minorinth-scrn6
image/jpeg
231K - last updated 2018-09-29 20:08 by Auriea
MoederKruid
TuinPlanten '''early spring 2006:''' It didn't fair too well end of last summer. it was swarmed by bugs . . . Self Portrait" finished on 2006-03-13. a tribute to the first year of my garden (2005) . . .
4K - last updated 2006-03-18 16:57 by Auriea
Mother
[[Games]] [http://mother3.fobby.net/ Mother 3 fan translation project] [http://www.gamefaqs.com/portable/gbadvance/file/914622/42740 . . . "the literature of the moment" a critique . . . a review of mother 3 (insertcredit.com GAME . . . OF THE YEAR, 2006)] . . .
1K - last updated 2007-10-04 13:16 by Auriea
Movies
[[Movies]] <list "Movies"> ----- ''see also: [[Cinema2007]]'', http://www.theauteurs.com/users/81386 . . . # In the Mood For Love/Chungking Express/2046/Fallen Angels - Wong Kar Wai # My Neighbor Totoro . . . ** ChungKingExpress ** InTheMoodForLove ** [[2046]] * HalHartley ** UnbelieveableTruth * PedroAlmodovar . . .
1K - last updated 2009-07-06 12:34 by Auriea
MovingToRome
https://www.belgium.be/nl/huisvesting/verhuizen/naar_het_buitenland https://www.immobiliare.it/agenzie-immobiliari/168346/zanni-roma/ . . .
1K - last updated 2019-05-18 17:15 by Auriea
Murakami interview1
[[Quoth]] from: http://www.salon.com/books/int/1997/12/cov_si_16int.html BY LAURA MILLER | The heroes . . . train in Tokyo in March 1995. I interviewed 63 victims who were on the train that day. I did it . . . in 1949 and I was in the university in the late '60s, a time of revolution and counterculture. We used . . . trust anything like that at all. I wake up at 6 in the morning and go to bed at 10, jogging every . . . But I recognized when I was interviewing those 63 ordinary people -- they were very straightforward, . . .
20K - last updated 2005-08-09 17:17 by AurieaHarvey
Murakami interview2
[[Quoth]] from: http://www.sundayherald.com/46885 '''Found in translation''' Haruki Murakami writes about . . .
16K - last updated 2005-10-21 13:52 by Auriea
MuziekLes
MySong i will take music lessons in the summer. i want to better understand the music i love so much. . . . . . . . . . juni 2007 t/m donderdag 28 juni 2007 * maandag: 16u00 tot 19u00 * dinsdag: 16u00 tot 19u00 * woensdag: . . . 13u30 tot 19u00 * donderdag: 16u00 tot 19u00 * NIET OP VRIJDAG & ZATERDAG maandag . . .
2K - last updated 2007-10-07 20:47 by Auriea
MySong
[[Projects]] ==instruments== * MU Midi Controller Wacom instrument - http://www.musicunfolding.com/MU_MIDI_Controller.html . . . Everybody does . . . ===My Heros=== * FM:Colleen . . . * tips http://www.apple.com/support/garageband/hottips/ . . . ==Hardware== * [[image:RolandTR-606]] ** http://machines.hyperreal.org/manufacturers/Roland/TR-606/info/drumantix/ . . .
5K - last updated 2018-09-10 17:47 by Auriea.
MyTopOneHundredSongsOfAllTime
SongBook upon a dare from LJ:hiphopdiary http://hiphopdiary.livejournal.com/488494.html?nc=5&style=mine . . . your girlfriend / Prince # Mas Que Nada / Brazil 66 # Creep in the Cellar / Butthole Surfers # Ik Kan . . . De Mol # Troubled Waters / Cat Powers version # 6 Different Ways / The Cure # Pocket Full of Change . . .
5K - last updated 2006-12-15 12:13 by Auriea
NET.ARCHEOLOGY
I was online from the “beginning” and first made a reputation as a web designer/net artist in 1996. . . . It was a web browser, a parser, which . . . p.s. kiss.entropy8zuper.com https://vimeo.com/365031 https://www.flickr.com/photos/entropy8/albums/72157594500928662 . . .
4K - last updated 2021-01-25 13:00 by Auriea
NegusPoem1and2
SongBook NEGUS POEM 1&2 sleep in my eye but still I gotta rise we wind thru cycles of time yet we . . . divine! real negus never die [[tube:awZQryp7v_I 560 315 0]] -KeiyaA . . .
1K - last updated 2020-09-03 10:33 by Auriea-Nero
NewYearsResolutions
ProofOfMyExistence i want to believe that these can be constructive.... lets try. the wording is probably . . . * yoga regularly * save up some money ==2016== * swim two times a week * 5 year plan * grad school . . .
6K - last updated 2018-01-01 15:56 by Au-Mercury
Nihonga
Outline of "Nihonga"-Traditional Japanese Painting Nihonga is one of the painting styles of Japapn. Fumiyo . . . The term coined during the Meiji period (1868-1911) which literally means gJapanese-style painting. . . . painting): Japanese painting in the Edo period (1615-1868) that was influenced by Western painting techniques, . . . of painting done by Japanese artists between 1868 and 1945 using Western perspective and chiaroscuro, . . . from China along with Buddhism in the 5th and 6th centuries. The papermaking technique was introduced . . .
17K - last updated 2010-01-29 18:16 by Auriea
NinaSimone
CastOfThousands [[tube:GUcXI2BIUOQ 320 240 0]] [[tube:CJA69C6SlRk 320 240 0]] . . .
1K - last updated 2008-02-13 02:59 by Auriea
NoQuarter
''for screenshots see: [[Minorinth]]'' ==Working Title: MINORINTH/LABYTAUR== <center>[[thumb:Minorith-lookfeel|600px]] . . . ===Formal=== * [[thumb:Labytaur-ref|600px]] * Jerusalem, games, heaven [http://www.phaistosgame.com/Phaistos48.htm] . . . ===Conceptual=== * [[vimeo:130888009 560 315 0]] * [[tube:O0VIxubUu4c 560 315 0]] ===Technical=== . . . * Seeing into the real [[tube:wD841MM6IvY 560 315 0]] '''but just make the chaperone really . . . height="480" src="https://sketchfab.com/models/6c18376147ef421788740f5b7593d250/embed" frameborder="0" . . .
6K - last updated 2018-09-29 23:01 by Auriea.
NorwegianWood
FiftyBooks A life is filled with connections to many people some strong, some weak connections. This . . . http://www.livejournal.com/users/womanonfire/645911.html So yeah, today I was stuck at a "thing" . . . that sort of thing. It was boring as hell. 6 hours of my life spent listening kids sing songs. . . . I was telling someone just tonight that i thought . . .
3K - last updated 2006-06-15 20:50 by Auriea
NothingEverDiesOnTheNet
RandomIdeas ''see also: ImmortalComputing, MemoriesWereMeantToFade'' i used to believe this. not sure . . . still can. [http://www.daniweb.com/blogs/entry1464.html mega zombie botnets]!! =) related: [::TheStrengthOfWeakTies][http://www.stanford.edu/dept/soc/people/faculty/granovetter/documents/TheStrengthofWeakTies.pdf], . . .
1K - last updated 2007-08-26 20:05 by Auriea
ObjectSeries
[[Sculpture]] * [[Object 01]] - head * [[Object 02]] - Magdalene * [[Object 03]] - the cup * [[Object . . . * [[Object 05]] - XLVI and a day * [[Object 06]] - Twins * [[Object 07]] - rings ----- <list . . .
1K - last updated 2018-09-13 15:43 by Au-Mercury
Object 01
ObjectSeries <center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" . . . . . . <center>cm:3.07 x / 5.316 y / 3.696 z in:1.209 x / 2.093 y / 1.455 z<BR> . . . <center><html><iframe width="625" height="652" frameborder="0" allowfullscreen allowtransparency . . . <center><html><iframe width="560" height="315" src="https://www.youtube.com/embed/4VRe_OXnLGs?rel=0" . . .
1K - last updated 2017-02-27 14:08 by Auriea
Object 02
ObjectSeries <center><html><nobr><div class="sketchfab-embed-wrapper"><iframe . . . width="300" height="600" src="https://sketchfab.com/models/3d471d09451d46188b617228bdc0f47b/embed?autostart=1&camera=0&transparent=1&ui_related=0" . . . width="300" height="600" src="https://sketchfab.com/models/1a43c5fc8b0e4c39bace1891570f5684/embed?autostart=1&camera=0&transparent=1&ui_related=0" . . . ''[https://www.patreon.com/posts/object-02-8598651 supported by Patreon]''</center> ----- ==WIP== . . . 10px 0 rgba(0,0,0,0.15); margin: 1px; max-width:658px; padding:0; width:99.375%; width:-webkit-calc(100% . . .
6K - last updated 2017-03-28 19:42 by Au-Danae
Ocean
[[Quoth]] ''see also: sea'' [[image:VijaCelmins_ocean]] ''Call me Ishmael. Some years ago -- never mind . . . src="http://player.vimeo.com/video/15341669" width="400" height="225" frameborder="0"></iframe></html> . . .
2K - last updated 2010-11-26 13:27 by Auriea
OilPainting
==INVOCATION== [[thumb:2014-09-24|frame|300px|sketching Rubens in Brussel.]] ==canvas== * http://www.claessenscanvas.com/en . . . http://www.danschultzfineart.com/blog/?p=476#sthash.nnQcNdZE.dpbs * don't have "Miracle Muck" . . .
1K - last updated 2014-09-25 17:08 by Auriea
OnNotWinningTheNobelPrize-DorisLessing
[[Quoth]] Nobel Lecture December 7, 2007 On not winning the Nobel Prize I am standing in a doorway looking . . . stumps, and charred remains of fires where in '56 was the most wonderful forest I have ever seen, all . . .
27K - last updated 2007-12-09 23:39 by Auriea
OneHundredYearsOfSolitude
[[Quoth]] [[image:Monday]] [[thumb:2006-06-02_champagne_10h21|600px]] ==Arcadio Buendia's last words== . . .
3K - last updated 2006-06-02 10:23 by Auriea
Orchids
==Orchidaceae Phalaenopsis== [[image:2012-08-27 orchid]] PHALAENOPSIS (fal-en-OPP-sis) - These plants . . . as we do. The minimum temperature at night is 60-65 °F, while the average daytime temperature should . . . and Brian Rittershausen ----- [[thumb:2005-06-28 orchids|frame|right|150px|Received yet another . . .
4K - last updated 2012-08-27 11:55 by Auriea
OsX
[[Reference]] ==Samba performance under Mac OS X== <source> I have a NetBSD/i386 3.0 file server . . . and put this in the root of your windows drive. 6. Now boot in OSX and your drive has an own icon! . . . ----- * global keyboard layouts - http://www-306.ibm.com/software/globalization/topics/keyboards/registry_index.jsp . . . Full Keyboard Access Highlight Toolbar "Control-F6" = Full Keyboard Access Highlight Utility window . . . "8" = Move Up "2" = Move Down "4" = Move Left "6" = Move Right "1, 3, 7, 9" = Move Diagonally "5" . . .
13K - last updated 2008-10-31 17:04 by Auriea
OutsideSomeplace
ProofOfMyExistence <list OutsideSomeplace> <html> <img src="http://www.world66.com/myworld66/visitedCountries/worldmap?visited=CAUSMXATBECZFRDEGRISITLUNLPLESCHUKVAJP"><br/> . . . <a href="http://www.world66.com/myworld66">create your own visited country . . .
1K - last updated 2013-09-10 15:54 by Auriea
Ovid-CadmusHarmonia
[[Quoth]] '''[[Ovid]] Metamorphoses Book IV:563-603 Cadmus and Harmonia become serpents''' The son of . . .
3K - last updated 2015-10-07 10:30 by Auriea
Painter
[[Reference]] to get Painter 6 to run on modern system: http://dev.depeuter.org/metacreations_fix_30.php . . . http://blenderartists.org/forum/showthread.php?376974 <source> Here is a Blender add-on to import . . . from RIFF files. Corel Painter can store up to 65536 levels of impasto depth information per layer . . . will not keep them! Save impasto images as BW 16-bit PNG to preserve full depth information. Mask . . . usually 0x0170 4) the four bytes at offset 0x0164 name the start of the layer's bump image; the size . . .
7K - last updated 2015-10-17 15:12 by Auriea
Panorama
exiftool -FullPanoWidthPixels=6000 -FullPanoHeightPixels=3000 -CroppedAreaLeftPixels=0 -CroppedAreaTopPixels=783 . . . -CroppedAreaImageWidthPixels=6000 -CroppedAreaImageHeightPixels=1433 -ProjectionType=cylindrical . . .
1K - last updated 2016-08-17 18:05 by Auriea
Paris
OutsideSomeplace ==Next time== * http://www.bourdelle.paris.fr/en * another trip to musee moreau (recently . . . 19 October 2010 - 23 January 2011 Musée de . . . Doubles from 140 euros, around $200 at $1.46 to the euro. The phrase “design hotel” finds . . . Grande Galerie de l’Evolution, 36, rue Geoffroy Saint Hilaire; Fifth; 33-1-4079-5479 . . . or 33-1-4079-5601 Galeries de Paléontologie et d’Anatomie Comparée, . . .
6K - last updated 2015-02-02 16:56 by Auriea
ParsonsParis
[[MyCompleteResume]] # fall 2016 - DrawingImaging (freshmen) # spring 2017 - DIMENSIONS (juniors) . . .
1K - last updated 2017-09-16 08:46 by Au-Roma
Passport
ProofOfMyExistence Dear Ms. Harvey: To issue a certificate of Nationality, we would have to see your . . . to support the name change. * You were at least 16 years old when your most recent passport was issued . . . here. Fee Adult renewal: $ 55 + $12 surcharge = $67 . . .
5K - last updated 2008-09-08 11:47 by Auriea
PataX
[[Research]] http://en.wikipedia.org/wiki/Alfred_Jarry Shoplifted from LibFoam:PataX LibFoam:pataphysics . . . potentiality, to their display. --''Mina Loy, 1946, France.'' Pataphor: http://www.paulavion.com/ptest.html . . . I actually prefer Babelfish's . . . Somehow . . .
7K - last updated 2008-10-31 00:04 by Auriea
PeachPlumPear
SongBook We speak in the store I'm a sensitive bore and you're markedly more and I'm oozing surprise . . . width="13" height="13" classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=7,0,0,0" . . . name="FlashVars" value="resourceID=3428676&flp=false" /> <param name="movie" value="http://static.last.fm/webclient/inline/1/inlinePlayer.swf" . . . quality="high" FlashVars="resourceID=3428676&flp=false" bgcolor="#ffffff" width="13" height="13" . . .
2K - last updated 2007-10-29 00:33 by Auriea
PeterHenryEmerson
CastOfThousands ''see also: photography, ElegantMedia, history'' http://www.ssplprints.com/category.php?catid=1184&page=2&numperpage=8 . . . http://news.bbc.co.uk/2/shared/spl/hi/pop_ups/06/in_pictures_peter_henry_emerson_/html/1.stm "pictorialism" . . .
1K - last updated 2010-05-27 12:22 by Auriea
Photogrammetry
[[3D]] ''see also: PhotogrammetryFromVideo'' <html> <iframe width="640" height="480" src="https://sketchfab.com/models/0aaf3716c92b4ffeba39ac82319b7d55/embed" . . . <a href="https://sketchfab.com/models/0aaf3716c92b4ffeba39ac82319b7d55?utm_source=oembed&utm_medium=embed&utm_campaign=0aaf3716c92b4ffeba39ac82319b7d55" . . . target="_blank" style="font-weight: . . . target="_blank" style="font-weight: . . .
2K - last updated 2017-05-30 19:08 by Au-Mercury
Photoshop
[[Reference]] ***44 Photoshop Tricks & Tips By - Xing Wei 1. Press Tab will hide tool bar and palette, . . . color you have in your foreground color box. 6. In photoshop, all "Cancel" button in a window can . . . instantly capture the color for background. 16. With Measure Tool, draw a line then hold Alt and . . . space bar can allow you to move the selection. 26. Hold Shift and press "+" or "-" will switch between . . . not make current layer chain with upper layer. 36. With grid on, click the top left corner of the grid . . .
6K - last updated 2007-12-20 14:06 by Auriea
PleasePleasePlease
SongBook [[tube:rMlDbhaI6n8 640 480 0]] . . .
1K - last updated 2009-01-09 22:20 by Auriea
PopUpBooks
ElegantMedia * an interesting article in pingmag [http://www.pingmag.jp/2006/11/27/pop-up-books/] * http://www.library.unt.edu/rarebooks/exhibits/popup2/introduction.htm#history . . .
1K - last updated 2007-01-15 17:20 by Auriea
PopularCulture
[[Quoth]] ''Excerpts{{lifted from http://pubpages.unh.edu/~dml3/880williams.htm}} from Raymond Williams{{linked . . . Ed. (NewYork: Oxford UP, 1983), pp. 87-93 and 236-8.}} == CULTURE == Culture is one of the two or three . . . next stage of meaning, by metaphor. From eCl6 the tending of natural growth was extended to process . . . Bacon: 'the culture and manurance of minds (1605); Hobbes: 'a culture of their minds (1651); Johnson: . . . and Easie Way to Establish a Free Commonwealth (1660): 'spread much more Knowledg and Civility, yea, . . .
20K - last updated 2005-01-09 15:48 by Auriea
PorgyAndBess
OldManSorrow from http://www.neh.gov/news/humanities/1997-11/porgy.html ===The Complicated Life of Porgy . . . that would fuse classical and jazz idioms. In 1926, he thought he had found the vehicle: a new novel . . . movement that had begun in Paris around 1906 and spread to America. Through the works of Rousseau, . . . It opened on Broadway in 1927 and ran for 367 performances. A New York Times critic termed it . . . last stop, in Washington, D.C., in March of 1936: As expected we were told that the National Theater . . .
28K - last updated 2004-08-16 21:10 by wof
PotatoPancakes
[[Food]] 4 big potatoes 1 yellow onion 1 egg -- beaten 1 teaspoon salt 2 tablespoons all-purpose flour . . . pepper. Wash, pare, finely grate and set aside 6 medium size (about 2 pounds) potatoes, about 3 cups . . .
2K - last updated 2005-11-06 13:41 by Auriea
Prado
[[Madrid]] <html><img src=http://www.auriea.org/data/static/2010-02-19.jpg> Velazquez <3 . . . . . . . . .
3K - last updated 2010-02-24 16:30 by Auriea
Prague
OutsideSomeplace little trip we decided to take summer, july 2010 with the kids. <html> <iframe . . . width="100%" height="166" scrolling="no" frameborder="no" src="http://w.soundcloud.com/player/?url=http%3A%2F%2Fapi.soundcloud.com%2Ftracks%2F4197975&show_artwork=true"></iframe> . . . Prague, Mala Strana, the "new" town (it was...: 600 years ago). Full of marvellous places, don´t miss . . . ------ . . .
1K - last updated 2012-06-07 15:49 by Auriea
PreComputationalGenerativeSystemsInArt
ElegantMedia * Underweysung der Messung, mit dem Zirckel und Richtscheyt, in Linien, Ebenen unnd gantzen . . . art book", and La Monte Young's "composition 1961", and Tristan Tzara's instructions for writing Dada . . . poems… * Another 1961 piece: Brecht's "Two Vehicle Events" (start and . . . pretty: http://www.flickr.com/photos/85009674@N00/3037607129/ * And the Aolian harp, beloved . . . http://www.toutfait.com/issues/issue_1/News/stoppages.html . . .
3K - last updated 2009-10-13 10:53 by Auriea
PrikNeus
TuinPlanten [[thumb:PrikNeusGroeiPatron|120px]][[thumb:2005-06-22 PrikneusInBloom|250px]] . . .
1K - last updated 2005-12-19 16:41 by Auriea
PrintersSpreads
[[Books]] [20|01], [02|19], [18|03], [04|17], [16|05], [06,15], [14|07], [08|13], [12|09] and [10|11] . . .
1K - last updated 2009-06-25 09:18 by Auriea
ProjectProject
<center> [[thumb:2019-12-13|600px]] '''OPENING Friday the 13th December 2019''' '''DEATH HAS A . . . https://www.3dsystems.com/3d-printers/projet-cjp-660pro/specifications * Ultimakers * Form 2 (?) == . . . . . . . . . of my glorious name]]=== [[thumb:Poliriea-image|600px]] [[image:ProjectProject_Polyphemau_QRCode.svg|Polyphemau|ProjectProject_Polyphemau]] . . .
3K - last updated 2019-12-30 19:28 by Au-Elektra
Projects
==Currently== [[In_the_Kingdom_No.19]] ------ == Queue == * Cyclops * StillLives ** Bugs ** The Cat * . . . The RIGHT To Be Wrong (4:18) # Blessed Marie (3:56) # Justice Isn't Blind (2:37) # Social Narcotics . . .
1K - last updated 2019-12-12 14:08 by Au-Elektra
ProsperosBooks
[[Movies]] The Books 1. A Book of Water This is a waterproof-covered book which has lost its colour by . . . out of the book to scorch the library floor. 6. A Harsh Book of Geometry This is a thick, brown, . . . an encyclopedia of pollen, scent and pheromone. 16. A Book of Love This is a small, slim, scented volume . . . This is a thick, printed volume of plays dated 1623. All thirty-six plays are there save one - the . . .
16K - last updated 2009-05-22 16:51 by Auriea
PureData
[[Reference]] * http://puredata.org/ * http://pure-data.sourceforge.net/ * http://crca.ucsd.edu/~msp/Pd_documentation/x2.htm#s1 . . . the fonts on your system : sudo mkdir /usr/X11R6/lib/X11/fonts/TTF sudo cp /usr/local/lib/pd/pdp_pidip_osx/fonts/* . . . /usr/X11R6/lib/X11/fonts/TTF 5. create a .pdrc file in your . . .
2K - last updated 2006-11-07 19:47 by Auriea
QRCode
SecretWriting little mobile phone readable codes (kind of like a bar code) [[thumb:QRCode-image2|frame|right|120px|"Unfortunately, . . . a QRcode! http://nfg.2y.net/games/jphonegames/v601shqrcode.shtm http://www.psytec.co.jp/freesoft/ . . . http://nfggames.com/neography/pivot/entry.php?id=69 * some software to allow non QR phones to read the . . . shapes combined with color to store up to 256GB of data on a sheet of paper or plastic. The article . . .
2K - last updated 2019-12-01 15:19 by Auriea
Quest3D
[[Reference]] <source> Step 3 So now we have 1 object with 2 different UV sets and textures, to . . . * Ground2 asset -> Mapping: Planar Y, Scale 16 x 16 * Floor of Phase Two -> Mapping: Planar Y, . . .
8K - last updated 2008-08-28 20:25 by d54C6FBEA.access.telenet.be
RaphaelHasan
==April 6, 2014 - Raphael's Birthday and A Day for Hasan== [[thumb:RaphaelPortrait|frame|right|250px|The . . . peace love.|https://www.youtube.com/watch?v=hRFYi6nErmE]] http://entropy8.com/live/GIFts/pantheonraphaelmomentofsilence.gif . . .
14K - last updated 2014-05-20 10:24 by Auriea
Ratatouille
[[Food]] http://www.guardian.co.uk/lifeandstyle/wordofmouth/2010/jul/15/how-to-make-perfect-ratatouille . . . this point it can be kept for a couple of days. 6. Just before serving, re-heat if desired, then put . . .
3K - last updated 2010-07-15 13:08 by Auriea
Ravi
CastOfThousands http://farm3.static.flickr.com/2612/3721997929_7539da2fed_b.jpg . . .
1K - last updated 2010-04-14 23:41 by Auriea
RealtimeArtReference
ElegantMedia projects to remember and refer to later * http://www.gabebc.com/Hereafter-Life * Richard . . . * http://newmediakassel.com/basisklasse016 * http://www.galaxykate.com/generominos/ * https://ledoux.itch.io/bitsy . . .
1K - last updated 2017-06-07 12:45 by Au-Mercury
RebeccaHorn
CastOfThousands [[image:infestation]] Img:Rebecca+Horn http://www.guardian.co.uk/artanddesign/2005/may/23/art . . . 'In 1964 I was 20 years old and living in Barcelona, in one . . . and some fan and dress drawings from the 1960s, have a concealed, protective quality, but one . . . can retrieve what is inside. In the late 1960s and the 1970s she worked on Unicorn, one of my . . .
9K - last updated 2009-11-18 02:45 by Auriea
Render
[[Reference]] [[3D]], Blender ==Cycles== ==Renderman== * https://rmanwiki.pixar.com/display/REN/RenderMan+Documentation . . . ==360== * doc made for DIMENSIONS class : [[download:[[Dimensions360Render]]]] . . .
1K - last updated 2017-02-28 15:42 by Auriea
Robots
[[Research]] climbing robot - http://www.newscientist.com/blog/technology/2006/03/tree-climbing-robot.html . . .
1K - last updated 2006-06-24 23:31 by Auriea
Rockefeller2006
ToDo [http://mediaartists.org/chat.html Nominee Chat Session Transcript] Since it is only me personally . . .
5K - last updated 2005-09-15 12:43 by wof
RolandTR-606
image/jpeg
111K - last updated 2007-06-07 10:16 by Auriea
RomanEmpire
[[Research]] # Julius Caesar (dictator) 49-44 BC # Augustus 31 BC - AD 14 # Tiberius AD 14-37 # Gaius . . . (Caligula) 37-41 # Claudius 41-54 # Nero 54-68 # Galba 68-69 # Otho 69 # Vitellius 69 # Vespasian . . . 69-79 # Titus 79-81 # Domitian 81-96 # Nerva 96-98 . . .
1K - last updated 2009-11-19 11:16 by Auriea
Rome
OutsideSomeplace Living here. ArtSuppliesRoma -------- [[Italy]] ''[[Rome2017]]'' Extended Stay at Academia . . . * http://www.lonelyplanet.com/travelblogs/654/24561/20+tips+on+Visiting+the+Vatican+Museums?destId=359518 . . . also: [[Book31]]'' Roma - Michaels Version '''20060508''' Hallo va & moe, We hebben wat foto's on . . . van ons reisje: http://home.zuper.com/---2006/ vanaf 20060508-colloseo_1.jpg Dit zijn ongeveer . . . van de apostel Petrus. Naast hem liggen er nog 146 andere pausen begraven (luguber als je eraan denkt...). . . .
5K - last updated 2021-06-05 11:45 by 93-39-148-146.ip76.fastwebnet.it
Rome2017
OutsideSomeplace [[Roma]] That time we went to Rome and stayed for 5 months. September 2017 - January . . . . . . Via Labicana, 95 Open Mon-Sat, 9am-12.30pm; 3pm-6pm; Sun 12.15pm-6pm Entry fee: €10 * Domitilla Catacombs . . .
3K - last updated 2018-03-29 10:07 by 78-22-179-76.access.telenet.be
Ruins
[[Projects]] Photogrammetry created from Youtube HD drone video of the ruins of Homs, Syria https://www.youtube.com/watch?v=DoRdCbDd50o&t=31s . . . . . . . . . frameborder="0" allowvr allowfullscreen . . . height="480" src="https://sketchfab.com/models/ff68d7b40ddd41e0aa58288cdbbcfa18/embed" frameborder="0" . . .
3K - last updated 2017-09-15 23:37 by Au-Danae
RulesOfAcquisition
[[Reference]] Rule 001 » Once you have their money, you never give it back. Rule 002 » The best deal . . . If you can't break a contract, bend it. Rule 006 » Never allow family to stand in the way of opportunity. . . . Rule 015 » Acting stupid is often smart. Rule 016 » A deal is a deal. (until a better one comes along). . . . it. Rule 025 » There's always a way out. Rule 026 » As the customers go, so goes the wise profiteer. . . . Rule 035 » Peace is good for business. Rule 036 » Too many Ferengi can't laugh at themselves anymore. . . .
10K - last updated 2009-01-17 01:51 by Auriea
RunsInTheFamily
SongBook [[tube:O_JFjY5Y0Os 640 480 0]] . . .
1K - last updated 2009-03-07 22:28 by Auriea
Russian
[[Language]] 1 2 3 4 5 6 7 8 9 10 11 |12 13 "14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 . . .
1K - last updated 2010-04-05 23:23 by Auriea
SIMULATIONS
http://song-of-songs.org My understanding of the world is three dimensional. [[tube:6kCgc_nLz1w 450 240 . . .
1K - last updated 2020-08-03 11:46 by Auriea-Mercury
SacredTexts
[[mythology]] http://www.sacred-texts.com/index.htm ==Founders of religions== Abraham - claimed as a . . . by Christianity, Judaism, and Islam - ca. 2166 BC and 1991 BC Moses - Judaism dates unknown, estimates . . . range from ca. 1600 BC to 1100 BC. Zoroaster - Zoroastrianism, ca. . . . and organized Roman religion, ca. 717 BC-673 BC Siddartha Gautama - Buddhism, ca. 563 BC-483 . . . ca. 4 BC-ca. 30 AD Mani - Manichaeism, ca. 210-276 Muhammad - prophet of Islam, ca. 570-632 Nanak - . . .
2K - last updated 2005-12-27 20:10 by Auriea
Salome
FataleVrouwen John the Baptist Beheaded 14King Herod heard about this, for Jesus' name had become well . . . prophet, like one of the prophets of long ago." 16But when Herod heard this, he said, "John, the man . . . now the head of John the Baptist on a platter." 26The king was greatly distressed, but because of his . . .
3K - last updated 2007-11-12 14:18 by Auriea
SantaMariaInTrastevere
[[Rome2017]] [[thumb:SantaMariaInTrastevere-Labyrinth|frame|200px|According to these testimonies, the . . . it was "destroyed during the restoration of 1867".]] . . .
1K - last updated 2017-09-06 10:31 by Au-Danae
Scans
[[foreground:none|#000000]] <center>[[thumb:artemis.png|1080px]]</center> <center>See . . . frameborder="0" allow="autoplay; fullscreen; . . . height="480" src="https://sketchfab.com/models/6c18376147ef421788740f5b7593d250/embed" frameborder="0" . . .
1K - last updated 2018-12-24 15:38 by Auriea.
SchildersVerdriet
TuinPlanten [[Gog:Saxifraga Umbrosa]] Notes: Apparently you can grow this among rocks(?) '''early spring . . . 2006:''' it seems to be spreading to other pots. I see . . .
2K - last updated 2006-03-18 16:39 by Auriea
Sculptris
[[Reference]] Downloaded an os x version which runs under WINE [http://www.zbrushcentral.com/showthread.php?t=91628&page=2&pp=15|here.] . . .
1K - last updated 2010-12-16 19:44 by Auriea
SecretWriting
SketchBooks ''see also: [[Marginalia]]'' ==made up scripts== * http://dscript.org kind of like the one . . . i made up as a teenager !! ''see: [[Book6]]'' WikiPedia:Antikythera_mechanism WikiPedia:Rosetta_Stone . . . * WikiPedia:Voynich_manuscript, http://www.voynich.nu/ . . . Quipu] database with pics of some of the 600 remaining. ** WikiPedia:Quipu * Braille ===Dead . . .
2K - last updated 2015-06-08 11:41 by Auriea
SedumSpathulifolium
TuinPlanten [[thumb:2005-05-21 SedumSpathulifolium|frame|right|I was given it by Robbe & Christiene . . . Height: Minimum: 4 inches Maximum: 6 inches Width: Minimum: 12 inches Maximum: . . .
1K - last updated 2010-04-14 23:59 by Auriea
SeydouKeita
[[photographers]] Img:Seydou+Keita [http://www.skny.com/lasso-bin/artist_artwork.lasso?-token.ArtistID=51&-token.ArtistName=The%20Estate%20of%20Seydou%20Ke%EFta] . . . [http://www.nytimes.com/2006/01/22/arts/design/22rips.html?pagewanted=1&ei=5088&en=49a68e760090be6c&ex=1295586000&partner=rssnyt&emc=rss . . . in 1945 in BAMAKO. I am self taught; I had a 6x9 camera that one of my uncles had brought me back . . . in bust, alone or by two, or even groups up to 6 people, families and so on. The clients were telling . . .
5K - last updated 2007-10-01 15:14 by Auriea
ShariRichards
CastOfThousands my eldest sister. [[image:Shari-2007]] 2006 GentRichards 2007 also the burns of Gent . . .
1K - last updated 2007-04-09 12:56 by Auriea
SightSize
[[drawing]] ''see also: CaproniCasts, LifeDrawing'' ==::BargueDrawing== http://www.learning-to-see.co.uk/bargue-drawings . . . plates: http://picasaweb.google.com/104620822473004383244/BargueBook ==::CastDrawing== sources . . . [http://www.fineartstore.com/Catalog/tabid/365/List/1/CategoryID/14887/Level/a/Default.aspx?SortField=UnitCost%2cUnitCost] . . . ----- http://www.sightsize.com '''So what exactly . . .
2K - last updated 2011-09-24 23:15 by Auriea
SilentHill4Kyodan
SongBook [[image:SilentHill4Kyodan-image]] ====Disc 2 Kyodan (Dramatic Storytelling) - "Inescapable Rain . . . 05 G -Shimomu- 05 下無(シモム) 06 G Sharp -Soujou- 06 双調(ソウジョウ) 07 A . . . = F = February 05. Shimomu = F# = March 06. Soujou = G = April 07. Fushou = G# = May 08. Oushiki . . . http://silenthillforum.com/viewtopic.php?t=16663 This CD contains horror stories produced by the . . .
11K - last updated 2009-01-13 14:51 by Auriea
SketchBooks
[[thumb:AnneCarson-Candor|600px]] This archive is a work in/of constant progress. '''I welcome you to . . . - Paris |http://auriea.org/Book48|*48.]] . . . - Skyros|http://auriea.org/Book46|46.]] . . . 42 - GLAMOUR|http://auriea.org/Book42|42.]] . . . 37 - 2010|http://auriea.org/Book37|37.]] [[image . . .
8K - last updated 2019-06-07 10:17 by Auriea
SmellMemory
ElegantMedia * http://www.cbihateperfume.com/ ** '''Winter 1972''' - A field of untouched new fallen . . . earth of a country garden ----- [[image:2007-05-06]] * Maki Ueda - http://www.ueda.nl/aromatic_journey1/index.html . . . world collecting odors, building a library of 6,763 scents, including dirt, toys, and rotten bananas. . . . releasing the various fragrances. Each holds 16 cartridges of base fragrances or essences that are . . . Cartridge refills should cost about ¥1,600 it said. NTT Communications believes that fragrance . . .
8K - last updated 2009-09-04 14:33 by Auriea
Solitaire
[[cards]] ''see also: Games, Gog:solitaire+source'' actionscript source (50$) * http://www.ifbin.com/news/2006/03/flex-2-actionscript-3-klondike-by.html . . .
1K - last updated 2007-08-13 13:56 by Auriea
SomeOfMyFavoriteSites
[[Empire]] <table/non A, B> A:<tt> handprint, watercolor.....[http://www.handprint.com/HP/WCL/] . . . syndicate.....[http://www.anart.no/syndicate] . . .
3K - last updated 2010-08-06 13:37 by Auriea
SongBook
[[Quoth]] [[image:ItNeverChangesToStop-TheBooks]] * LastFM * http://lyricwiki.org/ [[background external:http://auriea.org/data/static/2006-08-19_fountain.jpg|repeat . . .
1K - last updated 2012-07-11 15:25 by Auriea
SoundCloud
<html> <div style="font-size: 11px;"><object height="165" width="100%"> <param name="movie" . . . <embed allowscriptaccess="always" height="165" src="http://player.soundcloud.com/player.swf?url=http%3A%2F%2Fsoundcloud.com%2Fauriea%2Fsets%2Findpls&show_comments=true&auto_play=false&show_playcount=true&show_artwork=true&color=000000" . . .
1K - last updated 2009-08-10 16:51 by Auriea
StJTB
==CLAY== <center>[[vimeo:310987804 720 398 0]] Sculpture in clay, from a live model. Made in Studio . . . Italy. (Dec. 2017) [[thumb:StJTB-ClayPhases|600px]]</center> ==VERSIONS== [[thumb:StJTB-Prints|500px]] . . .
1K - last updated 2019-03-28 15:41 by Auriea
StabatMater
SongBook http://www.stabatmater.info [[tube:2XUC2MQ74DE 320 240 0]] http://www.stabatmater.info/vivaldi.html . . . </dir> </td> <td WIDTH="6%" VALIGN="TOP"><p ALIGN="CENTER"> </td> . . . </dir> </td> <td WIDTH="6%" VALIGN="TOP"><p ALIGN="CENTER">1</td> . . . </dir> </td> <td WIDTH="6%" VALIGN="TOP"><p ALIGN="CENTER">2</td> . . . </dir> </td> <td WIDTH="6%" VALIGN="TOP"><p ALIGN="CENTER">3</td> . . .
11K - last updated 2014-05-30 12:59 by Auriea
StanBrakhage
[[Movies]] [[tube:-drSrvTtZ1k 600 400 0]] [[tube:DIjkIJvHIzQ 600 400 0]] . . .
1K - last updated 2007-12-09 12:32 by Auriea
StokRoos
TuinPlanten WikiPedia:Alcea_rosea Hollyhock http://farm4.static.flickr.com/3256/2618850595_6ca0e62493.jpg . . .
3K - last updated 2008-06-29 21:43 by Auriea
Story
ElegantMedia [[tube:U82eWptFxSs 640 480 0]] . . .
1K - last updated 2008-11-20 11:25 by Auriea
StrawberryShortcake
[[Food]] Strawberry Shortcake Serves 6. Fruit: 2 pounds strawberries, washed, hulled, and sliced 3 or . . . biscuits about 1 1/2 inches apart, to create 6 biscuits. Sprinkle remaining 1 tablespoon sugar evenly . . .
3K - last updated 2008-06-29 21:33 by Auriea
StreetView
OutsideSomeplace permalinks to random places. via: http://web.mit.edu/~jmcmicha/www/globegenie/ and http://www.mapcrunch.com/ . . . old tree [http://www.mapcrunch.com/?p=22.386727,114.177321,46.35,3.51,0] ==South America== * Buenos . . . * pretty purple tree on a . . . ==Antarctica== * penguins! [http://web.mit.edu/~jmcmicha/www/globegenie/index.html?llyp=-62.594036,-59.894441,290.96,13.33] . . . ==GB== * a rather large cemetary . . .
2K - last updated 2010-12-23 16:42 by Auriea
StudLoan
ProofOfMyExistence ==2017== ||I.17 || $129+179 || $300 (11,04 EURfee) || 285,13 EUR || 20170107 || $1,947 . . . || ||II.17 || $129+179 || $300 (11,64 EURfee) || 302,54 EUR || 20170207 || $?? || ||III.17 . . . || $129+179 || $300 (2,81 EURfee) || 293,06 EUR || 20170310 || $?? || ||IV.17 || $129+179 || . . . time. extra because she's travelling.}} || 20170612 || $1,379 || || '''PAID OFF!! 1.179,77 EUR !! DONE . . . WITH THIS SHIT !!''' || ==2016== ||I.16 || $129+179 || $300 USD ($12 USD fee) || . . .
14K - last updated 2017-06-16 11:39 by Au-Danae
Studio
<center>[[thumb: fortune|600px]]</center> [[background:2010-06-24_silver|repeat #274b5b]] . . . Anthem = [[thumb:Studio-MissionStatement|600px]] [[image:AurieaDrawing3]] [[thumb:Ingres-vs-Delacroix_illustration1|400px|right]] . . .
1K - last updated 2020-04-08 12:37 by Auriea-Mercury
StudioEscalier
[[Drawing]] "The central subject of our intensive courses is drawing and painting the human figure from . . . curriculum from the Ecole des Beaux Arts circa 1864, nor to study or memorize the recipes, styles, or . . .
3K - last updated 2014-01-03 13:13 by Auriea
SunRa
[[Quoth]] [[tube:x0UVHsEWxYI 640 480 0]] . . .
1K - last updated 2008-07-05 14:51 by Auriea
Sunday
SongBook ==Gloomy Sunday== Gloomy Sunday - the notorious 'Hungarian Suicide Song' - was written in 1933. . . . and his Orchestra, with Bob Allen on vocals (1936), that was to become the most widely covered. The . . . Seress jumped to his death from his flat in 1968. Ôsz van és peregnek a sárgult levelek It is . . .
5K - last updated 2005-06-21 10:58 by Auriea
SwannsWay
InSearchOfLostTime ===Week 2=== thread: [http://www.goodreads.com/topic/show/1046872-through-sunday-13-jan-swann-s-way] . . . thread: [http://www.goodreads.com/topic/show/1046827-through-sunday-6-jan-swann-s-way] * I read it . . .
7K - last updated 2013-01-07 13:05 by Auriea
SweetPotatoPie
[[Food]] http://www.ehow.com/how_6999_make-sweet-potato.html ------ My recipe for sweet potato pie [[thumb:2005-11-01 . . .
4K - last updated 2009-05-21 20:25 by Auriea
Synthetic Corpo-Reality
[[Exhibitions]] <aggregate "La_Vita_Nova"> Synthetic Corpo-Reality is inspired by the extended . . . GIFs, AI softwares, augmented reality, 360 experiences and virtual reality. For this show I . . . and soundscape in Mozilla Hubs. when i was 46 it was the year after a deep depression. the year . . . I had learned about choosing. when i turned 46 i learned what it was to have chosen. I would go . . . and her death, and about creation. On my 46th birthday I forgave myself. I made two 3d scans . . .
3K - last updated 2021-02-23 13:08 by Auriea
TV
ProofOfMyExistence http://en.wikipedia.org/wiki/Jem_%28TV_series%29 i stopped watching television when . . . . . .
1K - last updated 2009-04-18 14:43 by Auriea
TableOfContents
SketchBooks width in cm. divided by 2 [[thumb:Book49_Cover|75px]] [[thumb:Book48_Cover|65px]] [[thumb:Book47_Cover|72px]] . . . [[thumb:Book46_Cover|80px]] [[thumb:Book45_Cover|57px]] [[thumb:Book44_Cover|80px]] . . . [[thumb:Book43_cover|85px]] [[thumb:Book42_Cover|60px]] [[thumb:Book41_Cover|128px]] [[thumb:Book40_Cover|80px]] . . . ------- [[thumb:Book37_Cover|65px]] [[thumb:Book36_Cover|65px]] [[thumb:Book35_Cover|65px]] . . . [[thumb:Book33_Cover|63px]] [[thumb:Book32_Cover_Lightside|82px]] [[thumb:Book31_Cover|65px]] . . .
2K - last updated 2014-09-09 14:27 by Auriea
TakayoshiSato
[[Games]] <html> <object width="425" height="350"><param name="movie" value="http://www.youtube.com/v/EFJZKf3Ox_k"></param><embed . . . we made wireframe models – each one is about 6,000 polygons – and added textures. We used motion . . .
9K - last updated 2008-06-17 01:29 by Auriea
Tamara
CastOfThousands http://farm4.static.flickr.com/3026/2741511338_315b2e5d85_b.jpg . . .
1K - last updated 2010-04-14 23:34 by Auriea
TaoTeChing
[[Quoth]] [[1]] [[2]] [[3]] [[4]] [[5]] [[6]] [[7]] [[8]] [[9]] ... [[37]] [[38]] [[39]] [[40]] [[41]] . . .
1K - last updated 2012-06-07 13:48 by Auriea
Tarot
ElegantMedia Tarot with FoAM - LibFoam:tarot -------- Tarot Exchange [http://groups.yahoo.com/group/Tarot-Exchange] . . . ==rws matrix== ''78 cards / 22 major / 16 court / 56 minor / 4 court per suit'' '''cups''' . . . ~ practical attainment 5 ~ unbalance, conflicts 6 ~ harmony 7 ~ choices 8 ~ changes 9 ~ conclusions . . . ** http://www.tarotforum.net/showthread.php?t=125650 ** http://www.tarotforum.net/showthread.php?t=136753 . . .
4K - last updated 2012-02-27 13:32 by Auriea
TedNelson
CastOfThousands "Designer, Generalist, Contrarian Theodor Holm Nelson, 1937- Best known for: coining . . . terms "hypertext" and "hypermedia," 1963 (first published 1965), and as founder and pursuer . . .
1K - last updated 2004-11-25 15:09 by Auriea
TenThousandThings
[[Quoth]] ''see also: numbers, [[1]], [[2]], [[3]], [[4]] ... [[33]], [[34]], [[35]], [[36]], [[37]], . . .
1K - last updated 2012-07-11 14:45 by Auriea
TeunisBloem
TuinPlanten [[Gog:Oenothera tetragona]] [[WikiPedia:Oenothera]] [[thumb:2005-06-22_TeunisBloemBloom|frame|right|150px|it . . . in Europe, reached Padua from Virginia in 1614 and were described by the English botanist John . . . Goodyer in 1621. The plant is now naturalised in several parts . . . by other species. It grows as far north as 65° N in Finland. Young roots can be eaten like a . . .
4K - last updated 2005-06-22 22:44 by Auriea
TextFormattingRules
[[Empire]] If you click on the question mark you can make a new wiki page. If a wiki page already exists . . . of the world|walk this way]] ----- . . .
16K - last updated 2017-02-28 15:38 by Auriea
TheAeneid
''see also: http://auriea.de'' For Aeneas in Book 3 - Halfway between Delos and Crete <center><html><iframe . . . . . .
1K - last updated 2017-08-14 14:32 by Au-Mercury
TheAnalyticalLanguageOfJohnWilkins
[[Quoth]] THE ANALYTICAL LANGUAGE OF JOHN WILKINS By Jorge Luis Borges Translated from the Spanish 'El . . . purely biographical data: Wilkins was born in 1614, Wilkins died in 1672, Wilkins was chaplain of . . . a Real Character and a Philosophical Language' (600 pages in large quarto, 1668). There are no copies . . . itself. Descartes, in a letter dated November 1629, had already noticed that, using the decimal number . . . covering all human ideas. John Wilkins, around 1664, started to work on this task. He divided the universe . . .
9K - last updated 2010-09-13 21:50 by Auriea
TheAntichrist
[[Mythology]] 46 Prophecies the Antichrist will fulfill # The antichrist will be a man - Daniel 7:24-25 . . . this covenant. The word here for "confirm" is 1396 gabar (gaw-bar'); a primitive root; to be strong; . . . that have ruled. So far there have been 6. 1. Egypt. 2. Assyria. 3. Babylon. 4. Medo-Persia. . . . 5. Greece. 6. Rome # He will have a mouth speaking great things. . . . things against the God of gods - Daniel 11:36 # He will exalt himself above all that is called . . .
9K - last updated 2009-06-25 09:25 by Auriea
TheDiseaseManifesto
[[Entropy8.com]] Manifesto | 1996 - 1998 [[image:bread]] Co-written by Bable and the Cut-up Machine. . . . something you hadnt bargained on feeling. 006. And it takes you on that ride and the line we walk . . . that you just arent going to be around for. 016. Finding you own little piece of eternity. Put a . . . that come out of me. my psychological journey. 026. Into those phrases into these notes, into the image . . . elsSomethingElse]. I call it "the fear" 036. Sometimes I can be said. "let all the poisons that . . .
21K - last updated 2018-09-10 19:41 by Auriea.
TheFaerieQveene
FiftyBooks http://darkwing.uoregon.edu/~rbear/fqintro.html Poet Edmund Spencer dedicated his rich and . . . complex masterwork The Faerie Queene (1590/96) to Elizabeth; she is represented in the epic as . . .
1K - last updated 2005-11-21 10:54 by Auriea
TheFlowerSeller
<html><center><div class="sketchfab-embed-wrapper"><iframe width="90%" height="750" . . . src="https://sketchfab.com/models/65a825dbcf694801968adfbf823a4148/embed" frameborder="0" . . .
1K - last updated 2018-03-09 16:15 by Au-Mercury
TheFourByFive
[[photography]] http://farm3.static.flickr.com/2367/2518960124_4d245c7134.jpg --i think i lost part of . . . lenses== # LINHOF Schneider-Kreuznach Angulon 1:6,8/90 3668257 Synchro-Compur 6,8 - 32 [http://photo.net/large-format-photography-forum/00OsJr] . . . [http://www.schneideroptics.com/info/age_of_lenses/index.htm . . . May 1952] # SEIKOSHA-SLV Commercial Astragon 1:6.3 f=180mm (7 1/8") No.83481 6.3 - 63 . . .
1K - last updated 2009-02-22 14:05 by Auriea
TheGlassEssay
[[Quoth]] POEM The Glass Essay BY AnneCarson I I can hear little clicks inside my dream. Night drips . . . once a minute over the twelve. I have Emily p. 216 propped open on the sugarbowl but am covertly . . . handwriting.” It was a small (4 x 6) notebook with a dark red cover marked 6d. and . . . deck once from end to end. Nude #6 I cannot remember. Nude #7. White room whose walls, . . .
46K - last updated 2013-01-06 12:10 by Auriea
TheGraeae
FataleVrouwen The three "old women" or "gray ones" from Greek mythology. They are the daughters of Phorcys . . . Ovid Metamorphoses 4.772, Nonnus Dionysiaca 25.64) NAMES [1.1] PEMPHREDO, ENYO (Hesiod Theogony 270) . . .
4K - last updated 2006-12-24 15:35 by Auriea
TheLimitsOfTwo
Not a fun place to be. What happens when the relationship between Michael and I break down and we are . . . fight, sometimes. We make up, always. [[thumb:2006-07-03 20h45 limits of two revisited]] . . .
1K - last updated 2012-07-11 15:18 by Auriea
TheLivingLine
[[Projects]] ''see also: Drawing, DrawingDancing, Residencies, LiveDrawing, [http://auriea.com/thelivingline/ . . . Lu's [http://velluminous.org/portfolio/detail/?16 Droom Zacht] ==Tools for Lines== Now that I have . . .
2K - last updated 2017-08-23 13:26 by Au-Mercury
TheLouvre
<html><script src="http://occipital.com/360/embed.js?pano=3Wf7cT&width=100%&height=400"></script></html> . . .
1K - last updated 2014-01-08 12:19 by Auriea
TheNineBillionNamesOfGod
[[Quoth]] The Nine Billion Names of God By Arthur Clarke "This is a slightly unusual request," said Dr. . . . the project would be extended to approximately 2060 A.D. They were quite capable of it. George heard . . .
15K - last updated 2007-12-21 14:58 by Auriea
TheRitualOfLoveAndDeath
[[Quoth]] <html><embed src=http://video.google.com/googleplayer.swf?docid=9201439452997071422&hl=en&fs=true . . . style=width:400px;height:326px allowFullScreen=true allowScriptAccess=always type=application/x-shockwave-flash> . . .
1K - last updated 2010-07-26 22:47 by Auriea
TheSandman
FiftyBooks A GraphicNovel series written by NeilGaiman. Covers by DaveMcKean. [http://spiffyness.net/dream/ . . . Morningstar. # '''The Doll's House''' (10-16) A very creepy and humorous serial killer convention . . . Watches II, DC Comics, 1993 ''Sandman #46'', Life Isn't Pleasant, Petrified-The Parting Of . . . # '''World's End''' # '''The Kindly Ones''' (57-69) A really lovely and fitting end. The dreaming is . . . style=width:400px;height:326px allowFullScreen=true allowScriptAccess=always type=application/x-shockwave-flash> . . .
7K - last updated 2010-05-19 14:56 by Auriea
The Archive To Come
<center><html><iframe src="https://player.vimeo.com/video/461163311?title=0&byline=0&portrait=0" . . .
3K - last updated 2021-01-04 12:13 by Auriea
ThoughtPhotoStream
<html><script type="text/javascript" src="http://www.flickr.com/badge_code_v2.gne?show_name=1&count=10&display=latest&size=m&layout=h&source=user_set&user=81482434%40N00&set=72157624960278365&context=in%2Fset-72157624960278365%2F"></script></html> . . .
1K - last updated 2012-02-10 21:15 by Auriea
ThreeMarys
FataleVrouwen [https://www.biblegateway.com/passage/?search=John+19%3A25&version=NIV John 19:25] . . . Mary (mother of James the Less) (Matthew 27:56; Mark 15:40; Luke 24:10) Mary of Cleopas (John 19:25) . . . mother of John Mark of Jerusalem (Acts 12:12–16) Mary of Rome All four gospels mention women going . . . to the tomb of Jesus, but only Mark 16:1 mentions the three that this tradition interprets . . .
3K - last updated 2017-04-07 13:12 by Au-Danae
ThroughAGlassDarkly
[[Reference]] [[tube:-SPfJIlkT_Y 640 480 0]] [http://www.bergmanorama.com Ingmar Bergman] . . .
1K - last updated 2008-01-17 01:44 by Auriea
TillWeHaveFaces
FiftyBooks [[thumb:TillWeHaveFaces-scan1]] [[thumb:TillWeHaveFaces-scan2]] [[thumb:TillWeHaveFaces-scan3]] . . . . . . . . .
1K - last updated 2006-11-08 02:29 by Auriea
TimelineOfVirtualWorlds
[[time]] <html> <iframe width="600" height="400" src="http://www.dipity.com/xantherus/Virtual_Worlds/embed_tl?"></iframe> . . .
1K - last updated 2009-01-03 01:06 by Auriea
ToWatch
[[Movies]] <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/kxIYuOeAKnw?fs=1&hl=en_US"></param><param . . . ----- <html> <object width="640" height="480"><param name="movie" value="http://www.youtube.com/v/2U7-QiLYwrQ&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="640" height="480"></embed></object> . . . value="http://www.youtube.com/v/Gn8IoA6wGCo&hl=en_US&fs=1&"></param><param . . . src="http://www.youtube.com/v/Gn8IoA6wGCo&hl=en_US&fs=1&" type="application/x-shockwave-flash" . . .
3K - last updated 2011-01-12 19:41 by Auriea
TooManyOptions
[[Entropy8]] i see this as a problem with the Empire. I want something sown together, something whole. . . . €9/mo €108/yr ### LastFM €3/mo €36/yr ### emusic €13,99/mo €167,88/yr ## LiveJournal . . .
3K - last updated 2009-08-10 17:07 by Auriea
TuinPlanten
[[Botany]] ===About Plants=== http://www.theplantlist.org/ ==Complete Listing== see also: worms http://www.plantentuin.ugent.be . . . [[background:2005-10-06_remembrance_of_things_past|repeat #ba039e]] Summer . . . 2005: Aphids Summer 2006: Spider Mites [[Hortensia]] === from Gorik === '''In . . . TeunisBloem (Oenothera Tetragona) -dead 2006 '''Big orange pot''' StokRoze (Althaea Officinalis) . . . (Dipsacus) http://home.zuper.com/---2005/20050602_GardenHoe.jpg === from Robbe en Christiene === . . .
2K - last updated 2011-01-02 20:07 by Auriea
Twine
ElegantMedia These will be notes about how to use [http://twinery.org twine] ==Resources== * [http://twinery.org/forum/index.php . . . http://twinery.org/forum/index.php?topic=2176.0 change the look http://furkleindustries.com/fictions/twine/twine2_CSS_tutorial/ . . . http://twinery.org/forum/index.php/topic,2085.msg6056.html#msg6056 * add images and use as a link: http://twinery.org/forum/index.php/topic,2467.0.html . . .
2K - last updated 2015-08-06 16:14 by Auriea
TwitterBots
ElegantMedia ==Learning how-to== Advice from @tinysubversions This is a good article for the most basic . . . if it works with python versions higher than 2.6). I might as well throw in some JS resources here . . .
2K - last updated 2015-08-06 17:52 by Auriea
Ultimaker3
[[3dPrinting]] =This Much I Know= # PLA is: ## brittle, don't drop it ## '''moisture in your PLA filament . . . clips [https://www.thingiverse.com/thing:12516] ### dessicant containers that fit in the center . . . of rolls [https://www.thingiverse.com/thing:1416307] ### filament dryer [https://www.thingiverse.com/thing:1618037] . . .
2K - last updated 2017-08-23 17:54 by Au-Mercury
Unity3dShaders
[[Unity3d]] http://www.unifycommunity.com/wiki/index.php?title=Shaders ====from the forums==== * Force . . . [http://forum.unity3d.com/viewtopic.php?t=10160&postdays=0&postorder=asc&start=0] * . . . [http://forum.unity3d.com/viewtopic.php?t=50262] . . .
1K - last updated 2010-05-26 20:38 by Auriea
VIDEOGAMES
1) Bientôt l’été, 2011 http://tale-of-tales.com/bientotlete A holodeck beach simulation. Entertainment . . . in french, if possible. https://vimeo.com/54039868 https://vimeo.com/54038250 2) The Graveyard, 2008 . . . and also featured was our 2006 Realtime Art Manifesto http://www.tale-of-tales.com/tales/RAM.html . . . 3. Luxuria Superbia, 2013 . . . time: https://www.gamasutra.com/view/news/212986/Road_to_the_IGF_Tale_of_Tales_Luxuria_Superbia.php . . .
2K - last updated 2020-06-15 22:30 by Auriea-Mercury
Vanitas
ElegantMedia ==Flower Painting== WikiPedia:Jan_van_Huysum WikiPedia:Abraham_Mignon WikiPedia:Jan_Weenix . . . römer],[http://www.rijksmuseum.nl/aria/aria_assets/BK-NM-8186?lang=en . . .
2K - last updated 2008-03-18 17:30 by d54C6FF9F.access.telenet.be
Velasquez
CastOfThousands [[background:2008-06-02|repeat #6d555d]] [[image:2010-02-19]] . . .
1K - last updated 2010-05-26 13:14 by 78-21-207-92.access.telenet.be
VelvetPlant
TuinPlanten [[thumb:2005-06-04_VelvetPlant|frame|right|the latin name is Gynura but it is also known . . . filtered/indirect sunlight. TEMPERATURE: Night = 65 - 70°F (18 - 21°C) Day = 75 - 85°F (24 - 29°C) . . .
3K - last updated 2005-07-14 11:22 by 84.194.164.18
Vimeo
[[Empire]] <html> <iframe src="http://player.vimeo.com/video/18599827" width="400" height="300" . . . { margin-top:10px; width: 57px; height: 16px; } .vimeoBadge .credit { font: normal 11px verdana,sans-serif; . . .
2K - last updated 2011-04-05 12:40 by Auriea
VincentDesiderioLectureNotes
[[Painting]] [[tube:GxRN9tcN6pQ 640 480 0]] # this talk is about how to control color temperature and . . . # better to do what he calls a chromatic grisalle. . . .
8K - last updated 2014-08-21 13:50 by Auriea
ViolHeads
* Swan * Cyclops * The Twins [https://photos.google.com/share/AF1QipMCgOtnDKE7c9XCd_Gvgba7y9XmbtA16YPbt87oIbR9kbhYy76EYk2xkE21729X0g?key=N1ZxajJ2M285b25HbG9RSUxsQXotRUJ1ZXl6eDln . . .
1K - last updated 2020-01-16 23:36 by Au-Elektra
WarsawFoksalGalleryShow2019
<html> <div class="sketchfab-embed-wrapper"><iframe width="640" height="480" src="https://sketchfab.com/models/be76382be40a4574b96b7c6b59a79c8b/embed?autospin=0.2&autostart=1&camera=0" . . . width="640" height="480" src="https://sketchfab.com/models/04d4f3a310d742fc8a71498ffc8917ef/embed?autospin=0&autostart=1&camera=0" . . . width="640" height="480" frameborder="0" webkitallowfullscreen . . .
1K - last updated 2019-02-25 15:26 by Auriea
WhatIsThePrecedentForYourWork
ElegantMedia Artists: Jacques Louis David, William Bouguereau, Gian Lorenzo Bernini, John William Waterhouse, . . . your disdain for the algorithmic work of the 1960s in favor of painting. Thank you for the consideration. . . . But it won't have anything to do with the 1960s or algorithmic art or possibly even computers... . . .
4K - last updated 2005-12-20 11:05 by Auriea
WhiteChocolateFrosting
[[Food]] 1 cup butter, softened (no subs) 2 cups confectioners' sugar 6 ounces white chocolate or 6 ounces . . .
1K - last updated 2015-08-25 19:09 by Auriea
WilliamKentridge
CastOfThousands ''see also: TheLivingLine'' ==Six Drawing Lessons== <html><iframe width="560" . . .
2K - last updated 2015-11-23 19:44 by Auriea
WirefirePortraits
<html><object width="320" height="240"> <param name="flashvars" value="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2F&set_id=72157594473311985&jump_to="></param> . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2F&set_id=72157594473311985&jump_to=" . . .
2K - last updated 2009-01-11 00:05 by Auriea
WongKarWai
CastOfThousands His films are complex and very romantic. Saturated colors and ornamental sets even if . . . another before giving it up completely. [::2046] Mainly about a playboy writer and his many conquests. . . .
3K - last updated 2007-01-22 01:58 by Auriea
WordGames
[[Language]] ''see also: SecretWriting'' 1. Isogram A word in which no letter of the alphabet occurs . . . 2. Pangram A phrase or sentence containing all 26 letters of the alphabet (ideally repeating as few . . . Semordnilaps (coined by Martin Gardner in 1961) are also known as backronyms, volvograms, heteropalindromes, . . . a pouchlift after carrying around that brood! 6. Lipogram A written work composed of words chosen . . . the words. Rebus has been used in English since 1605, when William Camden wrote, "They which lackt wit . . .
5K - last updated 2015-08-25 19:10 by Auriea
WordPress
==portfolio shortcodes== https://en.support.wordpress.com/portfolios/portfolio-shortcode/ * display_types: . . . columns in shortcode. Defaults to 2. (number, 1-6) * showposts: number of projects to display. Defaults . . .
2K - last updated 2016-08-04 19:52 by Auriea
X3DOM
in Header: <script src="http://www.x3dom.org/release/x3dom.js"></script> <link rel="stylesheet" . . . test: <html> <x3d width='600px' height='400px'> <scene> <shape> . . .
1K - last updated 2019-06-29 23:55 by Au-Roma
XLVI
<center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" height="700" . . . src="https://sketchfab.com/models/65a825dbcf694801968adfbf823a4148/embed?autospin=0.2&autostart=1&transparent=1&ui_related=0" . . . src="https://sketchfab.com/models/e198edf528164788910136043bec0f78/embed" frameborder="0" allowvr . . .
1K - last updated 2017-09-15 23:44 by Au-Danae
YoshinoyaAuthenticGyudonRecipe
[[Food]] 日本 ===YOSHINOYA AUTHENTIC GYUDON, TOLD TO ME BY A VERY KNOWLEDGABLE JAPANESE GIRL{{lifted . . . stuff. The rice has to stick to itself. * 360ml Water * 1 ½ Tbsp Shoyu (Soy Sauce, I just typed . . .
3K - last updated 2007-08-31 20:39 by Auriea
ZBrush
DigitalSculpture ZBrush is the only application that makes me think that 3d modeling could be alright . . . * Thread about masking with alpha. http://206.145.80.239/zbc/showthread.php?t=23872&highlight=assign+polygroup . . . http://www.zbrushcentral.com/showthread.php?170886&p=969526&viewfull=1#post969526 review: http://www.pixologic.com/docs/index.php/Manipulating_Masks . . . ginormous topology . . . "texture baking" # Download these lighting setups . . .
14K - last updated 2014-09-17 17:07 by Auriea
ZbrushShortcuts
The following list of Shortcuts and Mouse Actions is arranged by category. For a list arranged by palette . . . * Textures – '''F5''' * Materials - '''F6''' (with cursor '''off''' canvas area) Show QuickMenu . . .
10K - last updated 2012-04-20 19:20 by Auriea
a2p-summary
<center> It has been my pleasure to take part in blockchain experiment a2p. behold! my art collection! . . . <center> [[thumb:a2p_screenshot|600px]] <center> For this experiment I've released . . .
1K - last updated 2021-04-18 18:50 by Auriea
abyss
[[Quoth]] "Battle ye not with monsters, lest ye also become a monster. And remember that when you look . . . his entire past. When he was filmed in 1986 for Jonathan Miller’s extraordinary documentary . . . agonized man I had seen in Miller’s 1986 film that I was scarcely prepared for the dapper, . . . choir. He spoke of how after Cambridge, in 1968, he joined the London Sinfonietta, where they played . . . reënter the world of human discourse. In the 1986 film, Deborah quoted Proust’s description of Swann . . .
43K - last updated 2007-09-19 20:32 by Auriea
anatomy
SketchBook ''see also: LifeDrawing'' the differences between man and woman * http://anthropology.si.edu/writteninbone/male_female.html . . . ''"The functional anatomy of the human body . . . . . . Wing Image Collection http://www.ups.edu/x5662.xml ==Atlases== * interactive full body 3d http://www.visiblebody.com . . . * http://inventiontocompletehumanbeing.blogspot.com/ . . .
4K - last updated 2011-09-05 23:47 by Auriea
beauty
ElegantMedia Here's the GutaiManifesto: "This is described as the beauty of decay, but is it not perhaps . . . . . .
5K - last updated 2018-09-10 16:13 by 78-22-179-76.access.telenet.be
black
[[Quoth]] Scientists create darkest color out of carbon nanotubes, hundreds of times darker than black.[http://www.chron.com/disp/story.mpl/front/5451632.html] . . .
7K - last updated 2014-09-12 09:33 by Auriea
black.css
[[Empire]] @import url('https://fonts.googleapis.com/css?family=Cardo|Crimson+Text|Quattrocento|Source+Serif+Pro'); . . . } a.stemmed { } a.near { color: #007206; } a.near:before, div.content a.url:before { } a.inter . . . { color: #576D3B; background-color: #F6FF97; padding: 1px 2px; . . . none; border-bottom: 1px solid #96B566; border-right: 1px solid #96B566; white-space: . . . outset; padding: .23em .4em; color: #666666; text-shadow: #222222 0px 0px 5px; } div.content.cloud . . .
14K - last updated 2017-02-26 09:41 by Auriea
blueblueelectricblue
DigitalSculpture <center><html> <div class="sketchfab-embed-wrapper"><iframe width="1080" . . . height="600" src="https://sketchfab.com/models/ed124c52c0b74232b719913f55fc077d/embed" . . .
1K - last updated 2018-12-25 15:00 by Auriea.
bookbinding
SketchBooks ==The Making Of [[Book50]]== ===1.=== <html><iframe class="vine-embed" src="https://vine.co/v/MpqZaFMXgit/embed/postcard" . . . I want to practice more. Basically just take 4-6 pages (depending on the thickness of the paper) and . . . </html> ===6.=== <html> <iframe class="vine-embed" src="https://vine.co/v/MpbM0z6wuOz/embed/postcard" . . . src="https://vine.co/v/Mpbrng99h6I/embed/postcard" width="320" height="320" frameborder="0"></iframe><script . . .
8K - last updated 2014-06-02 17:08 by Auriea
caryatid
A CARYATID IS A SCULPTED FEMALE FIGURE SERVING AS AN ARCHITECTURAL SUPPORT TAKING THE PLACE OF A COLUMN . . . IN THE TREASURIES OF DELPHI, DATING TO ABOUT THE 6TH CENTURY BC, BUT THEIR USE AS SUPPORTS IN THE FORM . . .
1K - last updated 2010-08-04 01:04 by Auriea
cinamatography
[[Movies]] [::VadimYusov] * tarkovski ** ivan's childhood ** solaris ** etc. [::ChristopherDoyle] * WongKarWai . . . ** in the mood for love ** 2046 ** chungking express ** etc. . . .
1K - last updated 2007-04-05 11:47 by Auriea
clock
[[Quoth]] Clocks by lsaac Asimov Through most of history, people hardly felt the need of clocks. It seemed . . . hour a day. No clock in existence, up through 1656, could measure short intervals of time accurately, . . . more regularly than with the weights alone. In 1656 the Dutch astronomer Christian Huygens first devised . . . in wood, and hung the clock on the wall. In 1670 an English clockmaker, William Clement, made use . . .
6K - last updated 2007-08-31 14:49 by Auriea
color
[[Reference]] ''see also: FavoriteColor'' [::DeadColor] The first layers of paint the artist applies . . . http://0to255.com/ ----- R: 249, G:244, B:006 Cadmium Lemon R: 244, G:237, B:001 Yellow R: 241, . . . G:167, B:016 Cadmium Yellow R: 231, G:129, B:053 Cadmium . . . Orange R: 225, G:036, B:066 Cadmium Red R: 231, G:081, B:110 Rose Madder . . . R: 166, G:036, B:046 Alizarin Crimson R: 208, G:042, B:064 . . .
2K - last updated 2013-01-16 12:15 by Auriea
computer history
[[Empire]] ==prehistory== # brother or sx-70 ?? something (i was 8) # commodore vic 20 !! <3 # mac . . . Tablet PC # Mercury - !MacBook Air 13" i7 256 (mid 2013) acquired Feb 2014 # ATLAS - iMac 27"(late . . . acquired Apr 2014 # Danae + Dante - Alienware 2016 15" laptop # Elektra and Orestes - Microsoft Surface . . . 2 13" (2018) # Nero <3 Poppea - Corsair One i64, i9/2080Ti (2020) # Zephyrus - MacBook Air (2021) . . . ==meta== # Delphine - iPod touch 16GB 2nd gen # Vorenus - iPod touch 32GB 4th gen <3 . . .
2K - last updated 2024-12-20 15:29 by Au
css
/* @override http://auriea.org/?* */ @import url('https://fonts.googleapis.com/css?family=Quattrocento+Sans|Quattrocento|Cutive . . . 179, 179, .7); font-size: 16px; font-family: 'Quattrocento Sans', mono; color: . . . rgb(52, 56, 203); } div.wrapper { padding: 0px 20px 20px 20px; . . . bold; } /* @group A's */ a.url { color: rgb(52, 56, 203); text-decoration:none; font-family: 'Quattrocento+Sans', . . . serif; } a.url:hover { } a { color: rgb(52, 56, 203) ; text-decoration:underline; } a.local { color: . . .
15K - last updated 2022-03-21 12:38 by Au
cuirass
<html><iframe src="https://poly.cam/capture/409D21F1-0416-499A-84A1-3CBFB781A1AC/embed" title="polycam . . . capture viewer" style="height:640px;width:480px; frameborder="0"></iframe> . . . title="polycam capture viewer" style="height:640px;width:480px;" frameborder="0"></iframe></html> . . .
1K - last updated 2024-09-02 19:26 by Auriea
era
[[日本語]] * 645 大化 Taika * 650 白雉 Hakuchi * 654 (Discontinued) * 672 白鳳 Hakuhō * 686 . . . 朱鳥 Shuchō * 686 (Discontinued) * 701 大宝 Daihō or Taihō * . . . * 757 天平宝字 Tempyō-hōji * 765 天平神護 Tempyō-jingo * 767 神護景雲 Jingo-keiun . . . * 781 天応 Ten'ō * 782 延暦 Enryaku * 806 大同 Daidō * 810 弘仁 Kōnin * 824 天長 Tenchō . . . * 947 天暦 Tenryaku * 957 天徳 Tentoku * 961 応和 Ōwa * 964 康保 Kōhō * 968 安和 Anna . . .
6K - last updated 2005-06-29 09:29 by wof
ethnobotany
[[Research]] http://www.boingboing.net/2008/08/26/photos-by-ethnobotan.html find out more on this subject . . .
2K - last updated 2010-11-23 13:31 by Auriea
exercise
[[Reference]] ''see also: breathe, yoga, meditation, scoliosis'' this series is a little crazy: <html> . . . <object width="640" height="385"><param name="movie" value="http://www.youtube.com/v/7xctBhj7TVc?fs=1&hl=en_US&color1=0x234900&color2=0x4e9e00"></param><param . . . allowfullscreen="true" width="640" height="385"></embed></object> . . . . . . type="application/x-shockwave-flash" . . .
6K - last updated 2011-03-21 18:10 by Auriea
father
CastOfThousands Full fathom five thy father lies; Of his bones are coral made; Those are pearls that . . . who braved frigid temperatures to mark the 64th anniversary of the surprise attack by the Japanese. . . . of 18,000 in 1991; the members' average age is 86. The U.S. Department of Veterans Affairs estimates . . .
7K - last updated 2007-12-19 16:40 by Auriea
fungi
[[Botany]] * http://farm1.static.flickr.com/70/184447593_9da0683176.jpg http://faculty.cmsu.edu/myxo/Dcancellatum.htm . . .
1K - last updated 2007-08-31 12:13 by Auriea
gRig
ToDo http://www.grig.info/user/login ----- http://lib.fo.am/grig gRig is a guild with the common pursuit . . . and sundry.. . * http://themegarden.org/drupal6/?q=node&theme=barron * http://themegarden.org/drupal6/?q=node&theme=sanqreal . . . * http://themegarden.org/drupal6/?q=node&theme=painted * http://themegarden.org/drupal6/?q=node&theme=Amor_Azul . . . * http://themegarden.org/drupal6/?q=node&theme=hiroshige * http://themegarden.org/drupal6/?q=node&theme=deco . . .
2K - last updated 2009-06-02 13:54 by Auriea
groworld
hexagons <html> <object width="400" height="500"> <param name="flashvars" value="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Ffoam%2Fsets%2F72157610724467408%2Fshow%2F&page_show_back_url=%2Fphotos%2Ffoam%2Fsets%2F72157610724467408%2F&set_id=72157610724467408&jump_to="></param> . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Ffoam%2Fsets%2F72157610724467408%2Fshow%2F&page_show_back_url=%2Fphotos%2Ffoam%2Fsets%2F72157610724467408%2F&set_id=72157610724467408&jump_to=" . . .
10K - last updated 2009-05-21 19:06 by Auriea
gttgaatgggcggatgctaattactatctcccgaaagaatccgcatacca
<pre> Séquence de nucléotides de l'ADN du bactériophage lambda (48502 nucléotides, MM=31,5Md) . . . 601gcggcgttttccggaactggaaaaccgacatgttgatttcctgaaacggg . . . 651atatcatcaaagccatgaacaaagcagccgcgctggatgaactgataccg . . . 1601gaccgggatctggacccgtgatggcattctctggttttcgtcatccggtg . . . 1651aagagattgagccacctgacagtgtgacctttcacatctggacagcgtac . . .
53K - last updated 2004-12-23 22:04 by Auriea
hell
ProofOfMyExistence L'enfer, c'est les autres. (Hell is Other People.) ---Sartre L'enfer, c'est moi! ---Michaël . . . ===for sale=== * http://slashdot.org/articles/06/10/27/118211.shtml ** http://slashdot.org/comments.pl?sid=203038&cid=16611820 . . . time... http://www.theregister.co.uk/2000/04/26/hell_com_for_sale/ . . .
1K - last updated 2006-10-27 22:18 by Auriea
hotglue
* https://hotglue.me/manual#manual.head.130934635562 * https://www.favicon.cc . . .
1K - last updated 2021-03-03 01:43 by Auriea
iBooksAuthor
[[Reference]] ''see also: Dashcode'' HTML Widget creation [http://support.apple.com/kb/HT5068] Best practices . . .
1K - last updated 2012-06-15 13:34 by Auriea
iceland
OutsideSomeplace http://farm4.static.flickr.com/3403/3220856292_ee834ca8c2.jpg http://farm4.static.flickr.com/3350/3220857040_48e56f5eeb.jpg . . .
1K - last updated 2010-04-06 00:10 by Auriea
instagram
<html> <blockquote class="instagram-media" data-instgrm-version="7" style=" background:#FFF; . . . 10px 0 rgba(0,0,0,0.15); margin: 1px; max-width:658px; padding:0; width:99.375%; width:-webkit-calc(100% . . . style=" background:url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACwAAAAsCAMAAAApWqozAAAABGdBTUEAALGPC/xhBQAAAAFzUkdCAK7OHOkAAAAMUExURczMzPf399fX1+bm5mzY9AMAAADiSURBVDjLvZXbEsMgCES5/P8/t9FuRVCRmU73JWlzosgSIIZURCjo/ad+EQJJB4Hv8BFt+IDpQoCx1wjOSBFhh2XssxEIYn3ulI/6MNReE07UIWJEv8UEOWDS88LY97kqyTliJKKtuYBbruAyVh5wOHiXmpi5we58Ek028czwyuQdLKPG1Bkb4NnM+VeAnfHqn1k4+GPT6uGQcvu2h2OVuIf/gWUFyy8OWEpdyZSa3aVCqpVoVvzZZ2VTnn2wU8qzVjDDetO90GSy9mVLqtgYSy231MxrY6I2gGqjrTY0L8fxCxfCBbhWrsYYAAAAAElFTkSuQmCC); . . . line-height:17px;" datetime="2017-06-20T22:06:59+00:00">Jun 20, 2017 at 3:06pm PDT</time></p></div></blockquote> . . .
2K - last updated 2017-06-27 11:34 by Au-Mercury
itouch
[[Reference]] ==microphones== * http://www.griffintechnology.com/products/smarttalk (then i can hook . . . http://forums.macrumors.com/showthread.php?t=606567 ==get!== * eliss * lia's app * http://www.memo.tv/msaremote_for_iphone . . .
1K - last updated 2010-05-06 20:40 by Auriea
language
[[Research]] ''see also: [[reading]], [[writing]]'' http://en.wikipedia.org/wiki/Language_isolate ==Languages . . . http://www.pcvo-gent.net/index.php?id=168 (japanese!) ==Online resources== http://www.omniglot.com . . .
1K - last updated 2010-05-12 23:11 by Auriea
liquor
[[Food]] ==Hyaena's Blackberry Gin== Ingredients: Blackberries, 400 g. Sugar, 600 g. Gin (or vodka), . . .
1K - last updated 2007-09-07 18:43 by Auriea
meditation
[[Reference]] ''see also: breathe, exercise, yoga, SacredGeometry'' http://www.youtube.com/user/yogayak#grid/user/F2C08449BC287BC5 . . . [http://www.youtube.com/view_play_list?p=603BD0B03E12F5A1&annotation_id=annotation_452609&feature=iv] . . . name="movie" value="http://www.youtube.com/p/603BD0B03E12F5A1&hl=en_US&fs=1"></param><param . . . src="http://www.youtube.com/p/603BD0B03E12F5A1&hl=en_US&fs=1" type="application/x-shockwave-flash" . . .
2K - last updated 2010-06-18 09:58 by Auriea
mirror
[[Empire]] [[flash:http://auriea.com/live.swf?thePic=http://www.entropy8zuper.org/wirefire/movies/a.jpg&|160|120|#ae2d17|best|exactfit]] . . .
1K - last updated 2010-06-19 11:07 by Auriea
moon
[[Reference]] ''see also:time'' ||January|| Wolf Moon || ||February|| Snow Moon || ||March|| Worm Moon . . . names=Phobos, Deimos planet=Jupiter moons=62 names=Io, Europa, Ganymede, Callisto, Amalthea, . . . become balanced. The Trojans are situated 60 degrees ahead or behind the larger moon in its orbit . . .
3K - last updated 2007-01-13 21:57 by Auriea
nihongo-month
[[日本語]] || January || いちがつ ||睦月 (むつき)|| || February || にがつ ||如月 or . . . ||5||五日||いつか||6||六日||むいか|| ||7||七日||なのか||8||八日||よううか|| . . . ||15||十五日||じゅうごにち||16||十六日||じゅうろくにち|| ||17||十七日||じゅうしちにち||18||十八日||じゅうはちにち|| . . . ||25||二十五日||にじゅうごにち||26||二十六日||にじゅうろくにち|| ||27||二十七日||にじゅうしちにち||28||二十八日||にじゅうはちに|| . . .
3K - last updated 2005-06-13 10:47 by Auriea
numbers
[[Reference]] [[image:404]] <center>[[33]]</center> http://www.geocities.com/rmlyra/Numbers.html . . . http://3.141592653589793238462643383279502884197169399375105820974944592.com . . . planar maps. 5 is the number of Platonic solids. 6 is the smallest perfect number. 7 is the smallest . . . that there is only one group of order n. 16 is the only number of the form xy=yx with x and y . . . number. 20 is the number of rooted trees with 6 vertices. 21 is the smallest number of distinct squares . . .
74K - last updated 2014-05-30 12:49 by Auriea
nyc
OutsideSomeplace ''lived in: 1989-1999'' [[image:GoingForthByDay]] ==next time== * TheMet, of course . . . ==next next time== * Spanish Art Society (? whats . . . 225 Madison Avenue at 36th Street, New York, NY 10016 ** The Morgan Library . . . 10:30 a.m. to 9 p.m. Saturday: 10 a.m. to 6 p.m. Sunday: 11 a.m. to 6 p.m. ** GET *** catalog: . . . York 10001 ** GALLERY HOURS: Tuesday-Friday 10AM-6PM *Open until 8PM on Thursdays Saturday 12PM-6PM . . .
4K - last updated 2014-11-03 18:47 by Auriea
occult
[[mythology]] ''see also: TheUniverse, AncientReligions'' http://www.rinf.com/e-books/magick_books.html . . . name="movie" value="http://www.youtube.com/v/oqb6ndaHvO4&hl=en"></param><param name="wmode" . . . src="http://www.youtube.com/v/oqb6ndaHvO4&hl=en" type="application/x-shockwave-flash" . . .
1K - last updated 2010-11-23 13:26 by Auriea
ooOOooOOooOO
<html><object width="625" height="553"><param name="movie" value="http://www.youtube.com/v/gbXrdOwDlGc&rel=1"></param><param . . . wmode="transparent" width="625" height="553"></embed></object></html> . . .
1K - last updated 2007-10-07 11:41 by Auriea
painters
[[painting]] see also: Sculptors ==Old Masters== # Velazquez [http://www.metmuseum.org/special/Manet_Velazquez/frenchtaste_images.htm] . . . Desiderio * Odd Nerdrum [[tube:pYg11MvU89M 640 360 0]] * Antonio Lopez * Sigal Tsabari * Nelson . . .
2K - last updated 2014-09-11 11:23 by Auriea
panini
[[Food]] Panini With Artichoke Hearts, Spinach and Red Peppers By MARTHA ROSE SHULMAN Here’s a great . . . hearts, the panini are quickly assembled. 6 ounces (1 bag) baby spinach 3 tablespoons olive oil . . .
2K - last updated 2009-04-16 19:00 by Auriea
particles
[[日本語]] I. Japanese particles are always attached to other words, phrases, and clauses, and act . . . means “corresponds to--” (1) Ichi-doru wa 360 en ni atarimasu. One dollar is equivalent to 360 . . . o okurimasu. I send a magazine to my children. 6. To a. Indicates the substantive to which it is attached . . . I came walking. (5) Katte kuru. I go and buy. (6) Mite kuru. I go and see. (7) Itte kuru. I come saying. . . . Asahan wa rokuji ni tabemasu. I eat breakfast at 6 o’clock. (3) Tsukue no ue ni wa hon ga arimasu. . . .
40K - last updated 2005-06-13 00:06 by Auriea
photographers
CastOfThousands * William Eggleston [http://www.interviewmagazine.com/art/william-eggleston/] [http://www.egglestontrust.com/] . . . . . .
1K - last updated 2009-02-02 02:12 by Auriea
photography
ElegantMedia http://farm4.static.flickr.com/3397/3203934691_f52381bb57.jpg * polaroid * MediumFormat . . .
2K - last updated 2010-07-05 17:51 by Auriea
phreaking
SecretWriting Van Eck Phreaking is the name for a surveillance technology which is, that intelligence . . . ------ http://www.phrack.org http://www.2600.com/ . . .
2K - last updated 2006-12-31 11:47 by Auriea
polaroid
==mod/repair== * How to repair the latch on sx70 [http://www.chemie.unibas.ch/~holder/SX70.html] * How . . . to mod 600 for double exposure [http://silverbased.org/pola600double-mod/] . . .
1K - last updated 2010-06-20 12:01 by Auriea
portrait
[[Research]] [[Img:11th century portrait]] [[Img:12th century portrait]] [[Img:13th century portrait]] . . . portrait]] [[Img:15th century portrait]] [[Img:16th century portrait]] [[Img:17th century portrait]] . . .
1K - last updated 2010-01-30 17:26 by Auriea
postmodern
ElegantMedia for very good reasons he is my lover From: michael@entropy8zuper.org Subject: Re: Postmodernism . . . - Wikipedia, the free encyclopedia Date: 2006年2月28日 22:21:22 GMT+01:00 To: auriea@tale-of-tales.com . . . is so 17th century! ;) (z) At 20:41 28/02/2006, you wrote: <http://en.wikipedia.org/wiki/Postmodernism#Criticism> . . .
3K - last updated 2006-02-28 23:33 by Auriea
private.js
[[Reference]] <source> function translate() { thisText = document.forms[0].input.value.toLowerCase(); . . . = new Array(); for ( i = 0 ; i < 26 ; i++ ) { theseLetters[i] = thisAlphabet.substring(i,i+1); . . . for ( i = 0 ; i < 26 ; i++ ) { while ( thisText.indexOf(theLetters[i]) . . .
2K - last updated 2008-01-11 14:55 by Auriea
procrastination
ProofOfMyExistence [[image:procrastination-image]] "... Dr. Piers Steel is probably the world's foremost . . . synthesizes the evidence on procrastination from 691 other research sources. ''see also: [[2005-01-24_The_Most_depressing_Day_of_the_Year]]'' . . .
3K - last updated 2007-01-13 21:56 by Auriea
romance
romance |rōˈmans; ˈrōˌmans| noun 1 a feeling of excitement and mystery associated with love : in . . . love] dates from the mid 17th cent. ----- [[2006-01-15]] Our next original project is to make a romantic . . .
4K - last updated 2006-12-25 22:00 by Auriea
sauna
[[Reference]] [[Gog:gent belgium sauna]] where i went with tamara: http://www.raj.be/ very nice! sauna . . . stroop http://www.gent.be/eCache/THE/4/216.cmVjPTk5MDUw.html . . .
1K - last updated 2011-03-12 12:40 by Auriea
say
SongBook Learn to say the same thing Let us hold fast to sayin the same thing I hope all is well with . . . <html> <object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=7,0,0,0" . . . name="FlashVars" value="resourceID=1046689&flp=false" /> <param name="movie" value="http://static.last.fm/webclient/inline/1/inlinePlayer.swf" . . . quality="high" FlashVars="resourceID=1046689&flp=false" bgcolor="#ffffff" width="13" height="13" . . .
2K - last updated 2007-06-05 17:09 by Auriea
scri.ch
<html><iframe src="http://scri.ch" width="600" height="600" frameborder="0" style="border:0"></iframe></html> . . .
1K - last updated 2017-02-12 14:06 by Auriea
sea
[[Quoth]] ''see also: Ocean'' . [[vimeo:1444949 600 341 0]] . . Both elbows on the table, I covered my . . .
3K - last updated 2017-02-27 18:26 by Au-Roma
seasons
[[Research]] '''Spring Begins''' The east wind melts the ice Feb 5-9 ~ Larvae twitch in their cocoons . . . Awake''' Peach blossoms open March 6-10 ~ The skylark sings March 11-15 ~ Eaglehawks metamorphose . . . into doves March 16-20 '''Spring Equinox''' The swallows return March . . . 21-25 ~ Thunder lets loose its voice March 26-30 ~ The first lightning flashes March 31 - April . . . 1 '''White Dews''' The wild geese come Sept 2-6 ~ Swallows return Sept 7-11 ~ Flocks of birds gather . . .
4K - last updated 2005-12-18 21:11 by Auriea
skinonskinonskin
[[Empire]] http://entropy8zuper.org/skinonskinonskin/onskin/ <html> <iframe align=center src=http://www.flickr.com/slideShow/index.gne?user_id=81482434@N00&set_id=72157594508283369 . . . skin on skin"; whispers[5] = "implode"; whispers[6] = "soft"; whispers[7] = "slow"; whispers[8] = "can . . . you"; whispers[15] = "we are smoke"; whispers[16] = "yesss"; whispers[17] = "deeper"; whispers[18] . . . bgcolor=000000><MAP NAME="ImageMap65363"><AREA SHAPE="rect" ALT="Z" COORDS="510,598,516,608" . . . border=0 WIDTH=593 HEIGHT=825 USEMAP="#ImageMap65363"><EMBED SRC="./movies/cometome.swf" WIDTH=2 . . .
11K - last updated 2007-01-30 17:19 by Auriea
sleep
[[Research]] # Sleep occurs in cycles of around 90-110 minutes each. Most people normally go through . . . the night (7.5-8.5 hours). If you sleep for 6 hours you’re likely to be on a 4-cycle diet. # . . .
5K - last updated 2010-06-23 18:52 by Auriea
stalker
[[Quoth]] [[tube:dNiVFCWMrqI 640 480 0]] . . .
1K - last updated 2009-02-07 17:50 by Auriea
syndicate
[[Empire]] http://anart.no/~syndicate http://syndicate.anart.no i became a "moderator" or "fire guard" . . . people at the Next Five Minutes in Amsterdam 1996, the Syndicate was established as a platform for . . . culture. In December 2001 there are around 365 subscribers to Syndicate mailing list from more . . . at half-yearly intervals in Rotterdam (Sept. 1996) Liverpool (April 97), Kassel (July 97), Dessau (Nov. . . . in printed form: - V2_East Reader September 1996 - Deep Europe October 1997 - Junction Scopje October . . .
6K - last updated 2005-12-17 17:24 by Auriea
test
jjjjjj [[model:Fauna/gltf/scene.gltf|Fauna/Fauna.usdz]] ------ ::: Like this, a //poem// with its last . . . of the world|walk this way]] That . . .
1K - last updated 2020-05-01 16:22 by Auriea-Mercury
testimg
myImages[5][0] = "http://farm4.staticflickr.com/3447/3984562337_fb1ec28287_z.jpg"; myImages[5][1] = "http://farm2.staticflickr.com/1417/5125202669_dce2330777_z.jpg"; . . . = "http://farm3.staticflickr.com/2436/3985325644_b2b69df0eb_z.jpg"; myImages[5][3] = "http://farm2.staticflickr.com/1071/5125813482_5805af3082_z.jpg"; . . . = "http://farm2.staticflickr.com/1172/5125808762_770179a56e_z.jpg"; myImages[5][5] = "http://farm5.staticflickr.com/4066/5125811896_ec6eaf5bc8_z.jpg"; . . . myImages[5][6] = "http://farm2.staticflickr.com/1429/5125815150_8697ebe371_z.jpg"; . . . = "http://farm5.staticflickr.com/4111/5125816308_e6194b2013_z.jpg"; myImages[5][8] = "http://farm5.staticflickr.com/4019/5125815658_1a2c6d4021_z.jpg"; . . .
2K - last updated 2013-05-30 14:39 by Auriea
time
ElegantMedia * pagan clock http://www.archaeoastronomy.com/myclock.shtml * 10,000 year clock [http://www.longnow.org/projects/clock/prototype1/] . . . [::TimeTravel] WikiPedia:John_Titor ''By 2036, people are making progress in recovering from the . . .
2K - last updated 2010-04-08 11:12 by Auriea
tiramisu
[[Food]] '''maja's simple tiramisu recipe''' (serves about 10 ppl) 1 packet of savoiardi (italian biscuits . . . 2 hours. ------- '''Simple Tiramisu''' (serves 6-8) 115 gram (4 oz) Bisconova savoiardi biscuits 397 . . . mixture over the savoiardie biscuits 6. Sift with a generous dusting of cocoa powder 7. . . .
2K - last updated 2006-09-01 13:16 by Auriea
topology
DigitalSculpture http://www.pig-brain.com/tut02/tut02_02.htm [[image:topology-elbowsknees]] ---- ===crisis . . . ===general tutorials=== * great low poly hair - . . . * Bobo the Seal - http://www.bobotheseal.com/temp/WIP/ . . .
2K - last updated 2008-04-28 12:03 by Auriea
trees
[[Research]] [[background external:http://farm4.static.flickr.com/3155/2428209195_46906f733c_o.jpg|repeat . . . #845dd6]] http://farm5.static.flickr.com/4011/4521074821_20f846b0f7_b.jpg . . . http://farm5.static.flickr.com/4008/4519132068_2c517a372d_b.jpg i have a thing for trees. i photograph . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Ftags%2Ftrees%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Ftags%2Ftrees%2F&user_id=81482434@N00&tags=trees&jump_to=&start_index=" . . .
2K - last updated 2010-04-15 11:13 by Auriea
typhoon
The terms "hurricane" and "typhoon" are regionally specific names for a strong "tropical cyclone". A . . . and assigned a name. If winds reach 33 m/s (64 kt, 74 mph)), then they are called: * hurricane" . . . dateline, or the South Pacific Ocean east of 160E) * typhoon" (the Northwest Pacific Ocean west of . . . cyclone" (the Southwest Pacific Ocean west of 160E or Southeast Indian Ocean east of 90E) * severe . . .
2K - last updated 2004-10-20 09:51 by 192.168.0.10
typography
[[Research]] ==generally== http://typophile.com/ ==type Haute Couture== * hoefler - http://typography.com . . . http://www.eyemagazine.com/feature.php?id=126&fid=560 ==other design== * Andrea Dezso http://a.parsons.edu/~andi/ . . .
1K - last updated 2008-06-27 13:28 by Auriea
uterus
ProofOfMyExistence ''from the first operation'' [[thumb:abdomen_stapled_2002.jpg]] operation on for vleesbomen . . . * can he just leave the cervix anyway? [[2004-06-18]] it will be removed soon. i think, i won't miss . . .
1K - last updated 2007-12-30 00:03 by Auriea
visceral
[[Empire]] [[image:LadyInTheRadiator]] [[foreground external:http://visceral.net/autopsy/mid/02.jpg|repeat . . . http://farm5.static.flickr.com/4014/4479095654_c0f23bb7d3_z.jpg [[image:gold]] [[vimeo:914299 . . . 640 360 0]] . . .
1K - last updated 2015-06-16 21:15 by Auriea
watercolor
[[ArtSupplies]] ==pigments== http://www.kremerpigments.com/ ==you gotta read the label== http://www.handprint.com/HP/WCL/pigmt6.html#label . . .
1K - last updated 2010-08-16 18:22 by Auriea
worms
TuinPlanten Just adding a handful of earthworms to poor soil will probably not do much to improve it. . . . Although they are the most numerous in the top 6 inches, they also work in the subsoil, bringing mineral . . . They may also incorporate it as far down as 6 ft. A soil that is well managed, rich in humus may . . .
4K - last updated 2005-04-04 10:49 by Auriea
writing
ElegantMedia ''see also: CreativeWriting, [[poetry]], [[blog]]'' === hm. === WikiPedia:parataxis WikiPedia:hypotactaxis . . . Avoid cliches like the plague. (They're old hat) 6. Also, always avoid annoying alliteration. 7. Be . . . 15. Comparisons are as bad as cliches. 16. Don't use no double negatives. 17. Eschew ampersands . . . best way to put forth earth shaking ideas. 26. Use the apostrophe in it's proper place and omit . . .
3K - last updated 2017-02-12 14:53 by Auriea