04-15-2014
image/jpeg
19K - last updated 2014-07-21 13:26 by Auriea
1999-01-29
ProofOfMyExistence [[image:Riea-VSOP]] <tt>y must get tripod... just a sec [fakeshop]: telephone . . . (private) oldfashionedphonetypething=718.599.6565 womanonfire -> [fakeshop]: snailconferencing--->212 . . .
32K - last updated 2018-09-11 12:03 by Auriea.
2005-01-16 sweetheart the night
this morning began with thoughts of making my own little web business and ended with considering if a . . .
2K - last updated 2005-01-21 15:15 by wof
2005-01-24 The Most depressing Day of the Year
==i don't feel so well. i think i have people poisoning.== the problem with people is that the talk too . . . background=http://www.askart.com/photos/sny5132003/5.jpg></html> . . .
3K - last updated 2005-01-25 19:30 by wof
2005-01-25 Still can't believe I figured it out
In even less time, I made it work as advertised. . . .
1K - last updated 2005-01-25 21:15 by wof
2005-02-04
[[sound:test.mp3]][[sound:test.mp3]][[sound:test.mp3]] . . .
1K - last updated 2005-02-04 21:46 by wof
2005-02-05 small pleasures
==And that bush guy probably still thinks he's going to heaven. I look forward to seeing his astonished . . .
2K - last updated 2005-02-06 11:36 by 192.168.0.6
2005-02-06 Spring
More than anything I would like to see the cherry blossoms in Kyoto. --cut-- This is a test. But I meant . . . good. visual quotations. NotesForANewE8Z ==== 2005-02-06 Spring ==== . . .
1K - last updated 2005-02-07 02:34 by 192.168.123.100
2005-02-07 The Day Before
Today I fixed up the wireless modem. Gave it a nice sensible password so that the whole neighborhood . . .
1K - last updated 2005-02-07 19:23 by 192.168.0.9
2005-02-09 The Day After
now it is The Day After I have a little headache from all the verdoving It was a strange way to spend . . .
1K - last updated 2006-06-05 10:26 by Auriea
2005-02-19
okay i am gonna try to remember everything that happened in Maastricht. we drove there. parked the car . . . how to get into the academy because it was after 5 and they locked the doors. we had to look for annemie . . .
3K - last updated 2005-02-19 20:41 by 192.168.0.2
2005-03-12 Middle Passage
Not much survived the move from New York to Gent. I am not sure how I chose which memories to keep, which . . . i love you scrawled on paper and a photo from 1995. . . .
2K - last updated 2006-06-02 20:21 by Auriea
2005-03-18
today is our anniversary :) http://entropy8zuper.org/godlove/6years.html i guess we still love the net. . . .
1K - last updated 2005-03-18 13:24 by me
2005-03-20 Love the poem, not the poet
I don't know why life has to be the way it is. i am not sure what force is at work. i do not pretend . . .
1K - last updated 2005-03-20 15:02 by me
2005-03-23 forsaken
My big monitor that i won in 1996 died today. Very sad, and now i am stuck working on a fuzzy and far . . .
2K - last updated 2005-03-23 20:17 by Auriea
2005-03-25 Last night's dream
I was still with Marc. I was looking at red stipples on his back he was white almost blue. I had different . . .
1K - last updated 2005-03-25 12:36 by Auriea
2005-03-26
spent the day making a new [[sketchbook]]. i was just in the mood. it is all uneven. i am calling it . . .
1K - last updated 2005-03-26 23:52 by Auriea
2005-03-30
i am paralyzed. -no you're not. . . .
1K - last updated 2006-06-13 17:31 by Auriea
2005-03-31
don't you dare be afraid now. i cleaned the koer but good today. it needs a table. i would love to spend . . . of the city sort of outside. anyway. got a [50Books book] of W.B. Yeats poetry and added the following . . .
1K - last updated 2005-03-31 22:03 by Auriea
2005-04-12
problem is i can't concentrate worth a damn, worth a damn. i HATE it when i get like this. floating and . . .
1K - last updated 2005-04-12 22:21 by Auriea
2005-05-21 SedumSpathulifolium
image/jpeg
67K - last updated 2005-06-05 10:15 by Auriea
2005-05-26 Self Portrait
image/jpeg
60K - last updated 2006-07-09 22:02 by Auriea
2005-06-02 HemelSleutel
image/jpeg
24K - last updated 2005-06-05 13:56 by Auriea
2005-06-04
=== 1 Comment. === this plant has died. long time ago now. most unfortunate because it was beautiful. . . .
1K - last updated 2009-02-11 21:41 by Auriea
2005-06-04 JadePlant
image/jpeg
87K - last updated 2007-01-05 11:39 by Auriea
2005-06-04 VelvetPlant
image/jpeg
95K - last updated 2005-06-04 21:29 by Auriea
2005-06-08 VindgerhoedsKruidInBloom
image/jpeg
96K - last updated 2005-06-22 22:28 by Auriea
2005-06-08 WederikInBloom
image/jpeg
173K - last updated 2005-06-22 22:27 by Auriea
2005-06-11 Self Portrait
image/jpeg
104K - last updated 2006-12-29 16:33 by Auriea
2005-06-11 painting
image/jpeg
39K - last updated 2012-06-05 13:51 by Auriea
2005-06-22 PrikneusInBloom
image/jpeg
193K - last updated 2005-06-22 22:30 by Auriea
2005-06-22 TeunisBloemBloom
image/jpeg
117K - last updated 2005-06-22 22:19 by Auriea
2005-06-24 My desk on a hot day
image/jpeg
140K - last updated 2005-06-24 19:36 by Auriea
2005-06-28 orchids
image/jpeg
77K - last updated 2005-06-29 09:46 by wof
2005-06-28 zBirthdayFlowers
image/jpeg
125K - last updated 2005-06-28 14:38 by Auriea
2005-06-28 zBirthdayFlowers2
image/jpeg
38K - last updated 2005-06-29 09:48 by wof
2005-06-29 forest work
image/jpeg
74K - last updated 2006-11-05 14:57 by Auriea
2005-07-03 accidents happen
image/jpeg
66K - last updated 2006-06-19 21:11 by Auriea
2005-07-03 grr
image/jpeg
105K - last updated 2005-07-03 19:21 by Auriea
2005-07-16 painting
image/jpeg
64K - last updated 2006-07-09 22:03 by Auriea
2005-07-19 The King
image/jpeg
60K - last updated 2006-06-20 09:01 by Auriea
2005-07-27 make it real
image/jpeg
65K - last updated 2005-07-27 17:37 by Auriea
2005-09-02 grave
image/jpeg
27K - last updated 2005-09-03 01:15 by Auriea
2005-10-06 remembrance of things past
image/jpeg
134K - last updated 2007-01-10 13:13 by Auriea
2005-10-07 Jarboe in Rot1
image/jpeg
47K - last updated 2005-10-07 19:31 by 84.194.164.18
2005-10-07 Jarboe in Rot2
image/jpeg
65K - last updated 2006-06-24 23:32 by Auriea
2005-11-01 pie
image/jpeg
83K - last updated 2005-11-02 00:27 by Auriea
2005-11-08 la france cest moi
image/jpeg
83K - last updated 2005-11-08 21:18 by Auriea
2005-11-27 Sculpture-AHMS
image/gif
103K - last updated 2006-06-25 09:21 by Auriea
2005-12-08 TEF-stations
image/jpeg
95K - last updated 2006-12-31 11:50 by Auriea
2005-12-19 Reality is slippery
real <-- --> virtual == photography <-- --> painting. the virtual destroys the real. photography . . .
1K - last updated 2005-12-19 11:52 by Auriea
2006-02-15 endless arcade
image/jpeg
13K - last updated 2006-02-15 19:00 by Auriea
2006-05-04 art supplies
image/jpeg
54K - last updated 2006-05-04 19:14 by Auriea
2006-05-04 deer paradox from nik
image/jpeg
63K - last updated 2006-05-04 17:02 by Auriea
2006-05-04 deerpot from nik
image/jpeg
46K - last updated 2006-05-04 18:50 by Auriea
2006-05-07 weapon of choice
image/jpeg
55K - last updated 2006-05-07 10:35 by Auriea
2006-05-08 one last thing
3am normally i would be going to bed about now but instead i'm waking up and getting on a plane. so just . . .
2K - last updated 2006-05-08 03:16 by Auriea
2006-05-09 Berninis grave
image/jpeg
69K - last updated 2006-05-14 21:48 by Auriea
2006-05-11 under the tree
image/jpeg
138K - last updated 2006-05-13 14:31 by Auriea
2006-05-17 lina site launch day
image/jpeg
85K - last updated 2006-05-17 19:27 by Auriea
2006-05-30 muse 12h48
it occurs to me most accutely this day that my biggest problem is that i don't know what i want. that . . .
1K - last updated 2006-05-30 12:51 by Auriea
2006-06-02
My 35th birthday. Michael brought me 8 of the most beautiful roses. They were pink at the middle and . . .
1K - last updated 2006-06-13 19:59 by Auriea
2006-06-05 The Big German 20h25
image/jpeg
54K - last updated 2006-06-05 20:25 by Auriea
2006-06-30 21h25 Our Little Girl
image/jpeg
146K - last updated 2006-07-09 22:29 by Auriea
2006-07-03 20h45 limits of two revisited
image/jpeg
276K - last updated 2013-01-01 16:50 by Auriea
2006-07-07 20h59 FiftyHeads-079
image/jpeg
76K - last updated 2006-07-07 22:59 by Auriea
2006-07-09 10h05 FiftyHeads-096-detail
image/jpeg
50K - last updated 2006-12-29 16:33 by Auriea
2006-08-03
[[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060803-silenthill5.flv|320|240|#000000|high|noscale]] . . .
1K - last updated 2006-08-03 13:51 by Auriea
2006-12-14 15h00 girlhead
image/jpeg
63K - last updated 2006-12-29 16:30 by Auriea
2007-02-25
image/jpeg
101K - last updated 2007-02-25 22:15 by Auriea
2007-03-15
RandomIdeas ==thoughts?== * talked to Android extolled the virtues of the super-large wacom tablet. he . . .
1K - last updated 2007-03-20 17:28 by Auriea
2007-03-15 gfreject1
image/jpeg
43K - last updated 2007-03-15 17:32 by Auriea
2007-03-15 gfreject2
image/jpeg
41K - last updated 2007-03-15 17:31 by Auriea
2007-04-05
image/jpeg
131K - last updated 2007-04-05 22:19 by Auriea
2007-05-03
image/jpeg
107K - last updated 2007-05-03 22:30 by Auriea
2007-05-18 msk anticipation
image/jpeg
88K - last updated 2007-05-19 19:36 by Auriea
2007-05-19
destinesia - when you get to where you're going and forget why you went there . . .
1K - last updated 2007-05-19 17:13 by Auriea
2007-05-20
image/jpeg
43K - last updated 2007-05-20 13:13 by Auriea
2007-09-05 30MinutesOrLess
image/jpeg
127K - last updated 2007-09-05 01:41 by Auriea
2007-09-26 21h58 sleeeeeeep
image/jpeg
58K - last updated 2007-09-26 23:58 by Auriea
2007-10-05
image/jpeg
41K - last updated 2007-10-05 11:03 by Auriea
2007-10-15
image/jpeg
72K - last updated 2007-10-15 00:18 by Auriea
2007-11-15
image/jpeg
47K - last updated 2013-08-30 13:21 by Auriea
2007-11-25
image/jpeg
157K - last updated 2007-11-25 23:03 by Auriea
2007-12-05
image/jpeg
265K - last updated 2007-12-07 22:47 by Auriea
2008-02-15
image/jpeg
147K - last updated 2008-02-15 01:24 by d54C6FF9F.access.telenet.be
2008-02-25
image/jpeg
225K - last updated 2008-02-25 06:39 by adsl-76-252-57-126.dsl.ipltin.sbcglobal.net
2008-03-05
image/jpeg
70K - last updated 2008-03-05 01:46 by d54C6FF9F.access.telenet.be
2008-03-05-02
image/jpeg
181K - last updated 2009-01-10 18:18 by Auriea
2008-03-15
image/jpeg
34K - last updated 2009-01-22 21:31 by Auriea
2008-03-31 15h27 architecture
image/jpeg
171K - last updated 2008-03-31 22:31 by d54C6FF9F.access.telenet.be
2008-05-01
image/jpeg
110K - last updated 2008-05-02 09:26 by Auriea
2008-05-02
image/jpeg
259K - last updated 2008-05-06 10:27 by Auriea
2008-05-02oui
image/jpeg
87K - last updated 2008-05-02 19:29 by Auriea
2008-05-04
image/jpeg
137K - last updated 2008-05-04 12:50 by Auriea
2008-05-06
image/png
69K - last updated 2008-05-06 12:16 by Auriea
2008-05-07
image/jpeg
13K - last updated 2008-05-07 09:45 by Auriea
2008-05-08
image/jpeg
80K - last updated 2008-05-08 20:19 by Auriea
2008-05-10
image/jpeg
255K - last updated 2008-05-10 22:28 by Auriea
2008-05-16
image/jpeg
29K - last updated 2008-05-16 23:12 by Auriea
2008-05-20
image/jpeg
42K - last updated 2008-05-20 20:48 by Auriea
2008-05-27
image/jpeg
31K - last updated 2008-05-27 21:01 by Auriea
2008-07-05
image/jpeg
24K - last updated 2008-07-05 23:57 by Auriea
2008-08-25 superhyperworkinprogress
image/jpeg
84K - last updated 2008-08-25 21:47 by Auriea
2008-09-05
image/jpeg
53K - last updated 2008-09-05 13:13 by Auriea
2008-09-25
image/jpeg
166K - last updated 2008-09-26 00:35 by Auriea
2008-10-05
image/jpeg
130K - last updated 2008-10-05 00:44 by Auriea
2008-11-05
image/jpeg
78K - last updated 2008-11-05 09:37 by Auriea
2008-12-05 she lives
image/jpeg
40K - last updated 2008-12-05 15:52 by Auriea
2009-02-05
image/jpeg
66K - last updated 2009-02-05 02:37 by Auriea
2009-03-30 gdc notes
<html><object width="480" height="295"><param name="movie" value="http://www.youtube.com/v/UcC9-HYX1Ek&hl=en&fs=1&color1=0x5d1719&color2=0xcd311b"></param><param . . . type="application/x-shockwave-flash" . . . allowfullscreen="true" width="480" height="295"></embed></object></html> We . . . http://farm4.static.flickr.com/3426/3391916861_5ae5d64235.jpg Indeed it was a big theme for us and . . . http://farm4.static.flickr.com/3618/3391916775_0ed0bf1bf4.jpg . . .
2K - last updated 2009-03-30 11:41 by Auriea
2009-05-11
image/jpeg
36K - last updated 2009-05-11 14:18 by 78-21-206-53.access.telenet.be
2009-05-12
image/jpeg
102K - last updated 2009-05-13 09:01 by 141-70-72-68.user.wh-stuttgart.de
2009-05-29
image/jpeg
57K - last updated 2009-05-29 13:33 by Auriea
2009-09-25
image/png
12K - last updated 2009-09-25 03:05 by Auriea
2010-03-25
[[image:2010-03-25_tarot]] tarot tries to make me feel better about work and all the critical children . . .
1K - last updated 2017-05-12 09:43 by Au-Danae
2010-03-25 paper universe
image/jpeg
164K - last updated 2010-03-25 19:49 by Auriea
2010-03-25 tarot
image/jpeg
129K - last updated 2017-05-12 09:47 by Au-Danae
2010-05-06
image/jpeg
251K - last updated 2010-05-06 15:20 by Auriea
2010-05-06 18h54 now
image/jpeg
117K - last updated 2010-05-06 20:55 by Auriea
2010-05-07
image/jpeg
107K - last updated 2010-05-07 23:20 by Auriea
2010-05-14
image/jpeg
23K - last updated 2010-05-14 15:49 by Auriea
2010-05-21 scribble
image/jpeg
125K - last updated 2010-05-21 22:59 by Auriea
2010-06-02 at 16-26-50
image/jpeg
63K - last updated 2010-06-18 13:01 by Auriea
2010-06-17 at 15-17-17
image/jpeg
88K - last updated 2010-06-18 13:02 by Auriea
2011-01-24
http://farm6.static.flickr.com/5217/5384081289_0c2f98d18c.jpg http://farm6.static.flickr.com/5220/5384685608_f29334f390.jpg . . .
1K - last updated 2011-01-24 18:09 by Auriea
2011-11-25 desktop today
image/jpeg
88K - last updated 2011-11-26 14:43 by Auriea
2012-03-12
sunny :) getting back to organized existence after the trip to trouville last week, which threw my schedule . . . http://www.flickr.com/photos/entropy8/sets/72157629203803128/ . . .
1K - last updated 2012-03-16 19:57 by Auriea
2012-10-05
image/jpeg
461K - last updated 2015-08-07 13:27 by Auriea
2012-11-13
[[image:Book45_CoverTemp]] . . .
1K - last updated 2012-11-22 12:01 by Auriea
2015-06-17 souvenir
image/jpeg
594K - last updated 2015-06-17 16:34 by Auriea
2015-07-22
image/jpeg
179K - last updated 2015-07-27 13:25 by Auriea
2015-08-03
image/jpeg
1227K - last updated 2015-08-07 13:30 by Auriea
2017-05-17-SelfPortrait-Louvre
image/jpeg
2394K - last updated 2018-12-31 02:16 by Au-Roma
2017-12-15-NoQuarterAnimal-SelfPortrait.jpg
image/jpeg
2190K - last updated 2019-02-26 10:32 by Auriea
2018-09-25 Flora
image/jpeg
152K - last updated 2018-09-29 20:21 by Auriea
2018-12-05
image/jpeg
713K - last updated 2018-12-05 10:08 by Au-Roma
2019-03-15
image/jpeg
596K - last updated 2019-04-03 16:53 by Auriea
2019-07-05
image/jpeg
788K - last updated 2019-07-14 15:57 by Au-Roma
34
The great Tao flows everywhere. All things are born from it, yet it doesn't create them. It pours itself . . . is truly great. <center><--[[33]] - [[35]]--></center> . . .
1K - last updated 2014-05-30 12:47 by Auriea
35
She who is centered in the Tao can go where she wishes, without danger. She perceives the universal harmony, . . .
1K - last updated 2014-05-30 12:47 by Auriea
36
That which shrinks Must first expand. That which fails Must first be strong. That which is cast down . . . should not be displayed. <center><--[[35]] - [[37]]--></center> . . .
1K - last updated 2014-05-30 12:47 by Auriea
3dsMax
[[Reference]] 3 point lighting tutorial: http://www.3dtotal.com/team/Tutorials/Jenns3pt_tut/3ptlighting.asp . . . http://forum.onmac.net/archive/index.php/t-965.html <source> McCloud 6th January 2007, 07:25 . . . Manuliscious 6th January 2007, 08:43 PM This . . .
2K - last updated 2008-08-05 14:37 by Auriea
44
Fame or integrity: which is more important? Wealth or happiness: which is more valuable? Success or failure: . . . belongs to you. <center><--[[43]] - [[45]]--></center> . . .
1K - last updated 2017-02-11 20:01 by Auriea
45
The most complete seems lacking. Yet in use it is not exhausted. The most abundant seems empty. Yet in . . .
1K - last updated 2017-11-25 11:25 by Au-Mercury
46
When the Way governs the world, The proud stallions drag dung carriages. When the Way is lost to the . . . enough is always enough. <center><--[[45]] - [[47]]--></center> . . .
1K - last updated 2017-11-25 11:26 by Au-Mercury
49
The sage has no concern for himself, But makes the concerns of others his own. He is good to those who . . . his own children. <center><--[[48]] - [[50]]--></center> . . .
1K - last updated 2020-10-08 09:02 by Auriea
5
Heaven and Earth are impartial; They see the ten thousand things as straw dogs. The wise are impartial; . . .
1K - last updated 2004-08-11 16:43 by wof
50
We go from birth to death. Three out of ten follow life. Three out of ten follow death. People who rush . . .
1K - last updated 2021-07-09 09:43 by Auriea
5YearPlan
twitter notes for a plan for the next 5 years of my life. http://storify.com/auriea/5yearplan year 1: . . . year 2: #doingit year 3: year 4: year 5: . . .
1K - last updated 2017-08-23 17:13 by Au-Mercury
80sVideoGameResearch
[[Research]] http://www.stadtmuseum-ks.de/index.php/ausstellungen/aktuelle-sonderausstellung Mi, 5.2.2020, . . .
3K - last updated 2020-01-31 03:03 by Au-Elektra
AShortHistoryOfMyth
FiftyBooks Notes, since i bought the book. * Like science and technology, mythology... is not about opting . . . [http://www.amazon.com/gp/product/184195716X/104-6287722-9418308?v=glance&n=283155] '''What . . . and desires. </source> Copyright © 2005 by Karen Armstrong . . .
14K - last updated 2012-06-07 16:15 by Auriea
About
<table/about A, B> A/abouttd:[[thumb:2020-04-06|500px]] B/abouttd:http://auriea.art ------ <center> . . . [[thumb:2009-07-04|500px]] ''Welcome to my homepage.'' This site began . . .
1K - last updated 2023-10-25 14:19 by 93-42-66-246.ip85.fastwebnet.it
Abraxas
[[mythology]] A term used by the Basilideans, a Gnostic sect of the second century, designating the Supreme . . . when computed numerically equaled the number 365, which is the number of days in the year. It was . . . further believed that Abraxas commanded 365 gods, each possessing a virtue, so there was a virtue . . . Also, a favorite amulet bore the number 365. Later Gnostic symbols were adopted by many societies . . .
2K - last updated 2005-10-22 12:53 by Auriea
AllYouEverWantedToKnowAboutTempest
[[Tempest]] ==== All you Ever Wanted to Know About TEMPEST ==== from http://library.psyon.org/tempest.txt . . . Electromagnetic Compliance FAQ.) During the 1950's, the government became concerned that emanations . . . program. === TEMPEST History === The original 1950s emanations standard was called NAG1A. During the . . . Communications Security Information Memorandum 5100 (Directive on TEMPEST Security), also known as . . . NACSIM 5100. This was again revised in 1974. Current national . . .
44K - last updated 2008-05-02 21:50 by Auriea
AmaryllisFlower
TuinPlanten Ours didn't flower this year so I am thining I didn't let it hybernate properly: ''Advice . . . Rinse & repeat. I've had one going . . .
1K - last updated 2005-06-05 11:10 by Auriea
Ana
CastOfThousands http://profile.myspace.com/index.cfm?fuseaction=user.viewProfile&friendID=227408394 . . . http://farm3.static.flickr.com/2463/3722815466_35162e7cdc_b.jpg . . .
1K - last updated 2010-04-14 23:40 by Auriea
Ananatomy
[[Projects]] It would be really nice to update this site so that it works. I would change nothing else . . . . . .
1K - last updated 2007-05-14 16:53 by Auriea
AnimalCrossing
[[Games]] http://www.communauteanimalcrossing.fr/jukebox.php <source> Animal Crossing: Wild World . . . Blue Feather - 200,000 bells. Yellow Feather - 500,000 bells. Red Feather - 800,000 bells Purple Feather . . . Get the Gold Tools: Golden Slingshot Shoot down 15 items from the sky, then shoot the Golden Slingshot . . . later Nook Store Upgrades: Nook 'n' Go Spend 25,000 Bells in Nook's store. Nookway Spend 65,000 Bells . . . and sell them. In return, he will give you 4,500 bells. NOTE:You may get stung on your eye from . . .
10K - last updated 2009-01-14 12:16 by Auriea
AnneCarson
CastOfThousands my favorite living poet... if i could be said to have a favorite poet * http://www.poetryfoundation.org/bio/anne-carson . . . [[tube:zK44lArPXYc&hl 480 385 0]] [[image:GriefLessons]] . . .
1K - last updated 2013-01-06 12:30 by Auriea
AnneSexton
CastOfThousands <html> <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/L4VlcVfgFJk&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> </html> . . .
1K - last updated 2010-05-05 00:26 by Auriea
Aphrodite
<html><iframe id='embed3DViewer' src='http://www.123dapp.com/fullpreview/embedViewer?assetId=1950236&size=small' . . .
1K - last updated 2014-01-08 12:20 by Auriea
Apollo
[[mythology]] ==== This is copied from Mythica:Apollo ==== The son of Zeus and Leto, and the twin brother . . . during the height of the colonizing era circa 750-550 BCE. Apollo's title was "Archigetes" (leader . . .
10K - last updated 2007-05-03 09:59 by Auriea
ApprenticeBookbinder
RandomIdeas http://www.geocities.com/SoHo/Lofts/2123/coperta_08.html seriously, I want to learn a craft. . . . I can recommend you to visit our school on the 5the of may this year, from 9.00 am till 4.00 pm, we . . . want to contact me earlyer you can phone me 0475/47.23.65 greetings Josée -- Josee Van Loon - Atelier . . . LEDER & PERKAMENT Hekers, 2 Zwijnaarde B9052 Gent-Belgium Tel. & Fax: 32-(0)9-221.33.68 Email: . . . Bibliotheca Wittockiana, 21-23 rue de Bemel, 1150 Bruxelles 32 2 770 5333 Tues-Sat 10.00-5.00pm Closed . . .
3K - last updated 2005-04-29 09:52 by Auriea
ArtSchool
''see also: OntwikkelingsgerichteBeurs'' ==Online Classes== * http://www.livepaintinglessons.com/colour.php . . . it for dreams. [[background external:http://25.media.tumblr.com/tumblr_lyqgfgDLQm1r2qws7o1_1280.jpg|repeat . . .
2K - last updated 2013-02-15 14:26 by Auriea
ArtistStatement old
[[About]] An engagement with images of things/people/stories which don’t exist but are believed to . . . books, photo manipulations, drawings. But in 1995 the computer invaded me completely. I discovered . . . Along with Cologne Gamelab, in 2011, 2013 and 2015 we curated “notgames Fest” which was a bi-annual . . . in 2014 and made our last videogame in 2015 with the release of political drama, “Sunset”. . . .
13K - last updated 2020-05-07 17:23 by Auriea-Mercury
Astronaut
SongBook http://blog.amandapalmer.net/post/185458467/the-writing-filming-of-the-song-astronaut . . .
1K - last updated 2009-09-12 21:29 by 78-21-206-50.access.telenet.be
Athens
OutsideSomeplace If I ever get back to Athens, go to the Museon Hill. Monument to "Uncle Phil" and fabulous . . . to the sea. Also this island is renowned for its 5ooo years old civilization. Not far from my house, . . . me, and they ask me whether On 7 Jul 2006, at 20:56, Auriea wrote: >> On 2006/07/07, at 19:44, . . .
2K - last updated 2011-01-11 00:24 by Auriea
AugmentedReality
DigitalSculpture ==Tools I can use== * ARToolkit https://artoolkit.org/download-artoolkit-sdk ** ARToolkit . . . in Blender ? - http://www.ashsid.sk/?p=1591 <html><object width="480" height="385"><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> [::AugmentedRealityBooks] . . . (tools) http://saqoosha.net/2008/10/18/1585/ http://translate.google.com/translate?hl=en&sl=ja&u=http://saqoosha.net/2008/08/31/1221/ . . .
2K - last updated 2017-03-09 16:39 by Au-Mercury
August2006Travel
DarkSecret SALES PERSON: WM ITINERARY DATE: 25 MAY 06 CUSTOMER NBR: CREATIVE00 LRKYSE PAGE: 01 TO: CREATIVE . . . CAPITAL 65 BLEECKER STREET 7TH FLOOR NEW YORK NY 10012 FOR: . . . 14 AUG 06 - MONDAY AIR DELTA AIR LINES INC FLT:5372 COACH NEW YORK JFK-INDIANAPOLIS OPERATED BY COMAIR . . . INC LV NEW YORK JFK 945A EQP: CANADAIR REG JET DEPART: TERMINAL 3 02HR 25MIN . . . 24 AUG 06 - THURSDAY AIR DELTA AIR LINES INC FLT:586 ECONOMY LV INDIANAPOLIS 224P EQP: MD-88 01HR 42MIN . . .
2K - last updated 2006-06-19 10:16 by Auriea
AutobiographyOfRed
FiftyBooks While not as spectacular as TheBeautyOfTheHusband this book has it's moments. It scared me . . . - * Geryon moved the focal ring from 3 to 3.5 meters ''Maybe I'll just keep talking and if I say . . . on their faces, night at their back. -- wof 2005-10-27 08:20 UTC . . .
5K - last updated 2012-06-05 13:48 by Auriea
AutopsyFAQ
[[autopsy]] From: Ed Uthman <uthman@neosoft.com> Newsgroups: sci.med.pathology,sci.med,sci.answers,news.answers . . . Nuntius 2.0_PPC X-XXMessage-ID: <B1230C586501092E@scooter-ppp-port-23.neosoft.com> X-XXDate: . . . family generally cost between US$1200 and US$2500. After the patient is pronounced dead by a physician, . . .
27K - last updated 2007-05-18 12:10 by Auriea
BBCOresteia
<img src="http://auriea.com/wp-content/uploads/Screenshot-2015-06-08-18.57.28.png" alt="Screenshot . . . 2015-06-08 18.57.28" width="622" height="472" class="alignnone . . . size-full wp-image-335" /> <em>"This version of the Oresteia is . . . alt="agamemnon_musing" width="840" height="525" class="alignleft size-large wp-image-438" /> . . . me, either.) <iframe width="420" height="315" src="https://www.youtube.com/embed/O7sdZQ1BDs0?rel=0" . . .
5K - last updated 2017-02-12 14:48 by Auriea
Baklava
[[Food]] Baklava or Baklawa, depends on your preference {{from LJ:roshi}} '''Ingredients''' 10 sheets . . . filo pastry 50gms unsalted butter, melted 200gms walnut pieces/kernels . . . leave to sit and soak the syrup up for about 15 minutes. Serve warm. '''My Notes''' This was quite . . . 2, it won't hurt it much. Just give it another 5 minutes in the oven if you do. . . .
2K - last updated 2007-01-02 16:24 by Auriea
Barcelona
OutsideSomeplace ==some places== * fabra observatory http://www.observatorifabra.com/es/ ----- ==net . . . Inopia Classic Bar, Tamarit 104; (34-93) 424-5231; www.barinopia.com. Irati, Cardenal Casanyes 17; . . . Rossell, Tamarit 109; (34-93) 424-1505. La Cova Fumada, Baluard 56; (34-93) 221-4061. . . . La Boqueria, Plaça de la Boqueria; (34-93) 318-2584; www.boqueria.info. Closed Sundays. Nubius, Espaseria . . . First they deep fry a 6 inch churro that has a 2.5 inch diameter. After it cools down, they inject it . . .
3K - last updated 2008-07-19 20:49 by Auriea
Barry
CastOfThousands [[background:TheHangedMan|repeat #000000]] http://farm3.static.flickr.com/2446/3714923618_1c449775d3_b.jpg . . .
1K - last updated 2010-04-14 23:38 by Auriea
Bauhaus
ElegantMedia <html> <img src="http://www.auriea.org/index.pl/download/BauhausPhoto" USEMAP="#meisterfoto" . . . return true"> <AREA SHAPE=RECT COORDS="24,15,48,122" HREF="http://images.google.com/images?q=Hinnerk . . . true"> <AREA SHAPE=RECT COORDS="149,19,167,59" HREF="http://images.google.com/images?q=Herbertt . . . true"> <AREA SHAPE=RECT COORDS="229,19,255,53" HREF="http://images.google.com/images?q=Marcel . . . true"> <AREA SHAPE=RECT COORDS="172,18,195,47" HREF="http://images.google.com/images?q=Joost . . .
4K - last updated 2005-11-15 14:15 by Auriea
BeautyInTheAgeOfDigitalArt
ElegantMedia moderators: Maja Kuzmanovic (FoAM) and Michael Samyn (Tale of Tales) wednesday may 24, 2006 . . . it seems -Au) more info: http://okno.be/?id=815 ''see also:[[aesthetics]]'' =IT= <tt>Auriea: . . . Beauty in the age of digital art Date: 2006年5月18日 18:15:35 GMT+02:00 To: me Hi, Thank you for . . . in Brussels (more info on: http://okno.be/?id=815). The moderators of this panel are Maja Kuzmanovic . . . to be a bit more heterogeneous than the usual 15 minute presentation + 10 minutes for questions. we'll . . .
10K - last updated 2018-09-11 10:24 by Au-Mercury
BeerScallionPanckakes
[[Food]] '''Beer-Cake Scallion Breakfast Pancakes''' 2 envelopes dry yeast 2 cups flour 1/2 cup, plus . . . 1 tsp white sugar 1.5 teaspoon baking powder
1 tsp. salt 2 cups, plus . . . one splash beer 3 Tbs. warm vegan butter 1.5 cups diced scallions 1/2 cup minced parsley 1. Activate . . . flipping them when they start to bubble on top. 5. Serve with maple syrup, alongside other breakfast . . .
1K - last updated 2007-01-11 00:05 by Auriea
BegoniaEscargot
TuinPlanten "Niet veel water geven,... het zou kunnen een kliene rose bloem groeien" --- bloemwinkelmevrouw . . . no direct sun. If the temperature drops below 45 degrees, bring them inside. Hold back on the water . . .
2K - last updated 2006-05-19 20:29 by Auriea
BenjaminCoopersmith
CastOfThousands one day when i have the time... such stories to tell. http://bencoopersmith.com photographer . . . flamboyant new york friend. ------ ------ 2007-05-08 22:06 ben is finally coming to visit me in europe. . . .
1K - last updated 2010-12-07 12:42 by Auriea
BientotlEte
[[Games]] http://farm9.staticflickr.com/8351/8290258741_f2dea181b6_b.jpg http://farm9.staticflickr.com/8492/8291317362_c12fef80e5_b.jpg . . .
1K - last updated 2013-01-14 14:11 by Auriea
BillViola
CastOfThousands ''see also: ElegantMedia'' much more to mention here later * http://www.museumca.org/exhibit/exhi_viola.html . . . http://farm3.static.flickr.com/2787/4382767139_9457d3faf6.jpg <html> <object width="480" height="385"><param . . . allowfullscreen="true" width="480" height="385"></embed></object> <object width="480" . . . height="295"><param name="movie" value="http://www.youtube.com/v/eTakwOpWqG4&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="295"></embed></object> <object width="480" . . .
2K - last updated 2010-02-24 16:38 by Auriea
Biography
'''AURIEA HARVEY''' digital sculptor / videogame designer b. 1971 Indianapolis, IN 1989-1999 New York . . . of the Walker Art Center, SFMoMA, the Lot 555 NFT collection, and Rhizome’s Net Art Anthology. . . . Biography . . .
2K - last updated 2021-07-09 09:52 by Auriea
Blender
DigitalSculpture ''see also, [[topology]]'' * Creating Blendshapes for facial animation [https://cgi.tutsplus.com/tutorials/create-a-facial-animation-setup-in-blender-part-1--cg-32251] . . . <html><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/_igp7TyRGnU&hl=en&fs=1&"></param><param . . . allowfullscreen="true" width="425" height="344"></embed></object></html> . . . [[vimeo:1221926 400 225 0]] [[vimeo:1227660 400 225 0]] ==Material== Add . . . 'U' key to "make single user" ==Viewports== 1,3,5,7,9 use the CTRL key for the opposite view. 0 = camera . . .
7K - last updated 2018-11-22 18:08 by Auriea.
BlenderAnimation
[[Blender]] ==Morph Targets== Morph targets in Blender are also known as relative vertex keys. On the . . . http://www.elysiun.com/forum/viewtopic.php?t=38685 http://perso.wanadoo.fr/jb.perin/Mocap/MocapAnimation.html . . .
6K - last updated 2010-03-25 17:25 by Auriea
BlenderGameEngine
[[Blender]] http://tba-creations.leveluphost.com/index.php/Tutorials/using-the-mouse-in-the-ge-theory.html . . . time users. * [http://www.blending-online.co.uk/8501/49279.html 3rd person camera collision detection] . . . * [http://www.elysiun.com/forum/viewtopic.php?t=45163 2D camera following thread on elYsiun] * [http://blender3d.org/cms/3D_Walkthrough.340.0.html . . . the official documentation for 2.25] ----- ===On Radiosity=== * http://geocities.com/z3r0_d/bTut01.html . . . * [http://www.elYsiun.com/forum/viewtopic.php?t=56976&sid=c9c67def96ca13646af68932dc134465 on radiosity . . .
3K - last updated 2009-04-22 18:34 by 78-21-206-53.access.telenet.be
BlenderHA
[[Blender]] BPy script repository (sometimes you will get an error message that one or the other of these . . . - http://www.elYsiun.com/forum/viewtopic.php?t=58543 * http://download.blender.org/documentation/htmlI/x5612.html . . . * http://blender3d.org/cms/The_Blender_Windows.235.0.html * http://en.wikibooks.org/wiki/Blender_3D:_Noob_to_Pro . . . * http://www.cgtalk.com/showthread.php?t=50137 * [http://www.cgtalk.com/showthread.php?t=52560 . . . [http://www.elysiun.com/forum/viewtopic.php?t=43154 When you import one .blend file into another it . . .
3K - last updated 2007-02-24 20:00 by Auriea
BlenderKeys
[[Blender]] ==Basic editing== Quit Q Abort command ESC Erase CTRL-X all X selected Editmode on/off TAB, . . . open, F2 File save, F3 Image save, F4 Lamp, F5 Material, F6 Texture, F7 Animation, F8 Realtime, . . . Render with SHIFT: F1 Load lib, F4 DataView, F5 3D, F6 Ipo, F7 View Buttons, F8 Seq.Editor, F9 Oops, . . . Perspective mode Toggle persp/ortho NUMPAD 5 Camera view NUMPAD 0 Interactive Spinning Mdrag, . . . from Display buttons (F10) SizeX, SizeY, 100%, 75%, 50%, 25%, AspX, AspY, Presets Display in view or . . .
11K - last updated 2006-09-04 10:56 by Auriea
BlenderNormalMaps
Blender ==Step by Step== * material node tutorial and reference http://www.geneome.net/blender/writtentutorials/matnodes.html . . . <html> <object width="320" height="265"><param name="movie" value="http://www.youtube.com/v/qDOI-31jVzE&hl=en&fs=1"></param><param . . . allowfullscreen="true" width="320" height="265"></embed></object> <object width="640" . . . name="movie" value="http://www.youtube.com/v/gyi5_RHHDx0&hl=en&fs=1"></param><param . . . src="http://www.youtube.com/v/gyi5_RHHDx0&hl=en&fs=1" type="application/x-shockwave-flash" . . .
2K - last updated 2009-08-01 17:17 by Auriea
BlenderRendering
[[Blender]] * Node Editor tutorial - http://www.blender.org/cms/Blender_Material_Nodes.743.0.html Preview . . . . . .
1K - last updated 2006-12-20 00:08 by Auriea
BlueberryMuffins
[[Food]] 1 1/2 teacups (which are probably about the right size) of this flour that says its for fijngebak... . . . Preheat oven to that little mark after 175 C which might be 200 C. Grease muffin pan a bit but . . .
3K - last updated 2008-02-15 22:37 by d54C6FF9F.access.telenet.be
BodufSongs
http://farm4.static.flickr.com/3391/3509373923_608241d89a_o.jpg FM:Boduf+Songs seen at croxhapox on may . . .
1K - last updated 2009-05-18 14:57 by Auriea
Book0
SketchBooks 1987-1988 8.5x11 in. [[thumb:Book0_Cover|250px]] [[thumb:Book0_bird]] [[thumb:Book0_fantasydrawing]] . . .
1K - last updated 2018-09-09 20:58 by Auriea
Book15
SketchBooks May 1992 - Sept 1992 store bought, laserprint on old bookpaper cover, 8x7 inches [[thumb:Book15_Cover|350px]] . . . [[thumb:Book15_BackCover|350px]] [[thumb:Book15_ana-mom|200px]] . . . [[thumb:Book15_the_foolish_virgin|200px]] [[thumb:Book15_kit_lli_me|40px]] . . . [[thumb:Book15_me_w_venus|200px]] [[thumb:Book15_myperfectlife|200px]] . . . [[thumb:Book15_ravi_shari_md|200px]] [[thumb:Book15_ravi|200px]] . . .
1K - last updated 2012-09-04 12:35 by Auriea
Book15 BackCover
image/jpeg
174K - last updated 2012-09-04 12:34 by Auriea
Book15 Cover
image/jpeg
200K - last updated 2012-09-04 12:33 by Auriea
Book15 ana-mom
image/jpeg
25K - last updated 2006-05-28 22:39 by Auriea
Book15 kit lli me
image/jpeg
10K - last updated 2006-05-28 22:39 by Auriea
Book15 me w venus
image/jpeg
96K - last updated 2006-05-28 22:40 by Auriea
Book15 myperfectlife
image/jpeg
89K - last updated 2006-05-28 22:41 by Auriea
Book15 ravi
image/jpeg
97K - last updated 2006-05-28 22:41 by Auriea
Book15 ravi shari md
image/jpeg
94K - last updated 2006-05-28 22:41 by Auriea
Book15 separation
image/jpeg
78K - last updated 2006-05-28 22:42 by Auriea
Book15 symptoms and side effecs
image/jpeg
101K - last updated 2006-05-28 22:42 by Auriea
Book15 the foolish virgin
image/jpeg
45K - last updated 2006-05-28 22:39 by Auriea
Book15 xray
image/jpeg
70K - last updated 2006-05-28 22:43 by Auriea
Book17
SketchBooks '''millions of secrets are generated every day''' january 1993 - april 1993 [[thumb:Book17_Cover|300px]] . . . [[background:paper_bkg|repeat #ded9c5]] <table/booknav prev, next> prev/l=[[Book18|18.]] . . .
1K - last updated 2012-09-17 14:25 by Auriea
Book19
SketchBooks '''everyday kinds of peace and violence''' july 1993 - september 1993 23.5 x 31 cm; handbound . . . [[thumb:Book19_NeverDoubt|500px]] [[vimeo:48441613 500 281 0]] [[foreground:paper_bkg2|repeat . . . [[background:paper_bkg|repeat #ded9c5|200px]] . . .
1K - last updated 2012-09-06 12:31 by Auriea
Book20
SketchBooks '''Psyche Story''' Oct 1993 - Apr 1994 20 x 25.5 cm; handbound, found cover w/collage <center>[[vimeo:3065816 . . .
1K - last updated 2020-04-09 12:01 by Auriea-Mercury
Book20 5
image/jpeg
108K - last updated 2006-05-25 14:32 by Auriea
Book21
SketchBooks <include "Book21B"> ------ <include "Book21A"> [[foreground:paper_bkg2|repeat . . . [[background:paper_bkg|repeat #ded9c5]] . . .
1K - last updated 2012-09-06 12:24 by Auriea
Book21A
'''Night; stars and a bright moon.''' used briefly in 1994 and 1995 17.5 x 25 cm; handbound, velvet and . . .
1K - last updated 2012-09-06 12:25 by Auriea
Book21B
'''The Disease Manifesto''' July 1994 - winter 1994 33.5 x 25.5 cm; handbound, velvet and gold paint . . . [[thumb:Book21B_Cover|300px]] [[vimeo:914110 500 300 0]] [[foreground:paper_bkg2|repeat transparent]] . . . [[background:paper_bkg|repeat #ded9c5]] . . .
1K - last updated 2012-09-06 12:20 by Auriea
Book22A
SketchBooks '''present''' winter 1994 - winter 1995 [[thumb:Book22A_Cover|300px]] . . .
1K - last updated 2012-09-06 12:36 by Auriea
Book22B
SketchBooks '''Chinese Wedding'' summer - winter 1995 [[thumb:Book22B_Cover|350px]] [[thumb:Book22B_BackCover|350px]] . . . [[thumb:Book22B_img4|200px]] [[thumb:Book22B_img5|200px]] [[thumb:Book22B_img6|200px]] [[thumb:Book22B_img7|200px]] . . .
1K - last updated 2012-09-06 12:49 by Auriea
Book22B img5
image/jpeg
283K - last updated 2012-09-06 12:50 by Auriea
Book23A
[[image:Book23A_Cover]] used only briefly in 1995 then dismembered, didn't like the feel of it, or something . . .
1K - last updated 2012-09-06 14:00 by Auriea
Book23B
'''''Like Being Awake Sleeping And Hearing Seeing''''' Oct. 1995 - June 1996 [[thumb:Book23B_Cover|250px]] . . . [[thumb:Book23B_BackCover|250px]] "She is a living example of the ancient theorem . . . http://farm4.staticflickr.com/3492/3220016947_6592702ddb_z.jpg Iceland http://farm4.staticflickr.com/3403/3220856292_ee834ca8c2.jpg . . . http://farm4.staticflickr.com/3350/3220857040_48e56f5eeb.jpg first ever trip to London . . . . . .
1K - last updated 2012-09-06 13:59 by Auriea
Book25
SketchBooks 16 july 1997 - jun 1999 '''2 million year-old light''' [[image:Book25_Cover]] [[vimeo:48442206 . . . 500 375 0]] [[thumb:Book25_TheOnlyKnownDrawingOfRickInMaine|250px]] . . . http://farm4.staticflickr.com/3471/3259850143_f259922420_z.jpg http://farm4.staticflickr.com/3436/3260683536_227165209e_z.jpg . . . http://farm4.staticflickr.com/3428/3277767783_c5d8e60b4a_z.jpg . . .
1K - last updated 2012-11-20 18:27 by Auriea
Book25 Cover
image/jpeg
77K - last updated 2012-09-03 14:46 by Auriea
Book25 TheOnlyKnownDrawingOfRickInMaine
image/jpeg
99K - last updated 2006-05-25 13:14 by Auriea
Book28
SketchBooks '''bandaged (elegantly)''' 24 aug 2001 - 18 oct 2003 10.5 x 17 cm [[image:Book28_Cover]] . . .
1K - last updated 2012-09-01 17:50 by Auriea
Book29
SketchBooks '''Really Big Fires''' oct 2003 - apr 2005 Daler-Rowney sketchbook [[thumb:Book29_Cover|300px]] . . .
2K - last updated 2018-09-09 21:18 by Auriea
Book30
SketchBooks '''In-Between''' April 2005 - 4 August 2005 17 x 30.5 [[thumb:Book30_Cover|300px]] [[thumb:Book30_HecubaBlindsPolymnestor|150px]] . . .
1K - last updated 2018-09-09 21:17 by Auriea
Book31
SketchBooks '''"In case of loss, please return to: THAT PLACE IN YOUR HEART WHERE ALL THINGS ARE REAL"''' . . . [[thumb:Book31_Roma05|200px]] [[thumb:Book31_Roma06|200px]] [[thumb:Book31_Roma07|200px]] . . . [[thumb:Book31_Roma15|200px]] [[thumb:Book31_Roma16|200px]] These were . . . drawn on location in The Eternal City from 20060508-20060511. Michael and I went there for a good, . . .
2K - last updated 2018-09-09 21:17 by Auriea
Book31 Roma05
image/jpeg
179K - last updated 2006-05-14 21:14 by Auriea
Book31 Roma15
image/jpeg
75K - last updated 2007-01-18 22:40 by Auriea
Book32
SketchBooks '''Beautiful Lightside/Beautiful Darkside''' June 2006 - March 2007 16.3 x 24.3 cm; handbound, . . . [[thumb:Book32_Page11|150px]] [[thumb:Book32_Page18-19|300px]] [[thumb:Book32_Page20-21|300px]] . . . [[thumb:Book32_Page48-49|300px]] [[thumb:Book32_Page53|150px]][[thumb:Book32_Page60-61|300px]] . . . [[thumb:Book32_Page24-25_darkside|300px]] [[thumb:Book32_Page30-31_darkside|300px]] . . . [[thumb:Book32_Page44-45_darkside|300px]] [[thumb:Book32_Page47_darkside|150px]] . . .
2K - last updated 2018-09-09 21:17 by Auriea
Book32 Page24-25 darkside
image/jpeg
364K - last updated 2007-01-10 12:39 by Auriea
Book32 Page44-45
image/jpeg
206K - last updated 2006-08-23 21:33 by Auriea
Book32 Page44-45 darkside
image/jpeg
152K - last updated 2006-10-15 12:49 by Auriea
Book32 Page50-51 darkside
image/jpeg
234K - last updated 2007-01-10 12:35 by Auriea
Book32 Page52-53 darkside
image/jpeg
160K - last updated 2006-10-15 12:52 by Auriea
Book32 Page53
image/jpeg
29K - last updated 2007-02-06 15:39 by Auriea
Book32 Page54-55 darkside
image/jpeg
158K - last updated 2007-01-10 12:26 by Auriea
Book34
SketchBooks '''i sing anyway''' february 2008 [[thumb:Book34_Cover|300px]] <table/booknav prev, next> . . . prev/l=[[Book35|35.]] next/r=[[Book33|33.]] ----- . . .
1K - last updated 2018-09-09 21:17 by Auriea
Book35
SketchBooks '''talking to myself''' [[thumb:Book35_Cover|300px]] [[thumb:Book35_Untitled1|200px]][[thumb:Book35_Untitled2|200px]][[thumb:Book35_Untitled3|200px]][[thumb:Book35_Untitled4|200px]] . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Ftags%2Ftesters%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Ftags%2Ftesters%2F&user_id=81482434@N00&tags=testers&jump_to=&start_index=" . . .
2K - last updated 2018-09-09 21:14 by Auriea
Book35 Cover
image/jpeg
72K - last updated 2012-07-16 18:02 by Auriea
Book35 Untitled1
image/jpeg
423K - last updated 2008-12-27 23:41 by Auriea
Book35 Untitled2
image/jpeg
463K - last updated 2008-12-27 22:46 by Auriea
Book35 Untitled3
image/jpeg
440K - last updated 2009-01-10 02:58 by Auriea
Book35 Untitled4
image/jpeg
514K - last updated 2008-12-28 22:35 by Auriea
Book36
SketchBooks [[thumb:Book36_Cover|300px]] [[thumb:2008-12-31_00h07_done|200px]] <table/booknav prev, . . . next> prev/l=[[Book37|37.]] next/r=[[Book35|35.]] ----- . . .
1K - last updated 2018-09-09 21:13 by Auriea
Book38
SketchBooks '''Der Geist Des Rokoko''' spring 2010 - october 2010 9 x 13 cm [[thumb:Book38_Cover|300px]] . . . . . . [[thumb:Book38_page4-5|200px]] [[thumb:Book38_page1|200px]] [[thumb:Book38_jellyfish|200px]] . . .
2K - last updated 2018-09-09 21:13 by Auriea
Book38 page4-5
image/jpeg
208K - last updated 2010-05-06 00:09 by Auriea
Book39
SketchBooks '''sketchbookipod''' october 2010 - not finished (may use it again sometime) 8.5 x 14.8 cm . . . [[thumb:Book39_img1|250px]] [[thumb:Book39_lamp|250px]] [[thumb:Book39_moon|200px]] . . .
1K - last updated 2018-09-09 21:12 by Auriea
Book41
SketchBooks '''BELGIË/BELGIQUE''' 18 Aug 2011 - 17 feb 2012 25.5 x 20 cm [[thumb:Book41_Cover|300px]] . . . [[thumb:Book41_page43|200px]] [[thumb:Book41_page50-51|200px]] [[thumb:Book41_page68-69|300px]] [[thumb:Book41_page70-71|300px]] . . . [[image:2007-10-15]] <table/booknav prev, next> prev/l=[[Book42|42.]] . . .
1K - last updated 2018-09-09 21:12 by Auriea
Book41 page50-51
image/jpeg
213K - last updated 2012-09-11 12:11 by Auriea
Book42
SketchBooks '''GLAMOUR''' December 20, 2011 - February 29, 2012 12 x 18.5 [[thumb:Book42_Cover|300px]] . . . [[thumb:Book42_page35-36|200px]] [[thumb:Book42_page57-58|200px]] [[thumb:Book42_page66|100px]] . . .
1K - last updated 2018-09-09 21:11 by Auriea
Book42 page35-36
image/jpeg
168K - last updated 2012-09-07 14:11 by Auriea
Book42 page57-58
image/jpeg
245K - last updated 2012-09-07 14:11 by Auriea
Book43
SketchBooks '''De Rerum Natura''' March 18, 2012 - June 25, 2012 17 x 25.5 cm; handbound cover: canvas, . . . (DeRerumNatura)'' ''written by Lucretius in 50 B.C.'' ''translated by A.E. Stallings'' ''(written . . .
3K - last updated 2018-09-09 21:08 by Auriea
Book44
SketchBooks '''FEU ET FLAMME''' June 26, 2012 - November 12, 2012 16x24 cm.; handbound, found cover w/collage . . . <table/booknav prev, next> prev/l=[[Book45|45.]] next/r=[[Book43|43.]] ----- . . .
3K - last updated 2018-09-09 19:25 by Auriea
Book45
SketchBooks [[thumb:Book45_Cover|400px]] '''Mars Black''' 13 November 2012 - 5 March 2013 ----- [[thumb:Book45_InsidePortrait|200px]] . . . [[thumb:Book45_figure1|200px]] [[thumb:Book45_flowerportraits|200px]] . . . [[thumb:Book45_leaves|200px]] [[thumb:Book45_fourlegs|200px]] [[thumb:Book45_rose|200px]] . . . [[thumb:Book45_figure2|200px]] [[thumb:Book45_figure3|200px]] [[thumb:Book45_redmartha|200px]] . . . [[thumb:Book45_BackOfMarthasHead|110px]] [[thumb:Book45_martha|200px]] . . .
1K - last updated 2018-09-09 21:07 by Auriea
Book45 BackOfMarthasHead
image/jpeg
361K - last updated 2013-04-08 13:46 by Auriea
Book45 BattleOfCentaurs
image/jpeg
280K - last updated 2013-04-08 13:47 by Auriea
Book45 Cover
image/jpeg
196K - last updated 2013-04-08 12:57 by Auriea
Book45 CoverTemp
image/jpeg
211K - last updated 2012-11-22 11:02 by Auriea
Book45 Europa
image/jpeg
272K - last updated 2013-04-08 13:47 by Auriea
Book45 InsidePortrait
image/jpeg
241K - last updated 2013-04-08 13:22 by Auriea
Book45 MarcelGod
image/jpeg
327K - last updated 2013-04-08 13:47 by Auriea
Book45 figure1
image/jpeg
280K - last updated 2013-04-08 13:23 by Auriea
Book45 figure2
image/jpeg
202K - last updated 2013-04-08 13:37 by Auriea
Book45 figure3
image/jpeg
284K - last updated 2013-04-08 13:38 by Auriea
Book45 flowerportraits
image/jpeg
414K - last updated 2013-04-08 13:25 by Auriea
Book45 fourlegs
image/jpeg
250K - last updated 2013-04-08 13:37 by Auriea
Book45 leaves
image/jpeg
202K - last updated 2013-04-08 13:28 by Auriea
Book45 martha
image/jpeg
315K - last updated 2013-04-08 13:46 by Auriea
Book45 redmartha
image/jpeg
292K - last updated 2013-04-08 13:46 by Auriea
Book45 rose
image/jpeg
253K - last updated 2015-07-06 19:06 by Auriea
Book46
SketchBooks '''Σκύρος''' 06 March 2013 - 26 July 2013 14 x 25 cm handmade, canson mi-tientes paper, . . . . . . next> prev/l=[[Book47|47.]] next/r=[[Book45|45.]] ----- . . .
1K - last updated 2018-09-09 21:06 by Auriea
Book46 5
image/jpeg
1489K - last updated 2014-09-01 23:42 by Auriea
Book47
SketchBooks '''Costumes Anciens et Modernes''' 26 July 2013 - 25 Sept 2013 14.5 x 23 cm handmade, found . . . [[thumb:Book47_inserts|550px]] ------- [[thumb:Book47_1|200px]][[thumb:Book47_2|200px]][[thumb:Book47_3|200px]][[thumb:Book47_4|200px]][[thumb:Book47_5|200px]][[thumb:Book47_6|200px]][[thumb:Book47_7|200px]][[thumb:Book47_8|200px]][[thumb:Book47_9|200px]][[thumb:Book47_10|200px]][[thumb:Book47_11|200px]][[thumb:Book47_12|200px]][[thumb:Book47_13|200px]][[thumb:Book47_14|200px]][[thumb:Book47_15|200px]] . . .
1K - last updated 2018-09-09 21:05 by Auriea
Book47 15
image/jpeg
312K - last updated 2014-09-08 19:26 by Auriea
Book47 5
image/jpeg
260K - last updated 2014-09-08 19:22 by Auriea
Book48
SketchBooks [[thumb:Book48_Cover|300px]] [[thumb:Book48_BackCover|300px]] '''Paris''' 25 Sept 2013 - . . . [[thumb:Book48_4|200px]] [[thumb:Book48_5|200px]] [[thumb:Book48_6|200px]] [[thumb:Book48_7|200px]] . . . [[thumb:Book48_14|200px]] [[thumb:Book48_15|200px]] [[thumb:Book48_16|200px]] [[thumb:Book48_17|200px]] . . . [[thumb:Book48_24|200px]] [[thumb:Book48_25|200px]] [[thumb:Book48_26|200px]] [[thumb:Louvre_AphroditeChalk|300px]] . . . [[thumb:Louvre_DoubleCentaur|500px]] [[thumb:Louvre_Eros|300px]] [[thumb:Louvre_ThighsChalk|500px]] . . .
2K - last updated 2018-09-09 21:05 by Auriea
Book48 15
image/jpeg
309K - last updated 2014-09-09 13:38 by Auriea
Book48 25
image/jpeg
260K - last updated 2014-09-09 13:42 by Auriea
Book48 5
image/jpeg
325K - last updated 2014-09-09 13:34 by Auriea
Book49
SketchBooks [[thumb:Book49_Cover|400px]] [[thumb:Book49_BackCover|400px]] '''La salle des Caryatides''' . . . 21 Dec 2013 - 1 June 2014 21.5cm x 15cm bought at the Sennelier across from the . . . [[thumb:Book49_4|200px]] [[thumb:Book49_5|200px]] [[thumb:Book49_6|200px]] [[thumb:Book49_7|200px]] . . . [[thumb:Book49_14|200px]] [[thumb:Book49_15|200px]] [[thumb:Book49_16|200px]] [[thumb:Book49_17|200px]] . . . [[thumb:Book49_24|200px]] [[thumb:Book49_25|200px]] [[thumb:Book49_26|200px]] [[thumb:Book49_27|200px]] . . .
2K - last updated 2018-09-09 21:04 by Auriea
Book49 15
image/jpeg
302K - last updated 2014-09-09 14:14 by Auriea
Book49 25
image/jpeg
199K - last updated 2014-09-09 14:17 by Auriea
Book49 35
image/jpeg
340K - last updated 2014-09-09 14:19 by Auriea
Book49 5
image/jpeg
188K - last updated 2014-09-09 14:12 by Auriea
Book5
SketchBooks '''Pseudo Quasi Real''' 15 Apr 1990 - 27 May 1990 31 x 31 cm; spiral bound sketchbook w/added . . . cardboard covers and polaroid [[thumb:Book5_Cover|300px]] [[foreground:paper_bkg2|repeat transparent]] . . . [[background:paper_bkg|repeat #ded9c5]] [[thumb:Book5_bones|200px]] [[thumb:Book5_life . . . closed twice|300px]] [[thumb:Book5_scroll|350px]] [[thumb:Book5_selfportrait|200px]] . . . [[thumb:Book5_washingtonsqpark|200px]] . . .
1K - last updated 2012-09-07 11:00 by Auriea
Book50
SketchBooks [[thumb:Book50_KittenAsMuse|300px]] [[thumb:Book50_Mauritshuis|300px]] . . .
1K - last updated 2014-09-28 13:07 by Auriea
Book50 KittenAsMuse
image/jpeg
865K - last updated 2014-09-09 12:54 by Auriea
Book50 Mauritshuis
image/jpeg
1751K - last updated 2014-09-28 13:07 by Auriea
Book51
image/jpeg
3041K - last updated 2015-06-17 17:33 by Auriea
Book57-CaravaggioStJTB
image/jpeg
1724K - last updated 2017-09-15 12:45 by Au-Mercury
Book5 Cover
image/jpeg
107K - last updated 2006-05-16 00:34 by Auriea
Book5 bones
image/jpeg
367K - last updated 2006-06-27 13:06 by Auriea
Book5 life closed twice
image/jpeg
644K - last updated 2007-01-08 23:57 by Auriea
Book5 scroll
image/jpeg
1118K - last updated 2007-01-08 23:56 by Auriea
Book5 selfportrait
image/jpeg
403K - last updated 2008-05-07 22:42 by Auriea
Book5 washingtonsqpark
image/jpeg
467K - last updated 2006-06-27 13:04 by Auriea
Book6
SketchBooks 8 may 1990 - 20 aug 1990 '''sex, life, and the cosmos''' [[thumb:Book6_Cover|300px]] [[thumb:Book6_SecretWriting|200px]] . . . prev, next> prev/l=[[Book7|7.]] next/r=[[Book5|5.]] ----- [[foreground:paper_bkg2|repeat transparent]] . . . [[background:paper_bkg|repeat #ded9c5]] . . .
1K - last updated 2012-09-25 11:12 by Auriea
Books
ElegantMedia [[Books]] ''see also: FromLibrary, SketchBooks, FiftyBooks, ApprenticeBookbinder'' [[tube:sUgjlJ5hEbw . . .
1K - last updated 2012-12-19 12:34 by Auriea
BorisVian
CastOfThousands [[image:BorisVianAaZ]] books: [http://www.artworldbooks.com/pages/search.php?words=Vian&theme=0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16] . . . Vian's collected works amount to more than 50 vols. He died in a Parisian cinema at the age of . . . songs is the pacifist 'Le déserteur' (1955), about the Algerian war. It sold thousands of records, . . . parts in films and wrote film scenarios. In 1958, he and the director Louis Malle persuaded Miles . . . Les Bâtisseurs d'Empire ou le Schmurz (1959) was about a bourgeois family whose new apartment . . .
8K - last updated 2012-07-02 13:21 by Auriea
BronzeFoundryNotes
ObjectSeries Meeting with ArtCasting in Oudenaarde on [[2017-03-02]]: <center>[[image:2017-03-02_ArtCasting]] . . . idea. [https://www.patreon.com/posts/goals-8244514 Goals.] # asked if I am happy with the texture . . .
3K - last updated 2017-03-02 18:38 by Au-Mercury
BrownieBox
http://farm4.static.flickr.com/3220/2511129142_6526e97e16.jpg . . .
1K - last updated 2009-01-05 00:37 by Auriea
CCcaseStudy
[[CCretreat2009]] # The idea for The Path grew out of our desire to make games based on folk tales. Our . . . to success or failure, why, and do it in 10 to 15 minutes. Describe and identify the resources you . . .
5K - last updated 2009-07-23 23:17 by Auriea
CCpresentation2006
[[CCretreat2006]] # introduction '''''slide 01 - ToT''''' ## Hi, I am Auriea Harvey. # ToT ## I have . . . players. On average you will find around 15-20 deer playing at any given time. The game is quite . . . alot in common with a silent film. '''''slide 05 - 144''''' ## The charcters are the 6 Red Girls who . . .
7K - last updated 2009-06-29 11:09 by Auriea
CCpresentation2009
[[CCretreat2009]] '''''slide 01 - ToT''''' # Hello, I am Auriea Harvey he is Michael Samyn, we are Tale . . . Beauty which takes place in a palace during 500 years of sleep; A game bout an old woman who visits . . .
3K - last updated 2009-07-23 22:58 by Auriea
CCretreat2006
OutsideSomeplace ''see also ToDo, [[August2006Travel]], nyc, [[CCpresentation2006]]'' ==Contacts== Connor . . . Kalista: 315-560-9307 Katrina Grigg-Saito: 315-560-9223 ==things . . . for the retreat== '''FOR PDW (aug 2-3 8:45a-5:30p)''' Lawrence Hall -Ho Lecture room- Room 105 . . . Peretti - eyebeam 4. Pam Winfrey - exploratorium 5. Karen Marta & Ricky Lee - gsm marketing 6. Anne . . .
2K - last updated 2009-06-29 11:10 by Auriea
CaesarSalad
[[Food]] '''Green Garlic Caesar Salad With Anchovy Croutons''' 1/2 cup olive oil 7 anchovy fillets, finely . . . until croutons are golden and crisp, 3 to 5 minutes. 2. Make dressing: In medium bowl, whisk . . .
2K - last updated 2010-06-14 20:58 by au
CatIdeas
[[Ling]] ==Catification== * plank above michael's desk -> 1m x 30cm ** connect to the projector platform . . . * http://www.zooplus.nl/shop/katten/krabpaal_krabmeubels/krabtonnen/krabtonnen/277865 . . . http://www.bol.com/nl/p/krabpaal-serpa-zwart-40x40x90/9200000025083080/ . . . http://www.bol.com/nl/p/krabmeubel-segra-35x35x44/9200000026309213/ http://www.scratchycats.com/kitten_sisal_cat_scratching_post.html . . . http://www.dierenvilla.be/krabton-dasha-iii-grijs.html . . .
4K - last updated 2014-10-29 18:32 by Auriea
CatcherInTheRye
[[FiftyBooks]] almost didn't want to finish it. really was not something for me i guess. a novel written . . . who was the intended audience in the 50s for this book? lifted from:http://www.tmtm.com/sides/catcher.html . . . Holden Caulfield, a teenager growing up in 1950s New York, has been expelled school for poor achievement . . .
3K - last updated 2005-08-09 17:36 by AurieaHarvey
CauliflowerSoup
[[Food]] cauliflower soup 11/2 c. onion 1 1/2 lb cauliflower 12 tsp salt 1/8 tsp cayenne 3 tblsp fresh . . . dill 5 c stock 1 c milk (or 1/2 c milk 1/2 cream) onion . . . salt, cayenne, 2 tblspn dill and stock. cook 25-30 min, puree (i will puree all but 2 cups, i think), . . .
1K - last updated 2009-09-12 23:09 by 78-21-206-50.access.telenet.be
CeremonyOfInnocence
[[Games]] <html> <object width="700" height="525"><param name="allowfullscreen" value="true" . . . allowscriptaccess="always" width="700" height="525"></embed></object><p>Ceremony . . . Amazon]! ;)}} The books themselves were . . .
10K - last updated 2009-10-29 13:04 by Auriea
CharacterDesigners
CastOfThousands [[drawing]] Some CharacterDesigners I admire: '''[::AkihikoYoshida]''' Final Fantasy . . . Interview - http://www.1up.com/do/feature?cId=3152237&did=1 '''[::TetsuyaNomura]''' Final Fantasy . . .
3K - last updated 2006-09-24 20:10 by Auriea
Chowder
[[Food]] ; To serve about eight . . .: 4 oz. bacon 1 lg. onion, chopped 1 stalk celery, chopped . . . pepper, cored, seeded, and chopped 4 or 5 ears sweet corn--shucked with corn kernels cut from . . . to taste Simmer haddock in 2 cups of water for 15 minutes. Drain off and reserve the broth. Remove . . . Add milk and butter and simmer for an additional 5 minutes, or until well heated. Season with salt and . . . pepper, and wine or water. Cover and simmer for 15 to 20 minutes, until fish is cooked. Break fish into . . .
5K - last updated 2006-03-20 12:33 by Auriea
ConfigPage
package OddMuse; $CookieName = 'akiw'; $SiteName = 'Auriea L'; $HomePage = 'AurieaL'; $RCName = 'About'; . . . $KeepDays = 365; $defaultTZ = 2; $UploadAllowed = 1; @UploadTypes . . . http://entropy8zuper.org %s years", '1999-05-13'=>"Auriea moved to Belgium for good http://entropy8zuper.org . . .
6K - last updated 2023-10-25 14:36 by au
Contact
==EMAIL ME== <center>For direct inquiries please contact: studio@auriea.art</center> ==FIND . . . IS OUT THERE== [https://vimeo.com/showcase/7076574|SIMULATIONS] http://song-of-songs.org * [http://cathedral-in-the-clouds.net . . .
2K - last updated 2025-02-17 10:10 by AuOG
Context
* [http://instagram.com/auriea.harvey.studio|SCULPTURE] * [https://vimeo.com/showcase/7076574|SIMULATIONS] . . .
1K - last updated 2020-12-28 18:30 by Auriea
Cornbread
[[Food]] ===Ingredients=== 1 cup all-purpose flour 1 cup yellow cornmeal 2/3 cup white sugar 1 teaspoon . . . prepared pan. Bake in preheated oven for 20 to 25 minutes, or until a toothpick inserted into the center . . .
1K - last updated 2010-01-20 16:59 by Auriea
CraterLake
OutsideSomeplace [[background external:http://farm4.static.flickr.com/3311/3220926576_c92fc88cbc_b.jpg|repeat . . .
1K - last updated 2010-04-06 00:16 by Auriea
CurrentObsession
[[Projects]] I like things to be super clear. I like them to be -rich. I like JazzStandards and FairyTales. . . . [[OOO]], [[Consolidation]], Projects'' [[2019-05-18]] * KingMidas * Rumplestiltskin * Spatialism ------ . . . [[2019-02-25]] * [[python]] ** [[GAN]], [[RNN]] ** PythonPoetry . . . https://www.patreon.com/posts/goals-8244514 </center> # SacredArt # Ruins # OldMaps - . . . ----- below this line, as of: 2010-07-05 19:10 ------ ===CreativeWriting=== one of the reason . . .
4K - last updated 2019-05-18 16:46 by Auriea
Cyberspace
ElegantMedia [[image:CyberMapLandmarks]] ''lifted from: https://web.archive.org/web/19970207225527/http://pespmc1.vub.ac.be:80/CYBSPACE.html'' . . .
5K - last updated 2020-01-03 00:31 by Au-Elektra
Cyclops
[[Projects]] <center>[[thumb:2008-10-12|600px]]</center> <tt>"Here is a defense of . . . be certain that they had all died off some 65 million years ago. Also, if Troy, Babylon and other . . .
3K - last updated 2018-11-24 17:36 by Auriea.
DHTML
[[Reference]] ==css== Listamatic - http://css.maxdesign.com.au/listamatic/ make a list look "different" . . . CSS * http://www.smashingmagazine.com/2007/05/10/70-expert-ideas-for-better-css-coding/ ==Art History== . . . * http://www.smashingmagazine.com/2007/01/19/53-css-techniques-you-couldnt-live-without/ . . .
2K - last updated 2007-05-14 13:54 by Auriea
DSBrowserTranslation
[[Games]] ===== ===== NINTENDO DS OPERA WEB BROWSER FAQ (INCLUDES A SETTINGS MENU TRANSLATION) 4.05 ===== . . . [SEC3T] 4. Settings Menu Translation [SEC4] 5. Credits [SEC5] 6. Legal Info [SEC6] ===== 1. Introduction . . . is based on the Opera Mobile Browser version 8.5. The official Opera forums for the browser can be . . . for the original DS is retailing for $39.95 and the version for the DS Lite is $49.95. Their . . . of the browser is retailing (pre-order) for 25 GBP (approx. $47.00 USD) and their cheapest shipping . . .
27K - last updated 2007-01-10 13:03 by Auriea
DadaManifesto
[[Reference]] <html><div align=right><font size=-1><font color=000000>(The signatories . . . DO?<p></font><font size=+1> 50 francs reward to the person who finds the best<br> . . . size=5 ALIGN=CENTER WIDTH="100%"><p> <font size=+1><div . . . Péret, C. Pausaers<br>R.Hülsenbeeks, J. Evola, M. Ernst,<br> P. Eluard, . . . Avenue Kléber.<br>Tel. PASSY 25-22</b></font></html> . . .
6K - last updated 2007-05-22 22:55 by Auriea
DancingDrawing
[[Writing]] DrawingDancing [[background:DancingDrawing-image2|repeat #00FF00 scroll top]] '''A report . . . Nik.[https://www.flickr.com/photos/foam/sets/72157661494693736]'' https://c1.staticflickr.com/1/649/23386951742_41aa815b47_b.jpg . . . I am an artist who Draws. I draw habitually, . . . Kentridge [https://www.youtube.com/watch?v=2-n5Kvw9v4A], Nicolas Gansterer[https://www.youtube.com/watch?v=2Gk8nedJfi4], . . . dance [https://www.youtube.com/watch?v=3Fas65lT3fE] and it was suggested that to learn more I could . . .
13K - last updated 2017-02-12 14:58 by Auriea
DasBoot
[[tube:Oqek9Ktuwy8 512 420 0]] . . .
1K - last updated 2007-09-09 21:25 by Auriea
DasLook
TuinPlanten [[Gog:Allium Ursinum]] http://www.bioimages.org.uk/HTML/R140989.HTM basically, it's wild . . . http://www.biologie.uni-hamburg.de/b-online/fo09/mei13.jpg . . . Height: 12-18 in. (30-45 cm) 18-24 in. (45-60 cm) Spacing: 3-6 in. (7-15 cm) . . .
1K - last updated 2005-12-21 12:23 by Auriea
DeepPaint
[[Reference]] I've chosen to learn DeepPaint3d instead of BodyPaint3d because it has '''less''' features. . . . Menu</p> <table width="516" cellpadding="2" cellspacing="0" style = "border-collapse:collapse" . . . border="1" bordercolor="#010101" bgcolor="#555555"> <tr align="left" valign="top"> <td . . . Menu</p> <table width="516" cellpadding="2" cellspacing="0" style = "border-collapse:collapse" . . . border="1" bordercolor="#010101" bgcolor="#555555"> <tr align="left" valign="top"> <td . . .
23K - last updated 2006-07-15 13:35 by Auriea
DigitalPainting
SketchBook ''see also: [[Painter]] (software) ==How detailed is detailed== close up of leaves, photos . . . http://forums.cgsociety.org/showthread.php?t=236250 * http://features.cgsociety.org/story_custom.php?story_id=3275&page=1 . . . [http://forums.cgsociety.org/showthread.php?p=2581019 converting papers from mac to pc] <source> . . .
2K - last updated 2014-09-29 13:27 by Auriea
DigitalPhotography
[[photography]] ===Problems=== # Digital photography is too beholden to past paradigms ## the framing . . . I've dropped mine many times in the last 5 years, and if I record video and put pressure on . . . #http://flickr.com/photos/duchamp/2643457119/in/set-72157605106384679/ . . .
4K - last updated 2008-11-11 22:55 by Auriea
DigitalPuppetry
ElegantMedia I'm not a big fan of machinima... or at least what people have done with it thus far... . . . [http://www.linuxdevices.com/articles/AT6435065918.html How the Hensons use computers to control . . .
1K - last updated 2007-05-23 22:30 by Auriea
DigitalSculpture
[[Sculpture]] <center><html><iframe width="240" height="480" src="https://sketchfab.com/models/43253ee0013a4603a7af20069a7c9383/embed?autostart=1&ui_infos=0" . . . <list "DigitalSculpture"> [[image:2007-05-20]] striving to take my 3d to the next level (as . . .
2K - last updated 2017-08-24 00:42 by Au-Danae
DigitalSketchBook
SketchBook images drawn on a HomebrewDS using http://www.collectingsmiles.com/colors/ <html><object . . . . . . . . .
1K - last updated 2009-02-01 14:14 by Auriea
DontReadComments
<html><blockquote class="twitter-tweet" lang="en"><p>You have time to create something . . . 10, 2014</a></blockquote> . . .
1K - last updated 2015-02-24 16:07 by Auriea
Dracaena
TuinPlanten Dracaena marginata is een struikachtige plant met slanke, vertakte twijgen, die door de littekens . . . verspreid staande bladeren. Ze worden tot 50 cm lang, zijn vlak, glad en afstaand en staan bij . . . ochtend- en avondlicht. De plant heeft minimaal 750 lux nodig om te overleven, met een optimum van 1300 . . .
2K - last updated 2008-09-10 00:59 by Auriea
Drawing
ElegantMedia ''see also: Projects, ElegantMedia, RandomIdeas, Books, Raphael, DancingDrawing, TheLivingLine'' . . . [[thumb:2014-09-24|200px]] [[vimeo:49597331 160 120 0]] [[thumb:AurieaDrawing2|200px]] [[thumb:AurieaDrawing3|200px]] . . . Ruskin - http://t.co/7YXEEnu and http://t.co/9hMq5q9 * http://www.squidoo.com/what-is-good-drawing ===other . . . Italian Sketchbook] . . . Art Collections – Royal Museum . . .
2K - last updated 2017-08-23 13:18 by Au-Mercury
DrawingDay
[[Drawing]] '''DrawingDay is currently Saturday.''' ==The Rules of Drawing Day== # Feel like you can . . . waste time. [https://www.goodreads.com/quotes/51360-draw-antonio-draw-antonio-draw-and-don-t-waste-time] . . .
1K - last updated 2014-05-08 18:17 by Auriea
DrawingHardware
[[Research]] ''...artists can stylize their curves while drawing by dynamically adjusting line thickness . . . features.'' http://www.physorg.com/news109425896.html http://www-users.cs.umn.edu/~keefe/dfk_iweb/Home.html . . .
1K - last updated 2010-10-19 00:43 by Auriea
EagleCreek
[[park]] [[image:EagleCreek-imgFromMomsCellPone]] [[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060815-eaglecreektrees1.flv&repeat=true|320|240|#000000|high|noscale]] . . . . . . . . .
1K - last updated 2007-08-25 19:03 by Auriea
ElectronicPaper
ElegantMedia ''see also: DigitalBookBinding, handscroll, ProsperosBooks'' <html><object width="586" . . . classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000"><param name="movie" value="http://www.sony.co.jp/video3/player.swf?lang=en"></param><param . . . name="flashVars" value="config=/video3/201005/10-0526/config.xml&lang=en"></param><param . . . flashVars="config=/video3/201005/10-0526/config.xml&lang=en" allowFullScreen="true" . . . allowScriptAccess="always" width="586" height="400"></embed></object></html> . . .
2K - last updated 2010-05-27 12:17 by Auriea
ElegantMedia
[[background:TheZone|repeat #000000]] all the things i wouldn't throw away ''related: beauty, romance, . . . life but enhancing it! interaction is the 5th dimension! there is something there, and i am going . . . only if it can be made beautifully. ---20060605 ------ Where is the elegant art of our age? I want . . . examples: http://19thc-artworldwide.org/spring_05/articles/sik.html Perhaps related: http://www.endicott-studio.com/gal/index.html . . .
3K - last updated 2020-04-08 17:46 by Auriea-Mercury
ElementsOfDrama
[[Research]] Story does not equal plot. According to Aristotle drama has 6 main elements: Plot (''mythos'') . . . media are potentially ''better'' at the other 5 narrative elements than any other media. . . .
1K - last updated 2005-06-18 11:16 by Auriea
Empire
''see also: ComputerHistory'' ==DOMAINS.== <center>'''''Because [http://art.teleportacia.org/Location_Yes|Location . . . * http://www.goodreads.com/user/show/5685418-auriea * http://www.last.fm/user/womanonfire/, . . . *** http://e8z.org/godlove/closer/pop/20000511_kiss.html * http://eden.garden1.1.projects.sfmoma.org . . . * http://mubi.com/users/81386 * http://mixi.jp (womanonfire) . . .
4K - last updated 2019-12-11 12:59 by Auriea-Mercury
EncyclopediaOfEverything
[[Quoth]] In "TheAnalyticalLanguageOfJohnWilkins" Borges describes 'a certain Chinese Encyclopedia,' . . . 3. those that are trained, 4. suckling pigs, 5. mermaids, 6. fabulous ones, 7. stray dogs, 8. those . . .
1K - last updated 2012-07-03 18:05 by Auriea
Entropy8.com
[[Empire]] <center> [[image:flames.gif]] http://entropy8.com/NetscapeNavigator.gif http://entropy8.com/painting/ . . . http://30.media.tumblr.com/tumblr_l6cddiftt11qzs56do1_500.gif [[image:DorianGrayPreface]]</center> . . .
1K - last updated 2018-09-10 19:42 by Auriea.
EnvironmentModeling
DigitalSculpture ==tips and tutorials== http://www.3dtotal.com/team/Tutorials_2/making%20of_urban-environment/urban_01.asp . . . . . .
1K - last updated 2008-05-02 22:18 by Auriea
ErikSatie
CastOfThousands Erik Satie (1912–13) Memories of an Amnesiac (Fragments) 1. What I Am Everyone . . . horse to the end of my grounds: from 1:19 to 2:53. More inspiration: from 3:12 to 4:07. Various . . . symphonic readings (out loud): from 8:09 to 9:59. Going to bed to takes place regularly at . . . of the Société Musicale Indépendent), Paris, 15 April 1912, and 15 February 1913. <html> <object . . . width="500" height="405"><param name="movie" value="http://www.youtube.com/v/Gyo67kdFr98&hl=en_US&fs=1&color1=0x006699&color2=0x54abd6&border=1"></param><param . . .
5K - last updated 2009-11-27 18:52 by Auriea
EvaHesse
CastOfThousands For the exhibition of Contingent at the Finch College Museum of Art, Eva Hesse wrote . . . one complete from back then. Statement, October 15, 1969, out of hospital, short stay this time, third . . .
2K - last updated 2008-12-13 23:08 by Auriea
EveryIcon
[[Empire]] <center><html> <iframe src="http://auriea.org/everyIcon.html" width="450" height="420"> . . . Starting Time October 25, 2007, 4:20:00 PM nyc time (c)1997 John F. Simon, . . . the idea of an “unlimited edition.” I have #158 in a series of infinity! some text: <source> . . . the second line takes an exponentially longer 5.85 billion years to complete. While Every Icon is . . .
3K - last updated 2016-08-11 14:09 by Auriea
ExLibris
[[Empire]] want to design an ExLibris for our library. Not sure if it should be printed for co-ownership . . . and beautiful, Fig. 34; and the pictorial, Fig. 35, which includes designs representing definite ideas . . .
2K - last updated 2010-08-24 17:19 by Auriea
Example No.22
[[Exhibitions]] <center>[[thumb:Example_No.22_install01|650px]]</center> '''A lecture/performance . . . of 3D printworks: 13-18 Nov, Lecture: 15 Nov Location: BALi Kinos Kulturbahnhof [http://auriea.org/download/DokfestProgramAuriea.pdf . . .
1K - last updated 2020-12-29 01:30 by Auriea
Example No.22 Installation Images
[[thumb:Example_No.22_install01|left|300px]] [[thumb:Example_No.22_install02|left|400px]] [[thumb:Example_No.22_install03|left|300px]] . . . [[thumb:Example_No.22_install05|left|400px]] [[thumb:Example_No.22_install04|left|400px]] . . .
1K - last updated 2018-11-23 21:11 by Auriea.
Example No.22 install05
image/jpeg
2167K - last updated 2018-11-23 21:09 by Auriea.
Exhibitions
* '''[[YEAR_ZERO]]''' * '''[[Synthetic_Corpo-Reality]] * '''[[In_The_Kingdom_No._19]]''' * '''[[Example_No.22]]''' . . . of 3D printworks: 13-18 Nov, Lecture: 15 Nov Location: BALi Kinos Kulturbahnhof [http://auriea.org/download/DokfestProgramAuriea.pdf . . .
1K - last updated 2021-02-23 12:40 by Auriea
ExoticFood
[[Food]] http://www.chefkoch.de/rezepte/2351371373904775/Bulgur-Salat.html http://www.chefkoch.de/rezepte/904381195730161/Dolmades.html . . . http://www.chefkoch.de/rezepte/259631101560945/Reitersuppe.html . . .
1K - last updated 2013-09-18 13:38 by Auriea
Family tree of the greek gods
[[mythology]] Quote Chaos | +-------+-----+-------+------+------+ | | | | | Gaia Tartarus Eros Chronos . . . | (Siren) | | | | | | | | | \ \ \ |Metis | \ (50 Nereid) | | | | | | | Atlas Epimetheus| Prometheus . . .
5K - last updated 2007-08-27 22:42 by Auriea
FataleVrouwen
[[Mythology]] == [::Eve] == [[thumb:Eve-Snake|right]] the first woman. ==TheGraeae== : Mythica:Graeae . . . self-cursing contained in the oath" (Burkert 1985 p 198). They were usually said to have been born . . . said police officer Ram Bharose. The woman, 35, told police she had gone to a nearby forest to cut . . . took place in Makkapurva village, some 125 miles southeast of Lucknow, the capital of Uttar . . .
16K - last updated 2013-01-05 20:57 by Auriea
Fauna
[[thumb:Fauna-image.jpg|700px]] Fauna, 2018 3d printed plaster, 3d printed bronze, terracotta clay, natural . . . </center> . . .
1K - last updated 2020-11-16 14:44 by Auriea-Mercury
FavoriteApps
[[Empire]] * = not for iPad but i use it on iPad anyway ! = Don't know what I would do without it. Convert* . . . IncrediBooth - fun photo booth app by . . . if you don't have the apps for these sites . . . iFiles - a way to put miscellaneous documents . . . https://itunes.apple.com/be/app/ifiles/id336683524?mt=8 Stuff Apple makes that I find goo to have: . . .
6K - last updated 2013-01-04 14:55 by Auriea
FavoritePodcasts
[[Empire]] ===Antiquity Podcasts=== # Dan Carlin's Hardcore History - https://itunes.apple.com/be/podcast/dan-carlins-hardcore-history/id173001861?mt=2 . . . # Early Middle Ages (Yale) - https://itunes.apple.com/be/course/early-middle-ages/id519131977 . . . (Yale) - http://oyc.yale.edu/history-art/hsar-252 # Ancient Wisdom and Modern Love http://itunes.apple.com/us/itunes-u/ancient-wisdom-modern-love/id382669109 . . . # Ancient Greek History - http://itunes.apple.com/be/itunes-u/ancient-greek-history-audio/id341651987 . . . # Bill Viola Lecture at MIT - https://itunes.apple.com/be/itunes-u/arts-video/id387002909?mt=10 . . .
3K - last updated 2013-01-07 11:59 by Auriea
FieldRecordings
MySong http://www.quietamerican.org/ a great place to contribute sounds to: http://soundtransit.nl/ http://www.arteradio.com/wai/rubrique.do?num=17057 . . . very very coooool!! a (much too) . . . i need a new microphone. thus,... LJ:751903.html I am most interested in the OKM soundman . . . Music Mackowski André 79 RUE LESBROUSSART 1050 BRUSSELS BELGIUM tél. 0032 2 648.47.09 fax 0032 . . . 2 648.45.86}} ;) http://www.soundman.de/usa/usa.htm [http://sneaker.fm/setup-and-gear/] . . .
2K - last updated 2009-05-27 14:03 by Auriea
FiftyBooks
''see also: http://www.goodreads.com/user/show/5685418-auriea, FavoritePodcasts, FromLibrary '' ::: Murderous . . . of elsewhere. -- AnneCarson ::: == Read == ===2015=== # TheThingAroundYourNeck - ChimamandaNgoziAdichie . . . # [http://www.bibliomania.com/0/2/332/2435/28336/1/frameset.html The Wanderings of Oisin] - . . . - HarukiMurakami ===2005=== # AmericanPsycho == Didn't Finish == # '''[::Orlando] . . .
5K - last updated 2015-01-03 13:37 by Auriea
FiftyHeads
SketchBook ''see also: drawing, MasterCopy'' ===A challenge from CGTalk. To draw 50 heads in one month. . . .
1K - last updated 2006-07-03 23:29 by Auriea
FilamentList
[[3dPrinting]] <center>[[thumb:FilamentHeads|400px]]</center> <center>'''FILAMENT LIST'''</center> . . . Laybrick] ||heated bed necessary @50+/-, print temp: 140-165°C to get smooth, higher . . . rougher surfaces, slicing: object fill max. 25% the filament is brittle under 20°C, heat it and . . . to be tried. || || || PVA || ||to be tried. . . .
4K - last updated 2020-11-19 14:39 by 93-39-148-182.ip76.fastwebnet.it
FinalFantasy
[[Games]] <html><embed style="width:400px; height:326px;" id="VideoPlayback" type="application/x-shockwave-flash" . . . flashvars=""> </embed></html> . . . <html><object width="425" height="353"><param name="movie" value="http://www.youtube.com/v/Q02ompQhtY8&rel=1"></param><param . . . wmode="transparent" width="425" height="353"></embed></object></html> . . .
1K - last updated 2007-10-15 01:13 by Auriea
FiveRiversOfHades
There were five main rivers that appear both in the real world and the underworld. Their names were meant . . . to reflect the emotions associated with death.[5] * The Styx is generally considered to be one of . . .
3K - last updated 2019-12-11 12:46 by Auriea-Mercury
Flash
[[Reference]] ==''"The only HTML i need is the embed tag"''== I will begin again my learning of flash. . . . classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,0,0" . . .
2K - last updated 2007-05-05 13:47 by Auriea
FlashSettings
[[Flash]] http://livedocs.macromedia.com/flash/mx2004/main_7_2/wwhelp/wwhimpl/common/html/wwhelp.htm?context=Flash_MX_2004&file=00000484.html . . . configuring a web server for . . . Flash HTML settings</a>). . . . publish settings for . . . device fonts (static horizontal . . .
12K - last updated 2006-09-04 10:58 by Auriea
FlatFoot
==How to cure Flat Feet== strange because i'm sure i researched this before and there was nothing on . . . ** <html><iframe width="560" height="315" src="https://www.youtube.com/embed/QY5FW9BPbBg" . . . foot except the heel. Hold this stretch for 10-15 seconds and then do with right feet. Repeat the exercise . . . 5 times. # Sit on the floor with knees bend and hands . . . on the floor. Cramp the toes and hold it for 15 seconds. # Lift the left upper foot and rest it on . . .
3K - last updated 2016-05-14 19:05 by Auriea
Flickr
<html> <a data-flickr-embed="true" href="https://www.flickr.com/photos/entropy8/albums/72157669842528051" . . . src="https://farm8.staticflickr.com/7656/27966756936_1662544615_z.jpg" width="480" height="640" . . . title="Sunset"><img src="https://farm4.staticflickr.com/3906/14457304234_384a863716.jpg" . . . width="500" height="281" alt="Sunset"></a><script . . .
1K - last updated 2017-08-01 22:49 by Au-Mercury
Form2
[[3dPrinter]] Momus and Papposilenus eagerly await! [[thumb:2018-08-24_MagsFirstForm|350px]] LUC IS CURRENTLY . . .
1K - last updated 2018-10-08 22:06 by Au-Roma
FoundScripts
[[Empire]] http://www.naarvoren.nl/artikel/hover.html Pulldown Links with text description underneath . . . var winArgs = "top=50,left=50,toolbar=no,location=no,directories=no, status=no,menubar=no,scrollbars=no,resizable=no,copyhistory=no," . . . CHANGES Version 1.0 - Release version Version 1.5 - Tweaked a few boring bugs Version 2.0 - Complete . . . <img src="http://example.com/rotate.php"> 5. You can also specify the image to display like this: . . . $background_color = imagecolorallocate ($im, 255, 255, 255); $text_color = imagecolorallocate ($im, . . .
16K - last updated 2005-08-09 17:17 by AurieaHarvey
FourteenHolyHelpers
SaintChristopher and Saint Giles were invoked against the plague itself. Saint Denis was prayed to for . . . domestic animals|| ||Catherine of Alexandria ||25 November ||Against sudden death|| ||Christopher (Christophorus) . . . ||25 July ||Against bubonic plague and dangers while traveling|| . . . cancer and tuberculosis|| ||Vitus (Guy) ||15 June ||Against epilepsy, lightning and for protection . . .
2K - last updated 2017-09-05 12:11 by Au-Mercury
Framelessness
[[Simulation]] ==Equirectangularity== # I’ve got a 360 camera and It’s given me complicated thoughts . . . the reverence of the golden section. [[tube:MyFp5joAd7s 320 240 0]] . . .
1K - last updated 2018-12-05 22:22 by Au-Roma
French
[[Language]] FrenchClassNotes ==words i love== * '''ainsi''' Ainsi va la vie (Such is life) Ainsi soit-il . . . HER! ==new class 2008-2009== maandag 18.10-20.50 8/09/2008 29/6/2009 120 euro http://www.hetperspectief.net/index.php?id=198 . . .
1K - last updated 2009-01-27 00:11 by Auriea
FromLibrary
FiftyBooks ''see also: [[bibliotheek]], FiftyBooks, Books'' # [[Bib:Tintoretto]] # [[Bib:Kathe Kollwitz]] . . . Lampedusa [http://www.amazon.com/gp/product/0375714790?ie=UTF8&tag=morbanat-20&linkCode=as2&camp=1789&creative=9325&creativeASIN=0375714790] . . . * [http://www.asofterworld.com/bloody/index.php . . . Chapel Road by Louis Paul Boon] * William . . . * http://zoeken.bibliotheek.gent.be/?q=Amos+Tutuola . . .
2K - last updated 2015-10-18 12:14 by Auriea
Games
ElegantMedia == Definition == # I would say that all good art contains all the arts. # with videogames . . . cheats [http://www.mycheats.com/view/section/6153/6242/hotel_dusk_215/nintendo_ds] * Phoenix Wright . . . http://faqs.ign.com/articles/734/734985p1.html * Guild Wars ** wiki: http://gw.gamewikis.org/wiki/Main_Page . . . games * [http://ishi.blog2.fc2.com/blog-entry-158.html World Of Sand] http://fallingsandgame.com/viewtopic.php?t=1875 . . .
3K - last updated 2017-06-07 16:45 by Au-Mercury
GamesImLookingForwardTo
[[Games]] <html><object id="flashObj" width="486" height="412" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" . . . /><param name="bgcolor" value="#FFFFFF" . . . /><param name="flashVars" value="videoId=35247354001&playerID=22881388001&domain=embed&" . . . bgcolor="#FFFFFF" flashVars="videoId=35247354001&playerID=22881388001&domain=embed&" . . . you know, someone to share this with. [[tube:co-c5gPWfiM 320 240 0]] [http://imomus.livejournal.com/334948.html . . .
3K - last updated 2009-09-26 22:27 by Auriea
GardenArt
[[Botany]] http://www.vvork.com/wp-content/uploads/2007/08/ga.jpg http://www.icaphila.org/exhibitions/washburn.php . . . http://lord-whimsy.livejournal.com/208509.html http://lord-whimsy.livejournal.com/tag/organicism . . .
1K - last updated 2007-08-22 12:28 by Auriea
GawkerArtists
<html> <a href='http://d1.openx.org/ck.php?n=a4b76645&cb=12345' target='_blank'> <img . . . border='0' alt='' ></a> </html> . . .
1K - last updated 2009-04-08 14:39 by Auriea
GentRichards
CastOfThousands my sister Shari's husband of, i don't know, at this point, how many years, 16? 25? 200? . . . right now he lies in the hospital. at age 45. fighting that fight. it is moments like these when . . .
2K - last updated 2006-06-05 20:00 by Auriea
German
[[Language]] ==Hörspiel== bayern 2 Hörspiel Pool, right now it seems they are doing a lot of novels . . . I also like „lange nacht“ (these are 2 hour . . .
1K - last updated 2019-04-19 21:52 by Au-Roma
GoogleMaps
OutsideSomeplace <source> <script src="http://maps.google.com/maps?file=api&v=2&key=ABQIAAAA8gziLuG785smzT0a6REW3xSFtqeBGFMupH7NOyruGQrymP0yWxSFFVhoZ1mjmkxdzEiGTARy75-iVw" . . .
1K - last updated 2006-06-05 11:03 by Auriea
Graphic Novel
SketchBook ''To download in December'' Purgatory Kabuki (digital graphic novel by YasushiSuzuki] - http://www.dgnproduction.com/pk.html . . . http://cmars.250free.com/BarronStoryNotes.html [http://www.humano.com/bilal/ . . .
2K - last updated 2006-10-22 11:40 by Auriea
Greek
[[language]] http://www.ehow.com/how_2121195_learn-ancient-greek.html http://www.textkit.com/greek_grammar.php . . .
1K - last updated 2010-04-26 12:29 by Auriea
GreekTragedy
CreativeWriting * [[WikiPedia:Choerilus (playwright)|Choeriluĉs]] * [[WikiPedia:Aeschylus]] (c. 525–456 . . . (463 BCE) ** [[WikiPedia:The Oresteia]] (458 BCE, a trilogy comprising [[WikiPedia:Agamemnon]] . . . (tragic poet)|Phrynichus]] (~511 BCE): ** The Fall of Miletus (c. 511 BCE) ** Phoenissae . . . * [[WikiPedia:Achaeus of Eretria]] (484-c. 405 BCE) ** Adrastus ** Linus ** Cycnus ** Eumenides . . . Œdipus * [[WikiPedia:Achaeus of Syracuse]] (c. 356 BCE) * [[WikiPedia:Agathon]] (c. 448–400 BCE) . . .
3K - last updated 2011-01-26 01:33 by Auriea
GutaiManifesto
gutai art manifesto YOSHIHARA JIRŌ To today’s consciousness, the art of the past, which on the whole . . . Geijutsu Shinchō 7, no. 12 (December 1956), pp. 202–04. . . .
8K - last updated 2018-09-10 16:14 by 78-22-179-76.access.telenet.be
HDRI
[[Research]] what is HDR?[http://www.google.com/search?client=safari&rls=en-us&q=what%20is%20HDR&ie=UTF-8&oe=UTF-8] . . . http://www.flickr.com/groups/hdr/discuss/40580/ . . .
1K - last updated 2008-01-21 13:31 by Auriea
HandFan
[[Projects]] would like to make fans with varions uses and patterns ''see also: Books'' ==mooie waaiers . . . * Edo Fan - http://www.ei-net.city.edogawa.tokyo.jp/dentou/e/matsui/index.htm . . . Fan http://aic.stanford.edu/sg/bpg/annual/v05/bp05-04.html * Victorian fan card http://www.ruthannzaroff.com/mirkwooddesigns/fan.htm . . .
1K - last updated 2006-09-02 21:37 by Auriea
HemelSleutel
TuinPlanten http://www.missouriplants.com/Pinkalt/Sedum_telephium_page.html see also: Sedum [[thumb:2005-06-02 . . .
1K - last updated 2007-08-31 14:50 by Auriea
HiroshimaMonAmour
[[Quoth]] [[thumb:HiroshimaMonAmour-bookpageEN|250px]] [[thumb:HiroshimaMonAmour-bookpageEN2|250px]] . . .
1K - last updated 2005-11-19 20:14 by Auriea
History
<center>[[thumb:2019-12-11|frame|600px]]</center> Auriea Harvey b.1971 USA (Indianapolis)/EU . . . * 2017 Academia Belgica Artist Residency, 5 months in Rome * 2017 NoQuarter shows the Minorinth . . . Escalier/The Louvre, Paris'' * 2011,2013,2015 notgames Festival co-curator, Cologne Game Lab * . . . for Net Art] (the first ever given) * '''1995 [http://entropy8.com Entropy8.com]''' * 1995 Member's . . . ------- <center> [[thumb:2009-07-04|500px]] This site began on [[2004-06-20]] is Auriea's . . .
6K - last updated 2019-12-16 13:21 by Au-Elektra
HistoryOfMovingImages
[[Research]] phenakistiscope [http://www.mhsgent.ugent.be/engl-plat5.html] . . .
1K - last updated 2007-02-19 22:27 by Auriea
HomebrewDS
[[Games]] MakingDSGames latest firmware - http://dshere.com/ http://www.handheldsources.com/M3DS/Download_M3DSS.html . . . - http://boards.polycount.net/showthread.php?t=51691 * Blender export script - http://hackerpilot.org/dsblender.php . . . . . . ** skin files need to be .bmp format and saved . . . HOW TO install instructions!] . . .
5K - last updated 2010-10-06 10:27 by Auriea
HomepageContestJudging
ToDo ==2005== this year Michael and I are giving the prize for Best Homepage made by a Couple. http://art.teleportacia.org/1000$/page2.html . . . * 10 cents, coin, Bahamas, 1973 * 500 yen, coin, Japan * 2 dollars, coin, Hong Kong, . . . 1978 * 1 króna, coin, Iceland, 1992 * 25 cents, coin (commemorative, Connecticut), USA, 1999 . . . France, 1990 * 20 francs, coin, Belgium, 1981 * 5 francs, coin, Luxembourg, 1987 * 2 dollars, banknote, . . . USA, 1976 * 50 Piastres, banknote, Egypt * 3, 100 franc banknotes, . . .
2K - last updated 2007-05-29 13:29 by Auriea
HonorineJobert
TuinPlanten [[Gog:Honorine Jobert]] http://www.mobot.org/gardeninghelp/plantfinder/Plant.asp?code=B340 . . . Ranunculaceae Height: 3 to 4 feet Spread: 1.5 to 2 feet Bloom Time: August - September Bloom Color: . . . garden hybrid discovered in Verdun, France in 1858. ; Someone on LiveJournal wrote: 2. Anemone 'hybrida . . . accidentally discovered in Verdun, France, in 1858, 'Honorine Jobert' is a star of the fall garden. . . .
3K - last updated 2005-04-04 10:20 by Auriea
HorrorGameArticles
[[Games]] * interview with AkiraYamaoka and Christophe Gans about the Silent Hill Movie http://www.1up.com/do/blogEntry?bId=6605116&publicUserId=1002415 . . .
1K - last updated 2006-11-25 17:54 by Auriea
Hypnosis
[[Research]] <tt>'''Hypnotist thief hunted in Italy'''[http://news.bbc.co.uk/2/hi/europe/7309947.stm] . . . Recording] <html><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/nUFYJ2Nppfg&hl=en&fs=1&color1=0x2b405b&color2=0x6b8ab6"></param><param . . . type="application/x-shockwave-flash" . . . allowfullscreen="true" width="425" height="344"></embed></object></html> . . .
2K - last updated 2009-10-17 17:14 by Auriea
IULM
[[Projects]] GAME LAB: Studio for Experimental Asset Creation Professor AURIEA HARVEY M.A. IN GAME DESIGN . . . technical limitations. Or when to admit defeat. 5. To better understand what assets are necessary for . . . WEEK 1: Introductions - Come with a brief (5 min.) presentation of you and your work thus far. . . . its sights, sounds, smells. [[tube:PgCOH1W7tTg 560 315 0]] [[tube:ZYnS3kKTcGg 560 315 0]] WEEK 2: . . . that intimacy motion capture [[tube:a_AwDv9Al28 560 315 0]] WEEK 3: Landscapes WEEK 4: Time WEEK 5: . . .
4K - last updated 2017-09-22 13:55 by Au-Danae
Ikiru
[[tube:XjIZP5dMkl0 425 335 0]] . . .
1K - last updated 2007-07-21 12:26 by Auriea
ImmortalComputing
RandomIdeas ''see also: MemoriesWereMeantToFade, NothingEverDiesOnTheNet'' Microsoft is trying to patent . . . . . . But the patent application, filed in June 2005 and made public this month, at least shows that they've . . .
8K - last updated 2007-05-10 15:48 by Auriea
InSearchOfLostTime
FiftyBooks == ...in Proust the present is always absent. == # SwannsWay # -- # -- # -- # -- # -- # -- . . . GoodReads http://www.goodreads.com/group/show/75460-2013-the-year-of-reading-proust Final Reading . . . ----- [[image:2005-10-06_remembrance_of_things_past]] . . .
1K - last updated 2013-01-07 11:50 by Auriea
Indianapolis
OutsideSomeplace http://farm4.static.flickr.com/3518/3718279091_d2008057b9_b.jpg ==free wifi== * http://www.wififreespot.com/in.html . . . Abbey Coffeehouse - 825 N. Pennsylvania St. - (317) 269-8426 Ah Barista Cafe . . . Pain - 901 Indiana Ave Bjava Coffee and Tea - 5510 Lafayette Rd - 317 280 1236 Boulevard Place Caf� . . . - Butler Tarkington - 4155 Boulevard Place Broadripple (eWireless.com) - 6304 . . . Guilford Ave. - 316-536-0400 Buffalo Wild Wings - 8440 Castleton Corner . . .
4K - last updated 2020-04-06 17:14 by Auriea-Mercury
IndrasNet
[[Mythology]] http://www.heartspace.org/misc/IndraNet.html References to in Buddhism - http://www.cs.kent.ac.uk/people/staff/saf/networks/networking-networkers/indras-net.html . . . thunder and lightning. The Rig-Veda has about 250 hymns to Indra. It is Indra's lightning that reveals . . .
5K - last updated 2007-06-02 19:59 by Auriea
InsectsForGent
[[Projects]] [[image:MikeLibby-MechanicalInsect]] I would consider it to be my supriem gift to this town . . . that people come out at early morning hours 1-5am. to hear the symphony of mecahnical bugs. small . . .
1K - last updated 2007-01-16 11:51 by Auriea
InterMap
This is the intermap -- it lists all URL abbreviations for this site. Only the lines starting with exactly . . . . . .
2K - last updated 2015-08-07 17:35 by Auriea
InterviewsWithGameDesigners
[[Games]] * Tsutomu Kouno (Loco Roco) http://www.gamesindustry.biz/content_page.php?aid=25196 . . .
1K - last updated 2007-05-22 17:11 by Auriea
IsaacNewton
CastOfThousands ''i like the way this article reads{{clipped from: http://www.thehindu.com/opinion/op-ed/article827154.ece}}'' . . . he didn't like wasting his time. Born December 25, 1642, the great English physicist and mathematician . . . liaisons and may well have died, at the age of 85, with his virginity intact. “I never knew him to . . .
10K - last updated 2010-12-07 12:32 by Auriea
JadePlant
TuinPlanten [[thumb:2005-06-04 JadePlant|frame|right|I bought this at the plant store around the corner. . . . time and grow into small trees or shrubs up to 5 feet tall indoors.{{http://hgic.clemson.edu/factsheets/HGIC1507.htm}}'' . . . to the full sun. Jades are best grown between 55F at night and 75-80F during the day, however they . . . of bone meal added. The optimum soil ph is 6.5.Jade plants have an active and a dormant growing . . . from pot saucer. Fertilize with a 10-20-10 or 5-10-5 ratio soluble plant food every two weeks. African . . .
5K - last updated 2005-06-04 22:00 by Auriea
JaquesDerrida
CastOfThousands ==Derrida and Deconstruction== ''knip & plak from - http://130.179.92.25/Arnason_DE/Derrida.html'' . . .
17K - last updated 2005-10-23 20:39 by Auriea
Jitter
MaxMsp Jitter + Ogre = [http://www.cycling74.com/forums/index.php?t=msg&goto=168555&rid=0&S=8278e7f3ba1a06d814259eea9ff20297] . . . into MaxMsp http://jitogre.org/wiki/index.php5?title=Main_Page Ogre Blender exporter: http://www.ogre3d.org/forums/viewtopic.php?t=45922 . . .
1K - last updated 2009-06-26 14:36 by Auriea
JosephBeuys
CastOfThousands [[thumb:2006-06-05_The_Big_German_20h25|left|frame|150px|photos taken by Mike S. at MOMA . . .
1K - last updated 2006-06-05 20:33 by Auriea
JoyouKanji
[[日本語]] These are the 常用漢字 (Jouyou Kanji), which have been specified for use in schools . . . 機 積 録 観 類 験 願 鏡 競 議 ==Grade 5== 久 仏 支 比 可 旧 永 句 圧 弁 布 刊 . . .
10K - last updated 2005-06-22 11:37 by Auriea
JudasPenning
TuinPlanten [[Gog:Lunaria]] ooh, it turns into this! [[image:lunaria]] Family: Brassicaceae (brass-ih-KAY-see-ee) . . . Biennials Height: 24-36 in. (60-90 cm) Spacing: 15-18 in. (38-45 cm) Sun Exposure: Sun to Partial Shade . . . seedlings next season Soil pH requirements: 5.6 to 6.0 (acidic) 6.1 to 6.5 (mildly acidic) 6.6 . . . to 7.5 (neutral) Propagation Methods: From seed; direct . . .
1K - last updated 2007-01-05 12:32 by Auriea
KaardeBol
TuinPlanten http://oregonstate.edu/dept/nursery-weeds/weedspeciespage/teasel/flowers_2_250.jpg Common . . .
1K - last updated 2005-06-05 10:23 by Auriea
KanjiSKIP
[[日本語]] The SKIP method of identifying a Kanji that you can see but don't know how to pronounce. . . . First heard of it from this guy LJ:tithonus/525276.html ===Websites about it=== http://linear.mv.com/cgi-bin/j-e/tty/skip?SASE=/cgi-bin/j-e/tty/kanjidoc.html . . .
1K - last updated 2005-10-01 10:14 by Auriea
KasselDokFest-ArtistStatement
[[Example_No.22]] I was born in Indianapolis Indiana in 1971. After graduating high school, at age 18 . . . books, photo manipulations, drawings. But in 1995 the computer invaded me completely. I discovered . . . 8 videogames. Our first release was in 2005, multiplayer game “The Endless Forest” is still . . . Along with Cologne Gamelab, in 2011, 2013 and 2015 we curated “notgames Fest” which was a bi-annual . . . in 2014 and made our last videogame in 2015 with the release of political drama, “Sunset”. . . .
13K - last updated 2018-11-15 02:51 by Auriea.
Kinect
DigitalSculpture in addition to the main microsoft SDK you can install: * [https://developer.leapmotion.com/get-started . . . Speech recognition] ** [https://www.microsoft.com/en-us/download/details.aspx?id=43662 . . .
1K - last updated 2017-08-24 00:41 by Au-Danae
KrzesloKantora
<center>[[vimeo:229539717 160 120 0]][[vimeo:229539724 160 120 0]][[vimeo:229539728 160 120 0]][[vimeo:229539735 . . . 160 120 0]][[vimeo:229539738 160 120 0]][[vimeo:229539744 160 120 0]][[vimeo:229539751 . . . 160 120 0]][[vimeo:229539754 160 120 0]][[vimeo:229539763 160 120 0]][[vimeo:229539774 . . . 160 120 0]][[vimeo:229539783 160 120 0]][[vimeo:229539616 160 120 0]][[vimeo:229539621 . . . 160 120 0]][[vimeo:229539626 160 120 0]][[vimeo:229539633 160 120 0]][[vimeo:229539638 . . .
1K - last updated 2017-09-06 19:12 by Au-Mercury
KunstendecreetVisieMateriaal
||''P A S T''' || || <center>[[thumb:ToTGames|1020px]]</center> || ||My work with Tale of . . . ||'''EXHIBITIONS'''|| ||''V&A Museum, London . . . [[thumb:Example_No.22_install05|160px]] [[thumb:Example_No.22_install04|160px]] [[thumb:Example_No.22_install07|160px]]|| . . . frameborder="0" allow="autoplay; . . . src="https://sketchfab.com/models/e198edf528164788910136043bec0f78/embed" frameborder="0" allow="autoplay; . . .
5K - last updated 2019-02-26 00:56 by Auriea
LJCustomization
[[Reference]] Learning S2 http://www.livejournal.com/support/faqbrowse.bml?faqid=172 Tags http://www.livejournal.com/manage/tags.bml . . . Journal (lastn) -> styleid=596008 Day -> styleid=596315 Other People (friends) . . . -> styleid=596256 Time (calendar) -> styleid=596247 . . .
1K - last updated 2005-10-04 13:47 by Auriea
LaVitaNova-5
image/png
1518K - last updated 2021-02-23 12:34 by Auriea
La Vita Nova
[[thumb:LaVitaNova-1|700px]] [[thumb:LaVitaNova-2|700px]] [[thumb:LaVitaNova-3|700px]] [[thumb:LaVitaNova-4|700px]] . . . [[thumb:LaVitaNova-5|700px]] [[thumb:LaVitaNova-6|700px]] . . .
1K - last updated 2021-02-23 12:42 by Auriea
LambdaMOO
[[MOO]] telnet://lambda.moo.mud.org:8888 <pre> Store | West Bank---LambdaSt.---Street... | | Landing . . . Vaarg From: 2487@lambda.moo.mud.org Date: 2005年4月24日 09:00:00 GMT+02:00 To: auriea@telenet.be . . .
4K - last updated 2019-10-21 19:32 by Auriea.
LastFM
RssFeeds http://loczek.webd.pl/cover/?u=womanonfire&i=10&s=100 <html> <a href="http://www.last.fm/user/womanonfire/?chartstyle=basicrt10"><img . . . -20px;}.lastfmFoot a.config {width:85px;background-position: 0 -20px;}.lastfmFoot a.config:hover . . . a.view {width:74px;background-position:-85px -20px;}.lastfmFoot a.view:hover {background-position:-85px . . . 0;}.lastfmFoot a.popup {width:25px;background-position:-159px -20px;}.lastfmFoot a.popup:hover . . . {background-position:-159px 0;}</style> <div class="lastfmWidget"><div . . .
4K - last updated 2010-05-21 13:48 by Auriea
LastLifeInTheUniverse
[[Quoth]] http://film.indiefilipino.com/item.php?id=93 http://filmbrain.typepad.com/filmbrain/2004/05/found_in_transl.html . . . votes) iMDB Link: http://www.imdb.com/title/tt0345549/ Also Known As: Chikyû de saigo no futari (2004) . . . hours from now. 3 00:01:48,061 --> 00:01:51,940 Why do I want to kill myself? 4 00:01:52,781 . . . --> 00:01:55,170 I don't know... 5 00:02:01,861 --> 00:02:09,051 . . . No, not me. 10 00:02:20,661 --> 00:02:25,212 Many books say "Death is relaxing." 11 00:02:25,661 . . .
27K - last updated 2005-07-24 13:56 by Auriea
LeNombril
<html><iframe width="560" height="315" src="https://www.youtube.com/embed/Pw9ARZJf75U?ecver=1" . . .
1K - last updated 2017-07-31 23:50 by Au-Mercury
LearningToDrive
ProofOfMyExistence ==internationaal rijbewijs== * http://www.gent.be/eCache/THE/412.cmVjPTM3NzYw.html . . . http://www.rijschoolah.be/infotheorie.asp 125 Euro = "Wie zich via onze rijschool op dit examen . . . ==Rijbewijs== http://www.gent.be/eCache/THE/1/265.cmVjPTM4NDgx.html http://www.goca.be/nl/p/rijbewijs . . .
1K - last updated 2014-09-16 15:45 by Auriea
Lendelede
OutsideSomeplace where Michael's parents live http://farm5.static.flickr.com/4147/4982248862_b69c67199a_b.jpg . . .
1K - last updated 2010-09-13 10:07 by Auriea
LeonardoDaVinci
RssFeeds [[thumb:DaVinci-opus1]] [[thumb:DaVinci-opus2]] Draings of LDV - http://www.visi.com/%7Ereuteler/leonardo.html . . . <rss 15 http://interconnected.org/home/more/davinci/2004-05-30.rss> . . .
1K - last updated 2008-05-06 10:33 by Auriea
LetsMakeAVideogame
[[tube:-LCHPrRZA3s 425 350 0]] . . .
1K - last updated 2014-05-30 12:35 by Auriea
LifeDrawing
[[Drawing]] ''see also: drawing, anatomy, LeonardoDaVinci, CaproniCasts, SightSize'' ''also! also!: http://atelierauriea.tumblr.com/'' . . . door de aanwezigen. . Vooraf aanmelden (0475.65.39.11) maakt het ons organisatorisch makkelijk. . . . - [http://www.cgtalk.com/showthread.php?t=253289&page=1&pp=15 Lesson 1: Gesture Drawing]{{Gesture . . . . . .
4K - last updated 2014-09-29 17:47 by Auriea
Ling
'''Nicci-Ling Levka Almere de la Perla de las Esmereldas van Gent''' b. [[04-15-2014]] to [http://www.katten-enzo.nl/2014-Delphine-Vladimir.htm . . . Delphine & Vladimir] [[thumb:2014-10-17|500px]] ----- <html><iframe src="//instagram.com/p/qcQhjsFiQk/embed/" . . .
2K - last updated 2014-11-13 15:33 by Auriea
Linux
[[Reference]] ==Vanilla Ubuntu== ===Links=== * https://www.infofuge.com/how-to-install-ubuntu-18-04-on-microsoft-surface-book-2/ . . . * to get it running on Surface Book - https://github.com/jakeday/linux-surface . . .
4K - last updated 2020-01-07 20:15 by Au-Elektra
LliWilburn
CastOfThousands [[thumb:Lli93|500px]] http://www.pernoctalian.com/~lli/art/ http://pernoctalian-sketchbooks.net/ . . .
1K - last updated 2009-01-22 21:28 by Auriea
LocalNames
These are LocalNames for external links. whenever your use them they will be automatically linked. <tt> . . . . . .
2K - last updated 2014-01-21 13:54 by Auriea
LocationLocationLocation
<html> <head> <meta charset="utf-8" /> <meta http-equiv="X-UA-Compatible" content="IE=edge" . . . always face you." look-at="[gps-camera]" scale="50 50 50" gps-entity-place="latitude: 41.905480; longitude: . . . 12.458780;" ></a-text> <a-camera gps-camera . . .
1K - last updated 2020-03-27 16:05 by Auriea-Mercury
Lodewijk
[[thumb:2014-11-12|500px]] Lodewijk Casper Khalo van Gent a.k.a. Louis (quatorze) a.k.a. Leo or Lou a.k.a. . . .
1K - last updated 2014-11-13 15:35 by Auriea
LouiseBourgeois
CastOfThousands [[image:Louise]] 25/12/1911- 31/05/2010 [[Img:Louise Bourgeois]] http://www.deutsche-bank-kunst.com/art/2004/9/e/1/293.php . . .
3K - last updated 2010-06-01 19:24 by 78-21-207-92.access.telenet.be
LudisiaDiscolor
TuinPlanten the plant given to me by Lina. needs to be put in a terrarium. * http://www.speciesorchids.com/ludisiaDiscolor.html . . . * Gog:Ludisia_Discolor . . .
1K - last updated 2009-02-10 12:01 by Auriea
MacBookPro
[[Empire]] ''see also: OsX, emulation'' [http://www.ifixit.com/Guide/Repair/MacBook-Pro-15-Inch-Core-2-Duo-Model-A1211-Hard-Drive-Replacement/459/1 . . . card=== http://forum.onmac.net/showthread.php?p=5704&posted=1#post5704 ===Parallells Shite=== http://forum.parallels.com/showthread.php?t=6768&page=5&highlight=Tools+Boot+Camp . . .
1K - last updated 2010-06-24 15:17 by Auriea
MagdaleneEtching
[[image:MagdaleneEtchingStates]] <center>Magdalene, 2015 hard and soft ground etching with drypoint . . . image size 19.5 x 29 cm</center> ----- this was a series made . . .
1K - last updated 2017-03-28 19:54 by Au-Danae
MakeClothes
Blender3D http://workflows.grailmedia.com/makeclothes/ Step 1: Set up MakeClothes Open Blender Press . . . Select both New Shirt and Mannequin layers Step 5: Model your clothing Select New Shirt Go to Edit . . .
3K - last updated 2017-07-17 20:07 by Au-Roma
MakingDSGames
HomebrewDS http://forums.cgsociety.org/showthread.php?p=4727543 <source> Polycount per character . . . polys in the view of camera, but generally 300-500 tris per character is ok. Total limit of tris rendered . . . frame is about 2000. You can have texture size 256 but its not worth it because usually characters . . . due to its size so, 64 or 128 texture plus 300-500 tris, 20-24 bones per character - just right. I . . .
2K - last updated 2007-10-23 22:04 by Auriea
MamaDoris
CastOfThousands [[flash:http://auriea.com/live.swf?thePic=http://keystrokes.org/Webcam.jpg&|160|120|#000000|best|exactfit]] . . . me its offkey but..) Made a wikisite for her 2005-04-06 http://keystrokes.org/index.pl . . .
1K - last updated 2010-05-21 13:37 by Auriea
MamiyaC3
[[photography]] http://farm3.static.flickr.com/2134/2509929964_44896b16bc.jpg . . .
1K - last updated 2009-01-05 00:31 by Auriea
MarcelDuchamp
CastOfThousands Michael named his son after him. http://www.toutfait.com/issues/volume2/issue_5/articles/gerrard/gerrard.html . . .
1K - last updated 2006-07-09 22:38 by Auriea
MargueriteDuras
CastOfThousands [[thumb:MD|left]] from:http://www.france.diplomatie.fr/label_france/ENGLISH/LETTRES/DURAS/duras.html . . . figure. The mother figure in The Sea Wall (1950) can be found thirty years later in The Lover, always . . . writings of Pierre Loti."{{Pierre Loti (1850-1923): Naval officer and impressionist novelist . . . apparent when she published The Sea Wall, in 1950, a shortlisted novel with which she narrowly missed . . . the French Communist Party, which she left in 1950, after the Prague Uprising. She did not publish . . .
11K - last updated 2010-04-15 09:56 by Auriea
MarinaAbramovicAndUlay
CastOfThousands '''Abramovic, Marina; Ulay''' '''The Lovers – The Great Wall Walk''' ''The earth is . . . [http://catalogue.montevideo.nl/art.php?id=8754] He begins in the Gobi Desert and I begin at the . . . <html> <object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/VzelB74BJfI&color1=0xb1b1b1&color2=0xcfcfcf&hl=en_US&feature=player_embedded&fs=1"></param><param . . . allowScriptAccess="always" width="425" height="344"></embed></object> </html> . . . Gog:Abramovic <html> <object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/zOuzzzltSOA&color1=0xb1b1b1&color2=0xcfcfcf&hl=en_US&feature=player_embedded&fs=1"></param><param . . .
3K - last updated 2012-09-22 20:01 by Auriea
MarmosetToolbag
[https://marmoset.co/posts/the-toolbag-baking-texturing-and-rendering-handbook/?utm_source=Marmoset+Newsletter&utm_campaign=74be762255-Email_Newsletter_22_Steph_Handbook&utm_medium=email&utm_term=0_5665c2c57f-74be762255-318423917&ct=t(Email_Newsletter_22_Steph_Handbook)&mc_cid=74be762255&mc_eid=81735d17a5 . . .
1K - last updated 2022-06-13 13:49 by Auriea
Martha
CastOfThousands [[background external:http://farm4.static.flickr.com/3182/2910930013_cb3490c72b.jpg|repeat . . . http://farm4.static.flickr.com/3200/2836838413_11cb9c931f_b.jpg . . . http://farm4.static.flickr.com/3092/2636567843_6ef05fd885_b.jpg . . . http://farm4.static.flickr.com/3235/2700984718_9ec18476e5_b.jpg . . .
1K - last updated 2010-04-15 09:53 by Auriea
MarvelsOfThingsCreatedAndMiraculousAspectsOfThingsExisting
[[mythology]] A large animal, possibly big as an elephant which roams the perimeter of the world. His . . . deer dance or cry. ----- [[thumb:Sadawaar|frame|250px|right|Translation: SADAWAAR- This Animal lives . . . LJ: http://www.livejournal.com/users/womanonfire/589128.html '''''Excerpts''''' ''The animal described . . .
4K - last updated 2006-07-09 23:14 by Auriea
MaryMagdalene
ThreeMarys [https://www.biblegateway.com/passage/?search=Luke%208:2 Luke 8:2], [https://www.biblegateway.com/passage/?search=Mark+16%3A9&version=NIV . . . [https://en.wikipedia.org/wiki/Matthew_27:55-56 Matthew 27:56], [https://www.biblegateway.com/passage/?search=Mark+15%3A33-40&version=NIV . . . Mark 15:40], [https://www.biblegateway.com/passage/?search=John+19%3A25&version=NIV . . . John 19:25] (at crucifixion); [https://www.biblegateway.com/passage/?search=Matt.27.61 . . . Mark 15:47] (at burial); [https://www.biblegateway.com/passage/?search=John+20%3A14-18&version=NKJV . . .
6K - last updated 2017-03-28 18:58 by Au-Danae
MassExtinction
[[Reference]] Earth’s five previous mass extinctions End-Ordovician, 443 million years ago A severe . . . almost all corals. Permian-Triassic, c 250 million years ago The big one – more than 95% . . . for dinosaurs to flourish. Cretaceous-Tertiary, 65 million years ago An giant asteroid impact on Mexico, . . .
2K - last updated 2017-07-11 02:06 by Au-Roma
MaxMspJitter
VisualProgramming realtime audiovisual programming. ''see also: MySong, DigitalSculpture, RealTime'' . . . src="https://player.vimeo.com/video/13149959" width="500" height="281" frameborder="0" webkitallowfullscreen . . . . . . http://www.mat.ucsb.edu/~whsmith/xray.html . . . . . .
4K - last updated 2017-04-18 19:34 by Au-Mercury
MeAt25
image/jpeg
76K - last updated 2009-02-03 01:49 by Auriea
MediumFormat
[[photography]] http://farm4.static.flickr.com/3220/2511129142_9f8bf66ac0_o.jpg http://farm3.static.flickr.com/2321/2539059861_0ace5a9b75.jpg . . . http://farm3.static.flickr.com/2134/2509929964_70090a1737_o.jpg http://silverbased.org/load-120-film/ . . .
1K - last updated 2010-07-05 17:49 by Auriea
MedusasMirror
[[Projects]] project where i make a webcam application in max.msp.jitter. on second version already: . . . [http://www.renaissanceastrology.com/chartweek6-15-07.html Magic Mirrors], Gog:Spiritus+Mundi, etc. . . .
1K - last updated 2007-06-04 19:31 by Auriea
MemoriesWereMeantToFade
RandomIdeas ''see also: abyss, ImmortalComputing, NothingEverDiesOnTheNet'' * http://www.vmsweb.net/attachments/pdf/Useful_Void.pdf . . . By Nate Anderson | Published: May 09, 2007 - 08:52AM CT The rise of fast processors and cheap storage . . . | News | PC Pro http://www.pcpro.co.uk/news/362527/people-have-right-to-be-forgotten-online-says-eu#ixzz14QaGssYY . . .
4K - last updated 2010-11-05 18:53 by Auriea
Metropolis
<html><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/DukMPx6Fn_c&hl=en&fs=1&color1=0x2b405b&color2=0x6b8ab6"></param><param . . . type="application/x-shockwave-flash" . . . allowfullscreen="true" width="425" height="344"></embed></object></html> . . .
1K - last updated 2009-06-11 11:38 by Auriea
MexicoCity
OutsideSomeplace ==2014== In Mexico City there are a number of activities that may be appealing to them. . . . . . . . . .
2K - last updated 2014-09-29 11:55 by Auriea
Minorinth
[[Simulations]] <center>[[vimeo:302579640 640 360 0]] '''VR Labyrith exploration, for a 4x4 meter . . . [[thumb:Minorinth-scrn5|400px]] [[thumb:Minorinth-scrn6|400px]] [[thumb:Minorinth-scrn7|400px]] . . .
2K - last updated 2020-12-29 00:57 by Auriea
Minorinth-scrn5
image/jpeg
1507K - last updated 2018-09-29 19:53 by Auriea
MoederKruid
TuinPlanten '''early spring 2006:''' It didn't fair too well end of last summer. it was swarmed by bugs . . . my self portrait. [[thumb:SelfPortraitSummer2005|frame|right|200px|"Summer Self Portrait" finished . . . a tribute to the first year of my garden (2005) Note the aphids, there were plenty of them, I hope . . .
4K - last updated 2006-03-18 16:57 by Auriea
Murakami interview1
[[Quoth]] from: http://www.salon.com/books/int/1997/12/cov_si_16int.html BY LAURA MILLER | The heroes . . . poison gas attack on a Tokyo subway in March 1995. Murakami says this reassessment began during the . . . living in the States! I was here from 1991 to 1995, which was when I was writing this book. That's the . . . I have had my very loyal readers in these 15 years or so. They're buying my books, and they're . . . attack on the subway train in Tokyo in March 1995. I interviewed 63 victims who were on the train that . . .
20K - last updated 2005-08-09 17:17 by AurieaHarvey
Murakami interview2
[[Quoth]] from: http://www.sundayherald.com/46885 '''Found in translation''' Haruki Murakami writes about . . . He looks compact and fat-free; the healthiest 55-year-old in the world, give or take. This is a man . . . rites-of-passage story. The book is about a 15-year-old runaway beset by mythic, surreal and metaphysical . . . But they are also myself. When I write about a 15-year old, I jump, I return to the days when I was . . . I guess,” he says, eventually. “I am 55 years old now. It takes three years to write one . . .
16K - last updated 2005-10-21 13:52 by Auriea
MushroomSoup
[[Food]] 1 lb. fresh mushrooms 2 c. onions 1 1/2 tsp. sugar 3 tbsp. flour 1 c. cold water 1 can chicken . . . until blended. Add can of soup and simmer for 15 minutes. Just before serving, stir in cream. . . .
1K - last updated 2006-12-20 15:40 by Auriea
MuziekLes
MySong i will take music lessons in the summer. i want to better understand the music i love so much. . . . 17, 9000 Gent <html> <iframe width="425" height="350" frameborder="0" scrolling="no" marginheight="0" . . . . . . . . . Tel 09.225.04.79 Fax 09.233.54.03 muziekacademie.gent@pantarhei.be . . .
2K - last updated 2007-10-07 20:47 by Auriea
MySong
[[Projects]] ==instruments== * MU Midi Controller Wacom instrument - http://www.musicunfolding.com/MU_MIDI_Controller.html . . . Rossi [http://www.myspace.com/annirossi] Track 15! very vocal * Konono [http://www.crammed.be/konono/] . . . * tips http://www.apple.com/support/garageband/hottips/ . . .
5K - last updated 2018-09-10 17:47 by Auriea.
MyTopOneHundredSongsOfAllTime
SongBook upon a dare from LJ:hiphopdiary http://hiphopdiary.livejournal.com/488494.html?nc=5&style=mine . . . Called Quest # Nature Boy / Nat King Cole # 52 Girls / The B-52s # I Did It Just The Same / Eurithmics . . . Rakim # Happy and Bleeding / PJ Harvey my top 25 albums because i love them best in their entirety. . . .
5K - last updated 2006-12-15 12:13 by Auriea
NET.ARCHEOLOGY
I was online from the “beginning” and first made a reputation as a web designer/net artist in 1996. . . . the SFMOMA in 2000 https://www.nytimes.com/2000/05/12/technology/couple-wins-30000-online-art-award.html . . . https://www.flickr.com/photos/entropy8/albums/72157600005384815 It was a web browser, a parser, which . . . p.s. kiss.entropy8zuper.com https://vimeo.com/365031 https://www.flickr.com/photos/entropy8/albums/72157594500928662 . . .
4K - last updated 2021-01-25 13:00 by Auriea
NegusPoem1and2
SongBook NEGUS POEM 1&2 sleep in my eye but still I gotta rise we wind thru cycles of time yet we . . . divine! real negus never die [[tube:awZQryp7v_I 560 315 0]] -KeiyaA . . .
1K - last updated 2020-09-03 10:33 by Auriea-Nero
NewYearsResolutions
ProofOfMyExistence i want to believe that these can be constructive.... lets try. the wording is probably . . . up some money ==2016== * swim two times a week * 5 year plan * grad school (what would it take to do . . . brown people * Italy * discover MY 3d art ==2015== * to get up earlier in the morning (9:00am at the . . . shadow!, (subtle) lipstick colors! * to read 25 complete books. * to strategize for the future. * . . . lots of inner uneasiness to sort through. ==2005== # figure out ways to feel less like a caged animal. . . .
6K - last updated 2018-01-01 15:56 by Au-Mercury
NiceanCreed
[[Mythology]] THE CREED OF NICAEA - AGREED AT THE COUNCIL IN 325 Πιστεύομεν εἰς ἕνα . . .
4K - last updated 2018-12-28 12:58 by Au-Mercury
Nihonga
Outline of "Nihonga"-Traditional Japanese Painting Nihonga is one of the painting styles of Japapn. Fumiyo . . . first developed in the Heian period (794-1185) and an important element of imperial-court painting . . . into the medieval period (1105-1573). Yamoto-e was a major influence on subsequent . . . Japanese painting in the Edo period (1615-1868) that was influenced by Western painting techniques, . . . done by Japanese artists between 1868 and 1945 using Western perspective and chiaroscuro, and working . . .
17K - last updated 2010-01-29 18:16 by Auriea
NoQuarter
''for screenshots see: [[Minorinth]]'' ==Working Title: MINORINTH/LABYTAUR== <center>[[thumb:Minorith-lookfeel|600px]] . . . ===Conceptual=== * [[vimeo:130888009 560 315 0]] * [[tube:O0VIxubUu4c 560 315 0]] ===Technical=== . . . * Seeing into the real [[tube:wD841MM6IvY 560 315 0]] '''but just make the chaperone really small . . . frameborder="0" allowvr allowfullscreen . . . href="https://twitter.com/timescanner/statuses/502510901707038722">August 21, 2014</a></blockquote><script . . .
6K - last updated 2018-09-29 23:01 by Auriea.
NorwegianWood
FiftyBooks A life is filled with connections to many people some strong, some weak connections. This . . . http://www.livejournal.com/users/womanonfire/645911.html So yeah, today I was stuck at a "thing" with . . .
3K - last updated 2006-06-15 20:50 by Auriea
ObjectSeries
[[Sculpture]] * [[Object 01]] - head * [[Object 02]] - Magdalene * [[Object 03]] - the cup * [[Object . . . 04]] - StJTB * [[Object 05]] - XLVI and a day * [[Object 06]] - Twins * [[Object . . .
1K - last updated 2018-09-13 15:43 by Au-Mercury
Object 01
ObjectSeries <center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" . . . . . . <center>cm:3.07 x / 5.316 y / 3.696 z in:1.209 x / 2.093 y / 1.455 z<BR> . . . <center><html><iframe width="625" height="652" frameborder="0" allowfullscreen allowtransparency . . . <center><html><iframe width="560" height="315" src="https://www.youtube.com/embed/4VRe_OXnLGs?rel=0" . . .
1K - last updated 2017-02-27 14:08 by Auriea
Object 02
ObjectSeries <center><html><nobr><div class="sketchfab-embed-wrapper"><iframe . . . src="https://sketchfab.com/models/3d471d09451d46188b617228bdc0f47b/embed?autostart=1&camera=0&transparent=1&ui_related=0" . . . src="https://sketchfab.com/models/1a43c5fc8b0e4c39bace1891570f5684/embed?autostart=1&camera=0&transparent=1&ui_related=0" . . . (regrets)</center> <center> height 7.5 cm '''[https://www.shapeways.com/shops/zauriea ORDER . . . ''[https://www.patreon.com/posts/object-02-8598651 supported by Patreon]''</center> ----- . . .
6K - last updated 2017-03-28 19:42 by Au-Danae
Ocean
[[Quoth]] ''see also: sea'' [[image:VijaCelmins_ocean]] ''Call me Ishmael. Some years ago -- never mind . . . src="http://player.vimeo.com/video/15341669" width="400" height="225" frameborder="0"></iframe></html> . . .
2K - last updated 2010-11-26 13:27 by Auriea
OnNotWinningTheNobelPrize-DorisLessing
[[Quoth]] Nobel Lecture December 7, 2007 On not winning the Nobel Prize I am standing in a doorway looking . . . stumps, and charred remains of fires where in '56 was the most wonderful forest I have ever seen, . . . the magnificent Pamuk. He said his father had 1 500 books. His talent did not come out of the air, . . .
27K - last updated 2007-12-09 23:39 by Auriea
OntwikkelingsgerichteBeurs
ProofOfMyExistence [[thumb:2013-01-18|frame|150px|right|no comment.]] ''see also: ArtSchool'' . . .
1K - last updated 2018-09-10 13:04 by Auriea.
Ophelia
FataleVrouwen LJ:womanonfire/2005/12/15 All humans in the game are like apparitions. So remember, she . . .
3K - last updated 2007-11-12 14:20 by Auriea
Orchids
==Orchidaceae Phalaenopsis== [[image:2012-08-27 orchid]] PHALAENOPSIS (fal-en-OPP-sis) - These plants . . . we do. The minimum temperature at night is 60-65 °F, while the average daytime temperature should . . . be around 75-85 °F. Occasional deviations will not harm your . . . enjoy moist air, with a humidity level of 55-75% being ideal. Placing your plant over a tray . . . Wilma and Brian Rittershausen ----- [[thumb:2005-06-28 orchids|frame|right|150px|Received yet another . . .
4K - last updated 2012-08-27 11:55 by Auriea
Orion
[[Research]] the one constellation i can find in the night sky always.... i used to imagine him a real . . . '''Aurora and Orion''' ''Credit: NASA, STS-59 Crew.'' '''Explanation:''' Looking toward the south . . .
1K - last updated 2005-06-21 10:19 by Auriea
OsX
[[Reference]] ==Samba performance under Mac OS X== <source> I have a NetBSD/i386 3.0 file server . . . in the volumenames then put it between quotes!) 5. Reboot your computer and boot in Windows. Now copy . . . (active) or next window behind it "Control-F5" = Full Keyboard Access Highlight Toolbar "Control-F6" . . . Highlight Utility window (palette) "Command-F5 or fn-Command-F5" = Turn VoiceOver on or off (Mac . . . "6" = Move Right "1, 3, 7, 9" = Move Diagonally "5" = Press Mouse Button "0" = Hold Mouse Button ". . . .
13K - last updated 2008-10-31 17:04 by Auriea
Ouendan
[[Games]] I love playing games on my DS. Its the perfect way to play for me. I don't have much time to . . . for the Nintendo DS handheld game console in 2005, for release only in Japan. Ouendan stars a cheer . . .
6K - last updated 2007-06-08 22:57 by Auriea
Ovid-CadmusHarmonia
[[Quoth]] '''[[Ovid]] Metamorphoses Book IV:563-603 Cadmus and Harmonia become serpents''' The son of . . .
3K - last updated 2015-10-07 10:30 by Auriea
PaidInFull
SongBook Thinkin of a master plan Cuz ain't nuthin but sweat inside my hand So I dig into my pocket, . . . great! so maybe I might just Search for a 9 to 5, if I strive Then maybe I'll stay alive So I walk . . .
1K - last updated 2005-06-21 10:54 by Auriea
Painter
[[Reference]] to get Painter 6 to run on modern system: http://dev.depeuter.org/metacreations_fix_30.php . . . from RIFF files. Corel Painter can store up to 65536 levels of impasto depth information per layer . . . * 4; RIF use 4 bytes per pixel (ARGB sequence) 5) in Winhex, copy the block containing the bump image . . . ) bufferc = file.read ((w * h * 4)-1)+chr(255) file.seek ( bumpstart ) bufferb = file.read (w . . .
7K - last updated 2015-10-17 15:12 by Auriea
Painting
[[Projects]] This page collects pages on my painting. ([Self:action=rss;rcfilteronly=%5e%5cd%5cd%5cd%5cd-%5cd%5cd-%5cd%5cd.*painting . . .
1K - last updated 2018-08-15 19:34 by Au-Mercury
Paris
OutsideSomeplace ==Next time== * http://www.bourdelle.paris.fr/en * another trip to musee moreau (recently . . . 19 October 2010 - 23 January 2011 Musée . . . http://www.musee-orangerie.fr/homes/home_id25184_u1l2.htm ------ Vanitas exhibition! until June . . . ------ From Ashes, Reviving a Place of Wild Dreams . . . http://www.nytimes.com/2008/11/15/arts/design/15taxi.html By ELAINE SCIOLINO Published: . . .
6K - last updated 2015-02-02 16:56 by Auriea
Passport
ProofOfMyExistence Dear Ms. Harvey: To issue a certificate of Nationality, we would have to see your . . . ---- i sent away for the new passport by mail . . . valid for 10 years issued within the last 15 years; and * You are not requesting a change in the . . . form ! * Enclose two recent identical 5x5 cm passport size photos (see list of specialized . . . * Enclose a self-addressed envelope with a € 5 postal stamp so that we may return the passports . . .
5K - last updated 2008-09-08 11:47 by Auriea
PataX
[[Research]] http://en.wikipedia.org/wiki/Alfred_Jarry Shoplifted from LibFoam:PataX LibFoam:pataphysics . . . http://anaximandrake.hautetfort.com/archive/2005/03/16/elements_de_pataphysique.html I actually prefer . . . . . .
7K - last updated 2008-10-31 00:04 by Auriea
PeachPlumPear
SongBook We speak in the store I'm a sensitive bore and you're markedly more and I'm oozing surprise . . . classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=7,0,0,0" . . .
2K - last updated 2007-10-29 00:33 by Auriea
PerfumeTheStoryOfAMurderer
[[tube:cjxe3hVkNrU 425 335 0]] [[tube:Xcx1UU9fSrI 425 335 0]] . . .
1K - last updated 2007-07-21 12:27 by Auriea
PeterHenryEmerson
CastOfThousands ''see also: photography, ElegantMedia, history'' http://www.ssplprints.com/category.php?catid=1184&page=2&numperpage=8 . . . http://en.wikipedia.org/wiki/Peter_Henry_Emerson . . . http://www.metmuseum.org/toah/hd/ipic/ho_1994.520.2.htm http://news.bbc.co.uk/2/shared/spl/hi/pop_ups/06/in_pictures_peter_henry_emerson_/html/1.stm . . .
1K - last updated 2010-05-27 12:22 by Auriea
Photogrammetry
[[3D]] ''see also: PhotogrammetryFromVideo'' <html> <iframe width="640" height="480" src="https://sketchfab.com/models/0aaf3716c92b4ffeba39ac82319b7d55/embed" . . . 13px; font-weight: normal; margin: 5px; color: #4A4A4A;"> <a href="https://sketchfab.com/models/0aaf3716c92b4ffeba39ac82319b7d55?utm_source=oembed&utm_medium=embed&utm_campaign=0aaf3716c92b4ffeba39ac82319b7d55" . . . target="_blank" style="font-weight: bold; color: . . . target="_blank" style="font-weight: bold; color: . . .
2K - last updated 2017-05-30 19:08 by Au-Mercury
Photoshop
[[Reference]] ***44 Photoshop Tricks & Tips By - Xing Wei 1. Press Tab will hide tool bar and palette, . . . Shift+double click will open up the browser. 5. Sick of the default grey background around your . . . change the % for image in navigator window. 15. When Using eyedropper tool to capture foreground . . . Ctrl+Shift+D to reselect what you deselected. 25. While selecting with Marquee tool, press space bar . . . "Auto select layer" and "Show bounding box". 35. While Move Tool is selected, hold Shift (Alt+Shift+Right . . .
6K - last updated 2007-12-20 14:06 by Auriea
PlayForm
links to dreams: # [http://preview.playform.io/create/result/NDA0K2FyY2hhaWMgc2VycGVudGluYXRh Archaic . . . # [http://preview.playform.io/create/result/NDE5K0Nyb3VjaGluZyBWZW51cw== Crouching Venus] # [http://preview.playform.io/create/result/NDI0K3BhbGlzc3kgb2YgdGhlIGFlZ2Vhbg== . . . scholars nagel] # [http://preview.playform.io/create/result/NTMxK05hZ2VscyBSb2Nr . . .
2K - last updated 2019-08-13 10:32 by Auriea
PopularCulture
[[Quoth]] ''Excerpts{{lifted from http://pubpages.unh.edu/~dml3/880williams.htm}} from Raymond Williams{{linked . . . by LJ:imomus/75005.html}}, '''Keywords'''''{{Rev. Ed. (NewYork: Oxford . . . meaning, and later culture, which by eC15 had passed into English. The primary meaning was . . . Bacon: 'the culture and manurance of minds (1605); Hobbes: 'a culture of their minds (1651); Johnson: . . . neglected the culture of her understanding (1759). At various points in this development two crucial . . .
20K - last updated 2005-01-09 15:48 by Auriea
PorgyAndBess
OldManSorrow from http://www.neh.gov/news/humanities/1997-11/porgy.html ===The Complicated Life of Porgy . . . much of its African heritage. Even in 1925, the novel evoked an aura of strangeness, of the . . . the music, from February 1934 to January 1935, and nine more months orchestrating it. The collaboration . . . reaction to Porgy and Bess at its premiere in 1935, was decidedly mixed. The New York Times had three . . . himself said in the New York Times in 1935: Because Porgy and Bess deals with Negro Life in . . .
28K - last updated 2004-08-16 21:10 by wof
Prado
[[Madrid]] <html><img src=http://www.auriea.org/data/static/2010-02-19.jpg> Velazquez <3 . . . . . .
3K - last updated 2010-02-24 16:30 by Auriea
Prague
OutsideSomeplace little trip we decided to take summer, july 2010 with the kids. <html> <iframe . . . </html> . . .
1K - last updated 2012-06-07 15:49 by Auriea
PreComputationalGenerativeSystemsInArt
ElegantMedia * Underweysung der Messung, mit dem Zirckel und Richtscheyt, in Linien, Ebenen unnd gantzen . . . did some quite insane geometry tutorials in 1525. * There were many musical games/toys. Mozart did . . . Museum, pretty: http://www.flickr.com/photos/85009674@N00/3037607129/ * And the Aolian harp, beloved . . . system (1822) quadrille melodist (1865) * in literature: Georg Philipp Harsdörffer: "Fünffacher . . . Denckring der Teutschen Sprache" (1651) a permutative scheme for generating poetry the . . .
3K - last updated 2009-10-13 10:53 by Auriea
PrikNeus
TuinPlanten [[thumb:PrikNeusGroeiPatron|120px]][[thumb:2005-06-22 PrikneusInBloom|250px]] . . .
1K - last updated 2005-12-19 16:41 by Auriea
PrintersSpreads
[[Books]] [20|01], [02|19], [18|03], [04|17], [16|05], [06,15], [14|07], [08|13], [12|09] and [10|11] . . .
1K - last updated 2009-06-25 09:18 by Auriea
ProjectProject
<center> [[thumb:2019-12-13|600px]] '''OPENING Friday the 13th December 2019''' '''DEATH HAS A . . . [[thumb:SightTableSimulation1|500px]] [[thumb:SightTableSimulation2|500px]] [[thumb:ProjectProject_InstallationView1|500px]] . . . [[thumb:ProjectProject_InstallationView2|500px]] </center> Resources * https://www.mtrldsgn.com/services . . . Galaxy PLA] by Form Futura but any will . . . . . .
3K - last updated 2019-12-30 19:28 by Au-Elektra
ProjectProject Cyclops
<html> <model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/Cyclops_standing/gltf/cyclops_standing.glb" . . . chrome" shadow-intensity="50" shadow-softness="50" style="outline:none; background-color: . . . none; background-color: #2e2e2e; border-radius: 15px; position: fixed; display:inline-block; bottom:40px; . . .
2K - last updated 2020-02-26 00:28 by Au-Elektra
ProjectProject Leviathan
<html><model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/Leviathan/gltf/Leviathan.glb" . . . chrome" shadow-intensity="50" shadow-softness="50" style="outline:none; background-color:#000000; . . . none; background-color: #2e2e2e; border-radius: 15px; position: fixed; display: inline-block; bottom: . . .
2K - last updated 2020-02-26 00:30 by Au-Elektra
ProjectProject Polyphemau
<html><model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/Cyclops_head/gltf/Cyclops_head.glb" . . . chrome" shadow-intensity="50" shadow-softness="50" style="outline:none; width:100vw!important; . . . none; background-color: #2e2e2e; border-radius: 15px; position: fixed; bottom: 40px; right: 10px"><img . . .
2K - last updated 2020-02-26 00:27 by Au-Elektra
ProjectProject TheMystery
<html><model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/TheMystery/gltf/TheMystery2.glb" . . . chrome" shadow-intensity="50" shadow-softness="50" style="outline:none; background-color:#000000; . . . none; background-color: #2e2e2e; border-radius: 15px; position: fixed; bottom: 40px; right: 10px"><img . . .
2K - last updated 2020-02-26 00:31 by Au-Elektra
Projects
==Currently== [[In_the_Kingdom_No.19]] ------ == Queue == * Cyclops * StillLives ** Bugs ** The Cat * . . . 42:09) : # I Got Soul (4:48) # Welfare Slave (5:49) # Nothingness (2:28) # Thanksgiving (3:57) # . . . Ghettos Of The Mind (:35) # The RIGHT To Be Wrong (4:18) # Blessed Marie (3:56) . . . # Justice Isn't Blind (2:37) # Social Narcotics (5:11) # Blackman, My Brother (5:41) # Drunken Sister . . . (2:49) -- 2005-07-24 18:51 UTC <list "Projects"> . . .
1K - last updated 2019-12-12 14:08 by Au-Elektra
ProsperosBooks
[[Movies]] The Books 1. A Book of Water This is a waterproof-covered book which has lost its colour by . . . joined together by fast-moving, dotted lines. 5. An Atlas Belonging to Orpheus Bound in a battered . . . April or starlings in a November evening sky. 15. End-plants Looking like a log of ancient, seasoned . . .
16K - last updated 2009-05-22 16:51 by Auriea
PureData
[[Reference]] * http://puredata.org/ * http://pure-data.sourceforge.net/ * http://crca.ucsd.edu/~msp/Pd_documentation/x2.htm#s1 . . . /usr/X11R6/lib/X11/fonts/TTF 5. create a .pdrc file in your home directory with . . .
2K - last updated 2006-11-07 19:47 by Auriea
QRCode
SecretWriting little mobile phone readable codes (kind of like a bar code) [[thumb:QRCode-image2|frame|right|120px|"Unfortunately, . . . shapes combined with color to store up to 256GB of data on a sheet of paper or plastic. The article . . .
2K - last updated 2019-12-01 15:19 by Auriea
Quest3D
[[Reference]] <source> Step 3 So now we have 1 object with 2 different UV sets and textures, to . . . Painter channels are easy to set up. They . . . different tiles to various parts of the . . .
8K - last updated 2008-08-28 20:25 by d54C6FBEA.access.telenet.be
RandomFunction
RandomIdeas <html> <SCRIPT language="JavaScript"> <!-- function get_random() { var ranNum= . . . var whichQuote=get_random(); var quote=new Array(5) quote[0]="it is very likely"; quote[1]="it is not . . .
2K - last updated 2005-12-26 13:32 by Auriea
Raphael
CastOfThousands http://www.louvre.fr/expositions/raphael-les-dernieres-annees [[iframe:http://books.google.com.au/books?id=MsV1ZASkP0kC&lpg=PA242&ots=CsIJ9AuTfm&dq=joannides%20apostle%20incomparable&pg=PA40&output=embed"|1000|1500]] . . .
1K - last updated 2012-09-18 12:37 by Auriea
RaphaelHasan
==April 6, 2014 - Raphael's Birthday and A Day for Hasan== [[thumb:RaphaelPortrait|frame|right|250px|The . . . <center>[[thumb:HasanWisdom|frame|250px|We often conversed on the nature of digital friendship]]</center> . . . ===Origins=== [[thumb:MeCrazy|frame|right|250px|Nel mezzo del cammin di nostra vita mi ritrovai . . . we needed to. [[thumb:metamorphosis|frame|left|250px|He spoke of his body and life transformations . . . them larger)'': [[thumb:LateRaphael|frame|right|250px|Hasan and Gemma Garcia teamed up to send me a . . .
14K - last updated 2014-05-20 10:24 by Auriea
Ratatouille
[[Food]] http://www.guardian.co.uk/lifeandstyle/wordofmouth/2010/jul/15/how-to-make-perfect-ratatouille . . . 8 minutes), adding 3 cloves of minced garlic 5 minutes in. Stir in the tomatoes and juices, and . . . vegetables are tender to the point of a knife. 5. Remove the foil, and cook for 30 minutes more – . . .
3K - last updated 2010-07-15 13:08 by Auriea
Ravi
CastOfThousands http://farm3.static.flickr.com/2612/3721997929_7539da2fed_b.jpg . . .
1K - last updated 2010-04-14 23:41 by Auriea
RealtimeArtManifesto
ElegantMedia [[download:RAM.pdf]] ==Abstract== # '''Realtime 3D is a medium for artistic expression.''' . . . because together that can take up to a 95% cut, requiring you to sell hundreds of thouseands . . .
14K - last updated 2006-09-15 12:17 by Auriea
RebeccaHorn
CastOfThousands [[image:infestation]] Img:Rebecca+Horn http://www.guardian.co.uk/artanddesign/2005/may/23/art . . .
9K - last updated 2009-11-18 02:45 by Auriea
Robots
[[Research]] climbing robot - http://www.newscientist.com/blog/technology/2006/03/tree-climbing-robot.html . . . http://www.snakerobots.com/ . . .
1K - last updated 2006-06-24 23:31 by Auriea
Rockefeller2007
[[Projects]] these are notes. theres work to be done. mhm. ==Proposed Project== ===Title (required)=== . . . of the proposed project.}} (required, max 500 words)=== ''Character Studies: Femmes Fatales'' . . . of an idea to nearing post-production.}} (max 1500 words)=== ====Research Project==== Creating a 3d . . . been creating worlds with my partner for over 5 years. The technology changes constantly, improvements . . . and how you do it.}}== ===Aritst Statement (max 1500 words)=== Annoyance with games being always about . . .
6K - last updated 2007-11-19 18:17 by Auriea
RomanEmpire
[[Research]] # Julius Caesar (dictator) 49-44 BC # Augustus 31 BC - AD 14 # Tiberius AD 14-37 # Gaius . . . (Caligula) 37-41 # Claudius 41-54 # Nero 54-68 # Galba 68-69 # Otho 69 # Vitellius . . .
1K - last updated 2009-11-19 11:16 by Auriea
Rome
OutsideSomeplace Living here. ArtSuppliesRoma -------- [[Italy]] ''[[Rome2017]]'' Extended Stay at Academia . . . * http://www.lonelyplanet.com/travelblogs/654/24561/20+tips+on+Visiting+the+Vatican+Museums?destId=359518 . . . [[Book31]]'' Roma - Michaels Version '''20060508''' Hallo va & moe, We hebben wat foto's on . . . http://home.zuper.com/---2006/ vanaf 20060508-colloseo_1.jpg Dit zijn ongeveer alle foto's die . . .
5K - last updated 2021-06-05 11:45 by 93-39-148-146.ip76.fastwebnet.it
Rome2017
OutsideSomeplace [[Roma]] That time we went to Rome and stayed for 5 months. September 2017 - January . . . . . . Basilica San Clemente] Via Labicana, 95 Open Mon-Sat, 9am-12.30pm; 3pm-6pm; Sun 12.15pm-6pm . . . Chiese, 282 Open Mon, Wed-Sun 9am-12pm, 2pm-5pm Entry fee: €8 * Hadrian’s Crypt (Mouth of Truth) . . . times for the Crypt, Mon-Sat, 10am-2pm, 3pm-5.30pm; Sun 12pm – 5.30pm Opening times the church, . . .
3K - last updated 2018-03-29 10:07 by 78-22-179-76.access.telenet.be
Ruins
[[Projects]] Photogrammetry created from Youtube HD drone video of the ruins of Homs, Syria https://www.youtube.com/watch?v=DoRdCbDd50o&t=31s . . . . . . src="https://sketchfab.com/models/9bf395f77a4347fdbd5566a65ccfebbe/embed" frameborder="0" . . . frameborder="0" allowvr allowfullscreen . . . frameborder="0" allowvr allowfullscreen . . .
3K - last updated 2017-09-15 23:37 by Au-Danae
RulesOfAcquisition
[[Reference]] Rule 001 » Once you have their money, you never give it back. Rule 002 » The best deal . . . clothes is like a man in the kitchen. Rule 005 » If you can't break a contract, bend it. Rule 006 . . . family close, keep your Latinum closer. Rule 015 » Acting stupid is often smart. Rule 016 » A deal . . . but you can sure have a blast renting it. Rule 025 » There's always a way out. Rule 026 » As the customers . . . Rule 034 » War is good for business. Rule 035 » Peace is good for business. Rule 036 » Too many . . .
10K - last updated 2009-01-17 01:51 by Auriea
RunsInTheFamily
SongBook [[tube:O_JFjY5Y0Os 640 480 0]] . . .
1K - last updated 2009-03-07 22:28 by Auriea
Russian
[[Language]] 1 2 3 4 5 6 7 8 9 10 11 |12 13 "14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 . . .
1K - last updated 2010-04-05 23:23 by Auriea
SIMULATIONS
http://song-of-songs.org My understanding of the world is three dimensional. [[tube:6kCgc_nLz1w 450 240 . . .
1K - last updated 2020-08-03 11:46 by Auriea-Mercury
SacredTexts
[[mythology]] http://www.sacred-texts.com/index.htm ==Founders of religions== Abraham - claimed as a . . . 717 BC-673 BC Siddartha Gautama - Buddhism, ca. 563 BC-483 BC, or (trad.) 1029 BC-949 BC. Mahavira . . . - Jainism, 599 BC-527 BC Confucius - Confucianism, ca. 551 BC-479 . . . BC (trad.) Laozi - Taoism, ca. 500 BC Mozi - Mohism, ca. 470 BC-390 BC Jesus - Christianity, . . . ca. 210-276 Muhammad - prophet of Islam, ca. 570-632 Nanak - Sikhism, 1469-1539 Nakayama Miki - . . .
2K - last updated 2005-12-27 20:10 by Auriea
Salome
FataleVrouwen John the Baptist Beheaded 14King Herod heard about this, for Jesus' name had become well . . . is why miraculous powers are at work in him." 15Others said, "He is Elijah." And still others claimed, . . . "The head of John the Baptist," she answered. 25At once the girl hurried in to the king with the request: . . .
3K - last updated 2007-11-12 14:18 by Auriea
SalvadorDali
CastOfThousands 50 Secrets of Magic Craftsmanship [[image:DaliAdvice]] one of the most influential artists . . .
1K - last updated 2018-07-07 12:04 by Au-Roma
Scans
[[foreground:none|#000000]] <center>[[thumb:artemis.png|1080px]]</center> <center>See . . . frameborder="0" allow="autoplay; . . . frameborder="0" allow="autoplay; . . .
1K - last updated 2018-12-24 15:38 by Auriea.
Sculptris
[[Reference]] Downloaded an os x version which runs under WINE [http://www.zbrushcentral.com/showthread.php?t=91628&page=2&pp=15|here.] . . . ==notes== ===Working shortcuts=== rotation = command+left . . . Support/Wine/prefixes/Sculptris_a5/drive_c/winebottler open up config.txt Change the . . .
1K - last updated 2010-12-16 19:44 by Auriea
Sculpture
[[Works]] [[thumb:BronzeMagdalenes3|500px]] ''see also: DigitalSculpture'' * [[Minorinth]] * [[Fauna]] . . .
1K - last updated 2020-12-30 00:35 by Auriea
SecretWriting
SketchBooks ''see also: [[Marginalia]]'' ==made up scripts== * http://dscript.org kind of like the one . . . * WikiPedia:Voynich_manuscript, http://www.voynich.nu/ . . . * [http://digitalphotography.weblogsinc.com/2005/07/29/steganography-with-flickr/ steganography with . . .
2K - last updated 2015-06-08 11:41 by Auriea
Sedum
TuinPlanten A whole family{{http://www.jovihappy.nl/1895128.htm}} of succulent plants. Of which i currently . . .
1K - last updated 2006-03-16 12:36 by Auriea
SedumSpathulifolium
TuinPlanten [[thumb:2005-05-21 SedumSpathulifolium|frame|right|I was given it by Robbe & Christiene . . . Foliage Texture: medium USDA Hardiness Zone: 5 Water Requirements: average Additional Comments: . . .
1K - last updated 2010-04-14 23:59 by Auriea
SelfPortraitSummer2005
image/jpeg
289K - last updated 2006-03-18 16:50 by Auriea
SevenPilgrimageChurches
[[Rome2017]] ==The Seven Churches== The traditional stops of the Seven-Church Walk are as follows: # . . . in Vaticano. The entire journey is around 22.5 km. . . .
2K - last updated 2017-09-16 08:18 by Au-Roma
SevenSisters
[[Research]] [[image:constellation_Pleadies]] The Pleiades Star Cluster ''Photo Credit and Copyright: . . . city. Also known as the [[Seven Sisters]] and M45, the Pleiades is one of the brightest and closest . . .
1K - last updated 2005-08-09 17:17 by AurieaHarvey
SeydouKeita
[[photographers]] Img:Seydou+Keita [http://www.skny.com/lasso-bin/artist_artwork.lasso?-token.ArtistID=51&-token.ArtistName=The%20Estate%20of%20Seydou%20Ke%EFta] . . . . . . SEYDOU KEITA:''' I started to photograph in 1945 in BAMAKO. I am self taught; I had a 6x9 camera that . . . In 1949, I bought a view camera and started with 5x7 negatives. I was doing contact prints, that's why . . . I prefered 5x7. I had pinned on the walls of the studio various . . .
5K - last updated 2007-10-01 15:14 by Auriea
SightSize
[[drawing]] ''see also: CaproniCasts, LifeDrawing'' ==::BargueDrawing== http://www.learning-to-see.co.uk/bargue-drawings . . . [http://www.fineartstore.com/Catalog/tabid/365/List/1/CategoryID/14887/Level/a/Default.aspx?SortField=UnitCost%2cUnitCost] . . . ----- http://www.sightsize.com '''So what exactly . . .
2K - last updated 2011-09-24 23:15 by Auriea
SilentHill4Kyodan
SongBook [[image:SilentHill4Kyodan-image]] ====Disc 2 Kyodan (Dramatic Storytelling) - "Inescapable Rain . . . In Yoshiwara" (57:04)==== Info found on the net about this disc. 01 . . . F Sharp -Shozetsu- 04 勝絶(ショッゼツ) 05 G -Shimomu- 05 下無(シモム) 06 G Sharp -Soujou- . . . = E = January 04. Shozetsu = F = February 05. Shimomu = F# = March 06. Soujou = G = April 07. . . . intrigue. The yoshiwara was home to some 1,750 women in the 1700s, with records of some 3,000 women . . .
11K - last updated 2009-01-13 14:51 by Auriea
SketchBooks
[[thumb:AnneCarson-Candor|600px]] This archive is a work in/of constant progress. '''I welcome you to . . . finished but presentable are [[Book0|00]], [[Book5|5]], [[Book15|15]], [[Book19|19]], [[Book21|21]], . . . - La salle des Caryatides |http://auriea.org/Book49|*49.]] . . . - Paris |http://auriea.org/Book48|*48.]] [[image . . . 45 - Mars Black|http://auriea.org/Book45|45.]] . . .
8K - last updated 2019-06-07 10:17 by Auriea
SmellMemory
ElegantMedia * http://www.cbihateperfume.com/ ** '''Winter 1972''' - A field of untouched new fallen . . . earth of a country garden ----- [[image:2007-05-06]] * Maki Ueda - http://www.ueda.nl/aromatic_journey1/index.html . . . * http://www.wired.com/wired/archive/15.05/posts_odor.html ** ''Sissel Tolaas traveled the . . . emitter will cost about ¥20,000 (US$195) when eventually launched commercially. Cartridge . . . sponsored Internet survey, NTT found that 56 percent of people polled use aromatherapy or believe . . .
8K - last updated 2009-09-04 14:33 by Auriea
SnelBelgWet
ProofOfMyExistence U kunt in lokaal 211 in het Administratief centrum uw aanvraag doen. Hiervoor heeft . . . in de dienst Bevolking in het AC (gelijkvloers) 5. uittreksel uit het bevolkingsregister (samenstelling . . .
1K - last updated 2008-04-09 16:58 by Auriea
SoldierOfTheMist
FiftyBooks a fantasy novel by Gene Wolf which was at some time in the past my favorite book. Lost my . . . in San Francisco. [[image:SoldierOfTheMist-page125]] . . .
1K - last updated 2009-04-05 21:43 by Auriea
SoldierOfTheMist-page125
image/jpeg
267K - last updated 2009-04-05 21:44 by Auriea
Solitaire
[[cards]] ''see also: Games, Gog:solitaire+source'' actionscript source (50$) * http://www.ifbin.com/news/2006/03/flex-2-actionscript-3-klondike-by.html . . .
1K - last updated 2007-08-13 13:56 by Auriea
SomeOfMyFavoriteSites
[[Empire]] <table/non A, B> A:<tt> handprint, watercolor.....[http://www.handprint.com/HP/WCL/] . . . syndicate.....[http://www.anart.no/syndicate] . . .
3K - last updated 2010-08-06 13:37 by Auriea
SoundCloud
<html> <div style="font-size: 11px;"><object height="165" width="100%"> <param name="movie" . . . <embed allowscriptaccess="always" height="165" src="http://player.soundcloud.com/player.swf?url=http%3A%2F%2Fsoundcloud.com%2Fauriea%2Fsets%2Findpls&show_comments=true&auto_play=false&show_playcount=true&show_artwork=true&color=000000" . . . </object> <div style="padding-top: 5px;"><a href="http://soundcloud.com/auriea/sets/indpls">indpls.</a> . . .
1K - last updated 2009-08-10 16:51 by Auriea
Spatialism
* WikiP:Lucio_Fontana * “We have renounced the practice of familiar art forms and are working to develop . . . by Lucio Fontana at the Milan Triennale in 1951, published in Lucio Fontana, Manifesti Scritti Interviste, . . . ed. Angela Sanna [Milan: ABSCONDITA, 2015], 47) * "Matter, colour and sound in motion are the . . . ''MANIFESTO TECNICO DELLO SPAZIALISMO (1951) Tutte le cose sorgono per necessità e valorizzano . . .
11K - last updated 2019-05-18 16:49 by Auriea
StJTB
==CLAY== <center>[[vimeo:310987804 720 398 0]] Sculpture in clay, from a live model. Made in Studio . . . ==VERSIONS== [[thumb:StJTB-Prints|500px]] various 3d printed versions. (need better photos . . . ----- ==REFERENCE== [[thumb:KikiSmith-Fountain|250px|left]][[thumb:StJTBPisa-Baptistery|350px|left]] . . . [[thumb:BronzeMirror|250px|left]] [[thumb:PiraeusApollo|250px|left]] [[thumb:StJTB-PrintReflection|300px|left]] . . .
1K - last updated 2019-03-28 15:41 by Auriea
StabatMater
SongBook http://www.stabatmater.info [[tube:2XUC2MQ74DE 320 240 0]] http://www.stabatmater.info/vivaldi.html . . . VALIGN="TOP"><p ALIGN="CENTER">5</td> <td WIDTH="47%" VALIGN="TOP"><dir> . . . VALIGN="TOP"><p ALIGN="CENTER">15</td> <td WIDTH="47%" VALIGN="TOP"><dir> . . .
11K - last updated 2014-05-30 12:59 by Auriea
StokRoos
TuinPlanten WikiPedia:Alcea_rosea Hollyhock http://farm4.static.flickr.com/3256/2618850595_6ca0e62493.jpg . . .
3K - last updated 2008-06-29 21:43 by Auriea
StrawberryShortcake
[[Food]] Strawberry Shortcake Serves 6. Fruit: 2 pounds strawberries, washed, hulled, and sliced 3 or . . . rack to middle position and preheat oven to 475F. While fruit is macerating, whisk flour, baking . . . until tops are golden brown and crisp, about 15 minutes. Transfer to wire tack and let cool at least . . . 15 minutes before assembling. For the whipped cream: . . . and whipped cream forms soft peaks, 30 to 45 seconds longer. To assemble: Split each biscuit in . . .
3K - last updated 2008-06-29 21:33 by Auriea
StreetView
OutsideSomeplace permalinks to random places. via: http://web.mit.edu/~jmcmicha/www/globegenie/ and http://www.mapcrunch.com/ . . . ==South America== * Buenos Airies [http://web.mit.edu/~jmcmicha/www/globegenie/index.html?llyp=-22.905322,-43.18532,51.72,9.77] . . . * pretty purple tree on a quiet street . . . ==Antarctica== * penguins! . . . ==Scandinavia== * a . . .
2K - last updated 2010-12-23 16:42 by Auriea
StudLoan
ProofOfMyExistence ==2017== ||I.17 || $129+179 || $300 (11,04 EURfee) || 285,13 EUR || 20170107 || $1,947 . . . || $129+179 || $300 (11,64 EURfee) || 302,54 EUR || 20170207 || $?? || ||III.17 || $129+179 || . . . 303,00 USD{{there was a paypal balance}} || 20170509 || $1,493 || ||VI.17 || $129+179 || $370 (3,43 . . . EURfee) || 345,47 EUR{{she was here in Belgium at the time. extra . . . || $129+179 || $300 USD ($12 USD fee) || €295.80 EUR || 20160111 || ?? || ||II.16 || $129+179 || . . .
14K - last updated 2017-06-16 11:39 by Au-Danae
Studio
<center>[[thumb: fortune|600px]]</center> [[background:2010-06-24_silver|repeat #274b5b]] . . . [[image:Studio2017]] [[image:Book38_page4-5]] [[image:LainComputes-img]] ------ = The National . . .
1K - last updated 2020-04-08 12:37 by Auriea-Mercury
SweetPotatoPie
[[Food]] http://www.ehow.com/how_6999_make-sweet-potato.html ------ My recipe for sweet potato pie [[thumb:2005-11-01 . . . into the crust. Put into an oven preheated to 375 degrees. Cook for about 35-40 minutes or until a . . . a dash of cinnamon on the top and bake for 50 minutes to 1 hour.(Tip: Brush the edges of your . . .
4K - last updated 2009-05-21 20:25 by Auriea
Synthetic Corpo-Reality
[[Exhibitions]] <aggregate "La_Vita_Nova"> Synthetic Corpo-Reality is inspired by the extended . . . away. take from that what you will. [[vimeo:515693367 570 417 0]] Curated by Julie Walsh for MEET . . .
3K - last updated 2021-02-23 13:08 by Auriea
TV
ProofOfMyExistence http://en.wikipedia.org/wiki/Jem_%28TV_series%29 i stopped watching television when . . . . . .
1K - last updated 2009-04-18 14:43 by Auriea
TableOfContents
SketchBooks width in cm. divided by 2 [[thumb:Book49_Cover|75px]] [[thumb:Book48_Cover|65px]] [[thumb:Book47_Cover|72px]] . . . [[thumb:Book46_Cover|80px]] [[thumb:Book45_Cover|57px]] [[thumb:Book44_Cover|80px]] [[thumb:Book43_cover|85px]] . . . [[thumb:Book38_Cover|45px]] ------- [[thumb:Book37_Cover|65px]] [[thumb:Book36_Cover|65px]] . . . [[thumb:Book35_Cover|65px]] [[thumb:Book34_Cover|100px]] [[thumb:Book33_Cover|63px]] . . . [[thumb:Book31_Cover|65px]] [[thumb:Book30_Cover|85px]] [[thumb:Book29_Cover|105px]] . . .
2K - last updated 2014-09-09 14:27 by Auriea
TagakiMasakatsu
[[DrawingImaging]] <html><iframe width="420" height="315" src="https://www.youtube.com/embed/xufG5lYRafQ" . . . width="420" height="315" src="https://www.youtube.com/embed/v-9t3ue9Sjc" . . .
1K - last updated 2016-08-13 18:00 by Auriea
TakayoshiSato
[[Games]] <html> <object width="425" height="350"><param name="movie" value="http://www.youtube.com/v/EFJZKf3Ox_k"></param><embed . . . type="application/x-shockwave-flash" width="425" height="350"></embed></object> </html> . . . http://www.gamasutra.com/features/20050825/sheffield_01.shtml the soul of SilentHill 1&2 . . .
9K - last updated 2008-06-17 01:29 by Auriea
Tamara
CastOfThousands http://farm4.static.flickr.com/3026/2741511338_315b2e5d85_b.jpg . . .
1K - last updated 2010-04-14 23:34 by Auriea
TaoTeChing
[[Quoth]] [[1]] [[2]] [[3]] [[4]] [[5]] [[6]] [[7]] [[8]] [[9]] ... [[37]] [[38]] [[39]] [[40]] [[41]] . . . Tao Te Ching is a short text of around 5,000 Chinese characters in 81 brief chapters or sections . . .
1K - last updated 2012-06-07 13:48 by Auriea
Tarot
ElegantMedia Tarot with FoAM - LibFoam:tarot -------- Tarot Exchange [http://groups.yahoo.com/group/Tarot-Exchange] . . . matrix== ''78 cards / 22 major / 16 court / 56 minor / 4 court per suit'' '''cups''' -> hearts . . . 3 ~ planning 4 ~ practical attainment 5 ~ unbalance, conflicts 6 ~ harmony 7 ~ choices 8 . . . ** http://www.tarotforum.net/showthread.php?t=125650 ** http://www.tarotforum.net/showthread.php?t=136753 . . . card game, probably originating in 15th century Florence, Italy; it is no longer widely . . .
4K - last updated 2012-02-27 13:32 by Auriea
Techne
ElegantMedia Mythica:techne <source> From: rob@robmyers.org Subject: [NetBehaviour] Heidegger And . . . Art Computing Date: 2007年5月12日 17:14:11:GMT+02:00 To: netbehaviour@netbehaviour.org . . . Heidegger And Art Computing Date: 2007年5月12日 18:40:30:GMT+02:00 To: netbehaviour@netbehaviour.org . . .
2K - last updated 2007-05-12 19:10 by Auriea
TedNelson
CastOfThousands "Designer, Generalist, Contrarian Theodor Holm Nelson, 1937- Best known for: coining . . . and "hypermedia," 1963 (first published 1965), and as founder and pursuer of Project Xanadu®, . . .
1K - last updated 2004-11-25 15:09 by Auriea
TenThousandThings
[[Quoth]] ''see also: numbers, [[1]], [[2]], [[3]], [[4]] ... [[33]], [[34]], [[35]], [[36]], [[37]], . . .
1K - last updated 2012-07-11 14:45 by Auriea
TeunisBloem
TuinPlanten [[Gog:Oenothera tetragona]] [[WikiPedia:Oenothera]] [[thumb:2005-06-22_TeunisBloemBloom|frame|right|150px|it . . . by other species. It grows as far north as 65° N in Finland. Young roots can be eaten like a vegetable . . . blooming in late June. The flowers are 1.5 inches or so in diameter, and close up in the evenings. . . . as separate species. Hardy zone 3. Height is 15 inches to 20 inches. As mentioned above, in good . . .
4K - last updated 2005-06-22 22:44 by Auriea
TextFormattingRules
[[Empire]] If you click on the question mark you can make a new wiki page. If a wiki page already exists . . . ==MOVIES== '''YouTube''' [[tube:8nxUOIAyuvw 425 350 1]] '''Vimeo''' [[vimeo:8nxUOIAyuvw 425 350 1]] . . .
16K - last updated 2017-02-28 15:38 by Auriea
TheAeneid
''see also: http://auriea.de'' For Aeneas in Book 3 - Halfway between Delos and Crete <center><html><iframe . . . . . . width="80%" height="450" frameborder="0" style="border:0"></iframe></html></center> . . .
1K - last updated 2017-08-14 14:32 by Au-Mercury
TheAnalyticalLanguageOfJohnWilkins
[[Quoth]] THE ANALYTICAL LANGUAGE OF JOHN WILKINS By Jorge Luis Borges Translated from the Spanish 'El . . . in Jorge Luis Borges, 'Other inquisitions 1937-1952' (University of Texas Press, 1993) I have noticed . . . Henderson; the 'Wörterbuch der Philosophie' (1935), by Fritz Mauthner; 'Delphos' (1935), by E. Sylvia . . . In a similar language invented by Letellier (1850) a means animal; ab, mammal; abo, carnivore; aboj, . . . In the language of Bonifacio Sotos Ochando (1845) imaba means building; imaca, harem; imafe, hospital; . . .
9K - last updated 2010-09-13 21:50 by Auriea
TheAntichrist
[[Mythology]] 46 Prophecies the Antichrist will fulfill # The antichrist will be a man - Daniel 7:24-25 . . . By peace, he will destroy many - Daniel 8:25 # He will be promoted and exalted by a miracle working . . . be viewed. The word "goeth" in the scripture is 5217 hupago (hoop-ag'-o); from 5259 and 71; to lead . . . Egypt. 2. Assyria. 3. Babylon. 4. Medo-Persia. 5. Greece. 6. Rome # He will have a mouth speaking . . . # He will cause craft to prosper - Daniel 8:25 It is interesting to note the definition of the word . . .
9K - last updated 2009-06-25 09:25 by Auriea
TheBeautyOfTheHusband
FiftyBooks Read this while spending one day in the hospital{{uterus, [[2005-02-07 The Day Before]], [[2005-02-09 . . . a fictional essay in 29 tangos'' -- wof 2005-10-27 08:24 UTC ---- ===VII. BUT TO HONOR TRUTH WHICH . . .
5K - last updated 2013-01-05 22:01 by Auriea
TheBlueCurtain
reference [[tube:yKJIZ0WyjN8 512 350 0]] . . .
1K - last updated 2018-06-09 18:19 by Au-Mercury
TheDiseaseManifesto
[[Entropy8.com]] Manifesto | 1996 - 1998 [[image:bread]] Co-written by Bable and the Cut-up Machine. . . . I can be strong but I am writing here now. 005. It is between the peace and the music changes from . . . world. That is where getting it out is useful. 015. For a long time I have never bothered to consider . . . to find the time to do more. ignoring pain. 025. Saying goodbye to ego. hoping the things you cherish. . . . those phrases into these notes, into the beat. 035. When I feel nice. when the world is alright. pushing . . .
21K - last updated 2018-09-10 19:41 by Auriea.
TheFaerieQveene
FiftyBooks http://darkwing.uoregon.edu/~rbear/fqintro.html Poet Edmund Spencer dedicated his rich and . . . complex masterwork The Faerie Queene (1590/96) to Elizabeth; she is represented in the epic . . .
1K - last updated 2005-11-21 10:54 by Auriea
TheFlowerSeller
<html><center><div class="sketchfab-embed-wrapper"><iframe width="90%" height="750" . . . src="https://sketchfab.com/models/65a825dbcf694801968adfbf823a4148/embed" frameborder="0" . . .
1K - last updated 2018-03-09 16:15 by Au-Mercury
TheFourByFive
[[photography]] http://farm3.static.flickr.com/2367/2518960124_4d245c7134.jpg --i think i lost part of . . . LINHOF Schneider-Kreuznach Angulon 1:6,8/90 3668257 Synchro-Compur 6,8 - 32 [http://photo.net/large-format-photography-forum/00OsJr] . . . May 1952] # SEIKOSHA-SLV Commercial Astragon 1:6.3 f=180mm . . .
1K - last updated 2009-02-22 14:05 by Auriea
TheFuries
[[mythology]] Aeschylus The Eumenides ''The Kindly Ones'' 458 BC ''This translation, which has been prepared . . . the blame arising from his mother's murder. [580] Start the trial. You understand procedure. Confirm . . .
53K - last updated 2006-06-02 20:58 by Auriea
TheGardenOfForkingPaths-pg45
image/jpeg
88K - last updated 2008-11-10 15:02 by Auriea
TheGlassEssay
[[Quoth]] POEM The Glass Essay BY AnneCarson I I can hear little clicks inside my dream. Night drips . . . Recesses were many. One autumn day in 1845 Charlotte “accidentally lighted on a MS. volume . . . for patients who need chronic care about 50 miles from here. He suffers from a kind of dementia . . . with a big window and a combination lock (5—25—3) to the west wing, for chronic care patients. . . . Perhaps the Nudes are the best way. Nude #5. Deck of cards. Each card is made of flesh. The . . .
46K - last updated 2013-01-06 12:10 by Auriea
TheGraeae
FataleVrouwen The three "old women" or "gray ones" from Greek mythology. They are the daughters of Phorcys . . . [1.2] PHORKYS (Aeschylus Prometheus Bound 795, Pindar Pythian Ode, Ovid Metamorphoses 4.772, Nonnus . . . Dionysiaca 25.64) NAMES [1.1] PEMPHREDO, ENYO (Hesiod Theogony . . .
4K - last updated 2006-12-24 15:35 by Auriea
TheLimitsOfTwo
Not a fun place to be. What happens when the relationship between Michael and I break down and we are . . . We make up, always. [[thumb:2006-07-03 20h45 limits of two revisited]] . . .
1K - last updated 2012-07-11 15:18 by Auriea
TheNineBillionNamesOfGod
[[Quoth]] The Nine Billion Names of God By Arthur Clarke "This is a slightly unusual request," said Dr. . . . energy have you?" "A diesel generator providing 50 kilowatts at 110 volts. It was installed about five . . .
15K - last updated 2007-12-21 14:58 by Auriea
TheRitualOfLoveAndDeath
[[Quoth]] <html><embed src=http://video.google.com/googleplayer.swf?docid=9201439452997071422&hl=en&fs=true . . .
1K - last updated 2010-07-26 22:47 by Auriea
TheSandman
FiftyBooks A GraphicNovel series written by NeilGaiman. Covers by DaveMcKean. [http://spiffyness.net/dream/ . . . found online here] [[thumb:SandmanCover|frame|150px|right|Kinge of Dremes, The Prince of Stories, . . . Of Smoking In bed?," DC Comics, 1992 ''Sandman #45'', The Things We Do To Be Loved, Her Hands Do Not . . . # '''World's End''' # '''The Kindly Ones''' (57-69) A really lovely and fitting end. The dreaming . . . style=width:400px;height:326px . . .
7K - last updated 2010-05-19 14:56 by Auriea
TheSymbolsOnMyFlagAndWhatTheyMean
'''THE SYMBOLS ON MY FLAG (AND WHAT THEY MEAN)''' {{http://www.newyorker.com/humor/2008/05/19/080519sh_shouts_handey}} . . .
4K - last updated 2008-05-13 00:04 by d54C6FF9F.access.telenet.be
TheToyRoom
[[Projects]] ==The Endless Forest Toys== I am in touch with http://crazylabel.com but maybe it is too . . . toy cars] * if you . . . send it a message you change its shape. * every 15 minutes closes or opens its eyes. * can become whatever . . . secret.secret treasure ---- size: 174/32 = 5.4375 ---- but lets free up the mind a bit... heres . . .
2K - last updated 2006-05-30 15:38 by Auriea
TheWindUpBirdChronicle
FiftyBooks ''see also: [[Murakami_interview1]]'' finished 2005-12-18 A perfect illustration of how the . . .
2K - last updated 2006-12-26 22:23 by Auriea
ThisNightHasOpenedMyEyes
SongBook In a river the color of lead Immerse the baby's head Wrap her up in the news of the world Dump . . . and cried like a bullied child A grown man of 25, Oh, he said he'd cure your ills But he didn't and . . .
1K - last updated 2005-06-21 10:55 by Auriea
ThoughtPhotoStream
<html><script type="text/javascript" src="http://www.flickr.com/badge_code_v2.gne?show_name=1&count=10&display=latest&size=m&layout=h&source=user_set&user=81482434%40N00&set=72157624960278365&context=in%2Fset-72157624960278365%2F"></script></html> . . .
1K - last updated 2012-02-10 21:15 by Auriea
ThreeMarys
FataleVrouwen [https://www.biblegateway.com/passage/?search=John+19%3A25&version=NIV John 19:25] . . . Mary (mother of James the Less) (Matthew 27:56; Mark 15:40; Luke 24:10) Mary of Cleopas (John 19:25) . . . other women", after stating earlier (Luke 23:55) that at the burial of Jesus "the women who had . . . also'' [http://shadowsineden.blogspot.be/2015/11/mary-of-egypt-heart-in-wilderness.html Mary of . . . [http://shadowsineden.blogspot.be/2015/03/the-gospel-of-mary.html The Gospel of Mary] . . .
3K - last updated 2017-04-07 13:12 by Au-Danae
TillWeHaveFaces
FiftyBooks [[thumb:TillWeHaveFaces-scan1]] [[thumb:TillWeHaveFaces-scan2]] [[thumb:TillWeHaveFaces-scan3]] . . . . . . [http://www.amazon.com/exec/obidos/tg/detail/-/0156904365/qid=1130181528/sr=8-1/ref=pd_bbs_1/002-2748136-4372832?v=glance&amp;amp;amp;s=books&amp;amp;amp;n=507846] . . .
1K - last updated 2006-11-08 02:29 by Auriea
ToWatch
[[Movies]] <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/kxIYuOeAKnw?fs=1&hl=en_US"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> ----- . . . <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/Gn8IoA6wGCo&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> <object width="480" . . . height="385"><param name="movie" value="http://www.youtube.com/v/IE3mJvsOtk4&hl=en_US&fs=1&"></param><param . . .
3K - last updated 2011-01-12 19:41 by Auriea
TooManyOptions
[[Entropy8]] i see this as a problem with the Empire. I want something sown together, something whole. . . . emusic €13,99/mo €167,88/yr ## LiveJournal $25/yr ### Facebook . . .
3K - last updated 2009-08-10 17:07 by Auriea
TuinPlanten
[[Botany]] ===About Plants=== http://www.theplantlist.org/ ==Complete Listing== see also: worms http://www.plantentuin.ugent.be . . . [[background:2005-10-06_remembrance_of_things_past|repeat #ba039e]] . . . Summer 2005: Aphids Summer 2006: Spider Mites [[Hortensia]] === . . . KaardeBol (Dipsacus) http://home.zuper.com/---2005/20050602_GardenHoe.jpg === from Robbe en Christiene . . .
2K - last updated 2011-01-02 20:07 by Auriea
Twine
ElegantMedia These will be notes about how to use [http://twinery.org twine] ==Resources== * [http://twinery.org/forum/index.php . . . http://twinery.org/forum/index.php/topic,2085.msg6056.html#msg6056 * add images and use as a link: . . .
2K - last updated 2015-08-06 16:14 by Auriea
TwitterBots
ElegantMedia ==Learning how-to== Advice from @tinysubversions This is a good article for the most basic . . . to draw images as though I were using an HTML5 <canvas> object: https://github.com/dariusk/intersections . . .
2K - last updated 2015-08-06 17:52 by Auriea
TxoomHomecomingSoup
[[Food]] ///////////// Northern Flatlands Comfort (or TxOom? Homecoming Soup) - serves 4 2 leeks, cut . . . peeled and cut into chunks 1 large onion, sliced 5 cm cube of ginger, peeled and grated 2 pieces of . . . chilli pepper, crumbled pinch of cumin powder 750 ml of vegetable stock olive oil 1 table spoon of . . . Add the leeks and continue frying for another 5'. Then add the potatoes and fry for 5'. Add the stock . . .
1K - last updated 2005-11-19 23:30 by Auriea
Ultimaker3
[[3dPrinting]] =This Much I Know= # PLA is: ## brittle, don't drop it ## '''moisture in your PLA filament . . . clips [https://www.thingiverse.com/thing:12516] ### dessicant containers that fit in the center . . .
2K - last updated 2017-08-23 17:54 by Au-Mercury
UnderTheSea
[[image:lobster]] Dr. O'Dor was on a cruise to the Arctic last year that made a number of finds, including . . . together. A shrimp believed extinct for 50 million years ago was found on an underwater peak . . . but looks bulkier. Sooty shearwaters average 350 kilometres a day in their search for food. A satellite . . . deep ocean is free of sharks, which live at 1,500 metres or above. Scientists working on the marine . . . mercy of the ocean's currents. They identified 500 species, including a transparent jellyfish they . . .
3K - last updated 2006-12-12 15:10 by Auriea
Unity3D
[[Reference]] = [::uScript] = Forum [http://www.uscript.net/forum/index.php] * bring up the editor with . . . http://forum.unity3d.com/threads/34015-Newbie-guide-to-Unity-Javascript-(long) ==make it . . .
1K - last updated 2012-06-18 11:41 by Auriea
Unity3dShaders
[[Unity3d]] http://www.unifycommunity.com/wiki/index.php?title=Shaders ====from the forums==== * Force . . . [http://forum.unity3d.com/viewtopic.php?t=50262] . . .
1K - last updated 2010-05-26 20:38 by Auriea
VIDEOGAMES
1) Bientôt l’été, 2011 http://tale-of-tales.com/bientotlete A holodeck beach simulation. Entertainment . . . to, in french, if possible. https://vimeo.com/54039868 https://vimeo.com/54038250 2) The Graveyard, . . . who visits a cemetery. Free download, but pay 5 dollars for death. A Tale of Tales classic. It was . . . https://www.flickr.com/photos/entropy8/albums/72157709876997777/with/48372580181/ 3. Luxuria Superbia, . . .
2K - last updated 2020-06-15 22:30 by Auriea-Mercury
Vanitas
ElegantMedia ==Flower Painting== WikiPedia:Jan_van_Huysum WikiPedia:Abraham_Mignon WikiPedia:Jan_Weenix . . . Paintings - http://www.freewebs.com/garyosborn/235degreereferences.htm ==Momento Mori Elements== ===living=== . . . römer],[http://www.rijksmuseum.nl/aria/aria_assets/BK-NM-8186?lang=en . . . passglass]) * musical instruments & music . . .
2K - last updated 2008-03-18 17:30 by d54C6FF9F.access.telenet.be
Velasquez
CastOfThousands [[background:2008-06-02|repeat #6d555d]] [[image:2010-02-19]] . . .
1K - last updated 2010-05-26 13:14 by 78-21-207-92.access.telenet.be
VelvetPlant
TuinPlanten [[thumb:2005-06-04_VelvetPlant|frame|right|the latin name is Gynura but it is also known . . . comes from Java and requires a minimum of around 55ºF. The leaves and stems are covered in purple hairs . . . slightly acidic soil mixture, so the addition of 50% peat moss to the potting mix is helpful. Watering . . . (Purple Passion Plant) is easily propagated by 3-5 inch cuttings set in soil or vermiculite or simply . . . tablespoon of ground lime-stone - 2 teaspoons of 5-10-5 fertilizer. OR! use general purpose potting . . .
3K - last updated 2005-07-14 11:22 by 84.194.164.18
VijaCelmins
CastOfThousands <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/tORoyCJtO4o&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> painter . . .
1K - last updated 2010-05-05 00:31 by Auriea
Vimeo
[[Empire]] <html> <iframe src="http://player.vimeo.com/video/18599827" width="400" height="300" . . . a:link, a:visited, a:active { color:#3A75C4; text-decoration:none; cursor:pointer; } .vimeoBadge . . . #vimeo_badge_logo { margin-top:10px; width: 57px; height: 16px; } .vimeoBadge .credit { font: normal . . . Badge--> </html> ==tag== [[vimeo:190454 400 300 0]] ==rss== <rss "http://www.vimeo.com/auriea/videos/rss"> . . .
2K - last updated 2011-04-05 12:40 by Auriea
ViolHeads
* Swan * Cyclops * The Twins [https://photos.google.com/share/AF1QipMCgOtnDKE7c9XCd_Gvgba7y9XmbtA16YPbt87oIbR9kbhYy76EYk2xkE21729X0g?key=N1ZxajJ2M285b25HbG9RSUxsQXotRUJ1ZXl6eDln . . .
1K - last updated 2020-01-16 23:36 by Au-Elektra
VisualProgramming
[[Reference]] WikiPedia:Visual_programming_language ''see also: [[HTML5]], RealTimeProgramming'' For . . .
2K - last updated 2012-09-27 12:06 by Auriea
Wales
OutsideSomeplace [[vimeo:7254503 720 400 0]] . . .
1K - last updated 2009-10-28 23:26 by Auriea
WarsawFoksalGalleryShow2019
<html> <div class="sketchfab-embed-wrapper"><iframe width="640" height="480" src="https://sketchfab.com/models/be76382be40a4574b96b7c6b59a79c8b/embed?autospin=0.2&autostart=1&camera=0" . . . src="https://player.vimeo.com/video/227975590" width="640" height="480" frameborder="0" webkitallowfullscreen . . .
1K - last updated 2019-02-25 15:26 by Auriea
WhatIsThePrecedentForYourWork
ElegantMedia Artists: Jacques Louis David, William Bouguereau, Gian Lorenzo Bernini, John William Waterhouse, . . . tradition in a similar way as oil painting did 500 years ago. Jacques Louis David, William Bouguereau, . . .
4K - last updated 2005-12-20 11:05 by Auriea
WhiteChocolateFrosting
[[Food]] 1 cup butter, softened (no subs) 2 cups confectioners' sugar 6 ounces white chocolate or 6 ounces . . . white baking bar, melted and cooled 3 -5 tablespoons whipping cream or 3 -5 tablespoons half-and-half . . .
1K - last updated 2015-08-25 19:09 by Auriea
WilliamKentridge
CastOfThousands ''see also: TheLivingLine'' ==Six Drawing Lessons== <html><iframe width="560" . . . height="315" src="https://www.youtube.com/embed/tyndlMIgbnU?rel=0" . . .
2K - last updated 2015-11-23 19:44 by Auriea
WirefirePortraits
<html><object width="320" height="240"> <param name="flashvars" value="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2F&set_id=72157594473311985&jump_to="></param> . . . . . .
2K - last updated 2009-01-11 00:05 by Auriea
WordGames
[[Language]] ''see also: SecretWriting'' 1. Isogram A word in which no letter of the alphabet occurs . . . can relate to: Stressed is desserts backwards. 5. Kangaroo word or marsupial This refers to a word . . . produced the phenomenal Gadsby: A Story of Over 50,000 Words Without Using the letter "E," a scarcely . . . words. Rebus has been used in English since 1605, when William Camden wrote, "They which lackt wit . . . phrase. The English word anagram goes back to 1589. Grambs uses the word transposal in this general . . .
5K - last updated 2015-08-25 19:10 by Auriea
X3DOM
in Header: <script src="http://www.x3dom.org/release/x3dom.js"></script> <link rel="stylesheet" . . . </scene> </x3d> <x3d width='500px' height='400px'> <scene> <shape> . . .
1K - last updated 2019-06-29 23:55 by Au-Roma
XLVI
<center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" height="700" . . . src="https://sketchfab.com/models/65a825dbcf694801968adfbf823a4148/embed?autospin=0.2&autostart=1&transparent=1&ui_related=0" . . . src="https://sketchfab.com/models/e198edf528164788910136043bec0f78/embed" frameborder="0" allowvr . . .
1K - last updated 2017-09-15 23:44 by Au-Danae
YojimboPotatoes
[[Food]] ==Yojimbo Potatoes== Ingredients: 1.5 pounds small red potatoes 2 tablespoons olive oil .5 sprig . . . five minutes to prevent sticking. Bake for 25 minutes. Toss in bacon, being sure to cover evenly . . .
1K - last updated 2006-01-25 13:26 by Auriea
YoshinoyaAuthenticGyudonRecipe
[[Food]] 日本 ===YOSHINOYA AUTHENTIC GYUDON, TOLD TO ME BY A VERY KNOWLEDGABLE JAPANESE GIRL{{lifted . . . is a Japanese soup base. It should be like, $1.50 for a small bottle of it. You only need a teaspoon, . . . damn good Gyudon, and it took you less than 15 minutes. If you actually make this, email me and . . .
3K - last updated 2007-08-31 20:39 by Auriea
ZBrush
DigitalSculpture ZBrush is the only application that makes me think that 3d modeling could be alright . . . * Thread about masking with alpha. http://206.145.80.239/zbc/showthread.php?t=23872&highlight=assign+polygroup . . . master > select ‘Tpose>SubT’. 5. Zbrush transfers the transformation changes from . . . review: http://www.pixologic.com/docs/index.php/Manipulating_Masks . . . creating a seamless texture . . .
14K - last updated 2014-09-17 17:07 by Auriea
ZbrushShortcuts
The following list of Shortcuts and Mouse Actions is arranged by category. For a list arranged by palette . . . * Alphas – '''F4''' * Textures – '''F5''' * Materials - '''F6''' (with cursor '''off''' . . . Preview Unified Skin - '''A''' ==Canvas and 2.5D== Reverse 2.5D brush effect - '''Alt (hold down)''' . . .
10K - last updated 2012-04-20 19:20 by Auriea
abyss
[[Quoth]] "Battle ye not with monsters, lest ye also become a monster. And remember that when you look . . . Oliver Sacks September 24, 2007 In March of 1985, Clive Wearing, an eminent English musician and musicologist . . . instantly. As his wife, Deborah, wrote in her 2005 memoir, “Forever Today”: His ability to perceive . . . . . 2:14 P.M: this time finally awake. . . . 2:35 P.M: this time completely awake,” along with negations . . . out, followed by “I was fully conscious at 10:35 P.M., and awake for the first time in many, many . . .
43K - last updated 2007-09-19 20:32 by Auriea
anarchy
PrevalentPhilosophy [[image:anarchy sign]] ''One thing that I've learned in academia is no one much cares . . . principles. - [http://www.counterpunch.org/frank05132005.html David Graeber]'' * http://en.wikipedia.org/wiki/Anarchism . . .
1K - last updated 2008-01-14 13:53 by Auriea
anatomy
SketchBook ''see also: LifeDrawing'' the differences between man and woman * http://anthropology.si.edu/writteninbone/male_female.html . . . ''"The functional anatomy of the human body as revealed . . . . . . Wing Image Collection http://www.ups.edu/x5662.xml ==Atlases== * interactive full body 3d http://www.visiblebody.com . . .
4K - last updated 2011-09-05 23:47 by Auriea
banana
[[Food]] '''Banana pancakes''' INGREDIENTS 1 cup all-purpose flour 1 tablespoon white sugar 2 teaspoons . . . freshly-grated orange zest Preheat oven to 350°. Grease and flour a standard 9 x 5 loaf pan (I . . . orange juice and zest. Pour batter into a 9x5-inch loaf pan and bake at 350° for 1 hour, or until . . . a mixer with this recipe. # Preheat the oven to 350°F. With a wooden spoon, mix butter into the mashed . . . mixture into a prepared muffin tin. Bake for 25-30 minutes. Check for doneness with a toothpick inserted . . .
3K - last updated 2007-08-31 19:31 by Auriea
beauty
ElegantMedia Here's the GutaiManifesto: "This is described as the beauty of decay, but is it not perhaps . . . its original life?" [[tube:8nxUOIAyuvw 425 350 0]] [[thumb:DorianGrayPreface|150px|right]] maja . . . etc... http://vs2.i-dat.org/unstructured03/05.html ''might be taken as an illustration of Dostoyevsky's . . . . . . at his own image for the very first time. Nikon F5; 300mm lens; 1/125 sec at f2.8; Ektachrome E100VS; . . .
5K - last updated 2018-09-10 16:13 by 78-22-179-76.access.telenet.be
biscuits
[[Food]] http://allrecipes.com/Recipe/Easy-Baking-Powder-Drop-Biscuits/Detail.aspx INGREDIENTS: 2 cups . . . whole milk DIRECTIONS: 1. Preheat an oven to 450 degrees F (230 degrees C). 2. Mix flour, baking . . . onto a cookie sheet, and bake for 12 to 15 minutes, until the tops are golden. . . .
1K - last updated 2013-06-14 10:39 by Auriea
black
[[Quoth]] Scientists create darkest color out of carbon nanotubes, hundreds of times darker than black.[http://www.chron.com/disp/story.mpl/front/5451632.html] . . . poemde, poemen> poemde= Paul Celan (1945) "Todesfuge" poemen= Paul Celan (1945) "Deadfugue" . . .
7K - last updated 2014-09-12 09:33 by Auriea
black.css
[[Empire]] @import url('https://fonts.googleapis.com/css?family=Cardo|Crimson+Text|Quattrocento|Source+Serif+Pro'); . . . 17px; font-family: 'Cardo', serif; color: #c5c5c5; } div.wrapper { padding: 80px 20px 20px 20px; . . . div.content a.url:before { } a.inter { color: #576D3B; background-color: #F6FF97; padding: 1px 2px; . . . none; border-bottom: 1px solid #96B566; border-right: 1px solid #96B566; white-space: . . . { color: #000000; } a.site { color: #555555; } a.site:before { content: url('http://www.auriea.org/images/b-l.gif'); . . .
14K - last updated 2017-02-26 09:41 by Auriea
blog
[[Writing]] i hate blogs. long live [[WhatIsAWiki|Wiki]]! entries copied from my blog's brief existence . . . * DancingDrawing * [[5YearPlan]] * BBCOresteia * [[Rijksmuseum]] . . .
1K - last updated 2017-02-12 14:52 by Auriea
blueblueelectricblue
DigitalSculpture <center><html> <div class="sketchfab-embed-wrapper"><iframe width="1080" . . . src="https://sketchfab.com/models/ed124c52c0b74232b719913f55fc077d/embed" frameborder="0" allowvr . . .
1K - last updated 2018-12-25 15:00 by Auriea.
bookbinding
SketchBooks ==The Making Of [[Book50]]== ===1.=== <html><iframe class="vine-embed" src="https://vine.co/v/MpqZaFMXgit/embed/postcard" . . . The paper I chose for [[Book50]] is a pad of Strathmore Artagain[http://www.strathmoreartist.com/product-reader/items/400-series-artagain.html] . . . class="vine-embed" src="https://vine.co/v/MpqEK5AUvvz/embed/postcard" width="320" height="320" frameborder="0"></iframe><script . . . tight enough and the style of binding allows. ===5.=== <html> <iframe class="vine-embed" src="https://vine.co/v/MpbhgITIn5T/embed/postcard" . . .
8K - last updated 2014-06-02 17:08 by Auriea
breathe
ProofOfMyExistence ''see also: exercise, yoga, meditation'' http://www.youtube.com/results?search_query=yoga+breath&aq=f . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/WjbMB5IEUFI&hl=en_US&fs=1&"></param><param . . . src="http://www.youtube.com/v/WjbMB5IEUFI&hl=en_US&fs=1&" type="application/x-shockwave-flash" . . . allowfullscreen="true" width="480" height="385"></embed></object></html> Pranayama . . . [http://www.angelfire.com/ny5/shenandoah/OBB/OBB.html . . .
5K - last updated 2010-07-03 00:49 by Auriea
ceremony
SongBook <html> <object width="425" height="355"><param name="movie" value="http://www.youtube.com/v/rF9xO2Tpwzs&rel=1"></param><param . . . wmode="transparent" width="425" height="355"></embed></object> </html> . . .
2K - last updated 2007-11-12 00:30 by Auriea
clock
[[Quoth]] Clocks by lsaac Asimov Through most of history, people hardly felt the need of clocks. It seemed . . . hour a day. No clock in existence, up through 1656, could measure short intervals of time accurately, . . . clocks of ancient and medieval times. In the 1590s, for instance, the Italian scientist Galileo measured . . . To go further, more was needed. Yet in 1582, Galileo (then a teenager) had noticed the swaying . . . more regularly than with the weights alone. In 1656 the Dutch astronomer Christian Huygens first devised . . .
6K - last updated 2007-08-31 14:49 by Auriea
color
[[Reference]] ''see also: FavoriteColor'' [::DeadColor] The first layers of paint the artist applies . . . ==historic colors== * verdigris ----- http://0to255.com/ ----- R: 249, G:244, B:006 Cadmium Lemon R: . . . G:167, B:016 Cadmium Yellow R: 231, G:129, B:053 Cadmium Orange R: 225, G:036, B:066 Cadmium Red . . . Blue R: 001, G:118, B:188 Cobalt Blue R: 069, G:057, B:140 Deep Cobalt Blue R: 053, G:079, B:151 French . . . Ultramarine R: 047, G:058, B:127 Prussian Blue R: 008, G:014, B:019 Indigo . . .
2K - last updated 2013-01-16 12:15 by Auriea
computer history
[[Empire]] ==prehistory== # brother or sx-70 ?? something (i was 8) # commodore vic 20 !! <3 # mac . . . City - Power Computing, Power Tower Pro 225 # IO - Powerbook 2400 # Europa - Powerbook "Wallstreet" . . . Pro 2.33Ghz Intel ## Antonius and Faustina - 500 GB drive # IO II and JUPITER - !MacBook Pro i7 . . . x201t Tablet PC # Mercury - !MacBook Air 13" i7 256 (mid 2013) acquired Feb 2014 # ATLAS - iMac 27"(late . . . 2013) 3,5GHz i7 acquired Apr 2014 # Danae + Dante - Alienware . . .
2K - last updated 2024-12-20 15:29 by Au
css
/* @override http://auriea.org/?* */ @import url('https://fonts.googleapis.com/css?family=Quattrocento+Sans|Quattrocento|Cutive . . . html{ background-color: rgb(255, 179, 179); } body { background-color:rgba(255, . . . 'Quattrocento Sans', mono; color: rgb(52, 56, 203); } div.wrapper { padding: 0px 20px 20px . . . justify; text-justify: inter-word; padding: 5px 0px; margin: 30px; } div.content.printable.index{ . . . bold; } /* @group A's */ a.url { color: rgb(52, 56, 203); text-decoration:none; font-family: 'Quattrocento+Sans', . . .
15K - last updated 2022-03-21 12:38 by Au
cuirass
<html><iframe src="https://poly.cam/capture/409D21F1-0416-499A-84A1-3CBFB781A1AC/embed" title="polycam . . . src="https://poly.cam/capture/37384F8E-C852-4A40-9B9D-D0DA5F54D985/embed" title="polycam capture . . .
1K - last updated 2024-09-02 19:26 by Auriea
era
[[日本語]] * 645 大化 Taika * 650 白雉 Hakuchi * 654 (Discontinued) * 672 白鳳 Hakuhō * 686 . . . Taihō * 704 慶雲 Keiun * 708 和銅 Wadō * 715 霊亀 Reiki * 717 養老 Yōrō * 724 神亀 Jinki . . . * 749 天平勝宝 Tempyō-shōhō * 757 天平宝字 Tempyō-hōji * 765 天平神護 Tempyō-jingo . . . 834 承和 Jōwa or Shōwa * 848 嘉祥 Kajō * 851 仁寿 Ninju * 854 斉衡 Saikō * 857 天安 Tennan . . . * 859 貞観 Jōgan * 877 元慶 Genkei or Gangyō * 885 . . .
6K - last updated 2005-06-29 09:29 by wof
exercise
[[Reference]] ''see also: breathe, yoga, meditation, scoliosis'' this series is a little crazy: <html> . . . <object width="640" height="385"><param name="movie" value="http://www.youtube.com/v/7xctBhj7TVc?fs=1&hl=en_US&color1=0x234900&color2=0x4e9e00"></param><param . . . allowfullscreen="true" width="640" height="385"></embed></object> <object width="480" . . . height="385"><param name="movie" value="http://www.youtube.com/v/aZyuvVPDLfk&hl=en_US&fs=1?color1=0x402061&color2=0x9461ca"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> <object width="480" . . .
6K - last updated 2011-03-21 18:10 by Auriea
father
CastOfThousands Full fathom five thy father lies; Of his bones are coral made; Those are pearls that . . . Indpls Star], December 8, 2005 Survivor's memories of Pearl Harbor vivid Only 1 . . . remembrance By Will Higgins December 8, 2005 William Harvey was the only Pearl Harbor survivor . . . Pearl Harbor Survivors Association, founded in 1958, estimates there are fewer than 9,000 survivors . . . living. About 5,800 remain members of the group, down from a high . . .
7K - last updated 2007-12-19 16:40 by Auriea
flowers
ElegantMedia ==The Language of Flowers.== Flowers may be combined and arranged so as to express even . . . and Myrtle. A confession of love. ----- 242 . 055 . blumensprache o\ - - - Blumensprache - http://membank.org/biosemiotics/blumensprache.html . . . - Netochka Nezvanova f 3.MASCHIN3NKUNST smtp55o@m9ndfukc.com 17.hzV.tRL.478 e | | +----- | | < . . .
11K - last updated 2005-12-18 11:32 by Auriea
fungi
[[Botany]] * http://farm1.static.flickr.com/70/184447593_9da0683176.jpg http://faculty.cmsu.edu/myxo/Dcancellatum.htm . . . * [[tube:g5zTX1fn-38 425 353 0]] * http://www.flickr.com/photos/myriorama/sets/1241134/ . . .
1K - last updated 2007-08-31 12:13 by Auriea
grains
SongBook The guitar is in standard tuning but with a Capo on fret 3, all of the tab is in to the capo . . . -5-------5-------5-------5-------0-------0-------0-------0-------| . . .
1K - last updated 2009-03-07 23:14 by Auriea
groworld
hexagons <html> <object width="400" height="500"> <param name="flashvars" value="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Ffoam%2Fsets%2F72157610724467408%2Fshow%2F&page_show_back_url=%2Fphotos%2Ffoam%2Fsets%2F72157610724467408%2F&set_id=72157610724467408&jump_to="></param> . . . . . . width="400" height="500"></embed></object> </html> . . . [http://www.personal.psu.edu/faculty/j/e/jel5/biofilms/rhizosphere.html] (part of the soil) ''The . . . where they're needed; playing a species - 5 types of seeds (based on guild functions), that grow . . .
10K - last updated 2009-05-21 19:06 by Auriea
gttgaatgggcggatgctaattactatctcccgaaagaatccgcatacca
<pre> Séquence de nucléotides de l'ADN du bactériophage lambda (48502 nucléotides, MM=31,5Md) . . . 051ggcgtttccgttcttcttcgtcataacttaatgtttttatttaaaatacc . . . 151ctgtcgtttcctttctctgtttttgtccgtggaatgaacaatggaagtca . . . 251aactggcaggaacagggaatgcccgttctgcgaggcggtggcaagggtaa . . . 351atgctgaaattgagaacgaaaagctgcgccgggaggttgaagaactgcgg . . .
53K - last updated 2004-12-23 22:04 by Auriea
hanafuda
[[cards]] Hanafuda (花札) are playing cards of Japanese origin, used to play a number of games. The . . . Matsu Pine 2 Normal (1 point), 1 Poetry Ribbon (5 points) and 1 Special: Crane and Sun (20 points) . . . blossoms 2 Normal (1 point), 1 Poetry Ribbon (5 points) and 1 Special: Warbler in a Tree (10 points) . . . blossoms 2 Normal (1 point), 1 Poetry Ribbon (5 points) and 1 Special: Sakura Banner (20 points) . . . April Wisteria 2 Normal (1 point), 1 Red Ribbon (5 points) and 1 Special: Cuckoo in a Tree (10 points) . . .
3K - last updated 2007-08-13 13:57 by Auriea
handscroll
[[Research]] emaki 絵巻 Also called emakimono 絵巻物, or less commonly, *ekotoba 絵詞. Painting . . . Many emaki average 10m in lenghth and around 25cms in width, but there are no fixed dimensions. The . . . 小絵) was painted, often by amateurs. In the 15c emaki received new impetus from the creative talents . . . of Tosa Mitsunobu 土佐光信 (1434-1525) and continued to be painted, by *Tosaha 土佐派 . . .
6K - last updated 2005-06-21 10:18 by Auriea
hologram
[[Reference]] * Rabbit Holes™ - http://rabbitholes.com/ A RabbitHole is a 3D Motion Hologram printed . . . . . .
1K - last updated 2008-08-08 12:16 by Auriea
home
OutsideSomeplace ''see also: [[Twitter]], [[5yearplan]]'' cities that i have called home [[Indianapolis]], . . .
1K - last updated 2017-03-03 15:10 by Au-Danae
hotglue
* https://hotglue.me/manual#manual.head.130934635562 * https://www.favicon.cc . . .
1K - last updated 2021-03-03 01:43 by Auriea
html5
[[Reference]] ==making things for iPad== ==css3 tricks== http://developer.apple.com/safari/library/documentation/InternetWeb/Conceptual/SafariVisualEffectsProgGuide/Transforms/Transforms.html . . .
1K - last updated 2012-09-27 12:53 by Auriea
iBooksAuthor
[[Reference]] ''see also: Dashcode'' HTML Widget creation [http://support.apple.com/kb/HT5068] Best practices . . . using 3d models [http://support.apple.com/kb/HT5093] ==humanitarian assistance== Apple discussion . . .
1K - last updated 2012-06-15 13:34 by Auriea
iceland
OutsideSomeplace http://farm4.static.flickr.com/3403/3220856292_ee834ca8c2.jpg http://farm4.static.flickr.com/3350/3220857040_48e56f5eeb.jpg . . .
1K - last updated 2010-04-06 00:10 by Auriea
instagram
<html> <blockquote class="instagram-media" data-instgrm-version="7" style=" background:#FFF; . . . box-shadow:0 0 1px 0 rgba(0,0,0,0.5),0 1px 10px 0 rgba(0,0,0,0.15); margin: 1px; max-width:658px; . . . padding:0; width:99.375%; width:-webkit-calc(100% - 2px); width:calc(100% . . . line-height:0; margin-top:40px; padding:50% 0; text-align:center; width:100%;"> <div . . . . . .
2K - last updated 2017-06-27 11:34 by Au-Mercury
itouch
[[Reference]] ==microphones== * http://www.griffintechnology.com/products/smarttalk (then i can hook . . . http://forums.macrumors.com/showthread.php?t=606567 ==get!== * eliss * lia's app * http://www.memo.tv/msaremote_for_iphone . . .
1K - last updated 2010-05-06 20:40 by Auriea
jewelry
[[Projects]] * Naoko Ogawa (berlin/japan) http://graphics8.nytimes.com/images/blogs/themoment/posts/12308nytogawa1_n.jpg . . . Mateu (spain) http://farm4.static.flickr.com/3215/3128227227_941fe07ccb_m.jpg http://www.raraavisnidus.com/ . . .
1K - last updated 2017-02-27 17:33 by d5152d4e4.static.telenet.be
kimono
[[日本語]] '''How to Make a Kimono''' You may expect making a kimono to be relatively difficult, after . . . ribcage from one side to the other. Add about 5 inches for moderate fullness and another 2 for hemming. . . . is the width of the front pieces, but add about 5" to each side to allow for overlap and modesty. If . . . and front flap. You will want this piece about 5 inches wide (3" for the collar, 2" for hem). If you . . .
5K - last updated 2005-08-04 11:31 by wof
math
[[Reference]] ==Pi== [[image:Pi]] http://numbers.computation.free.fr/Constants/Pi/piCompute.html http://www.numberworld.org/misc_runs/pi-5t/details.html . . .
1K - last updated 2012-06-29 21:10 by Auriea
meditation
[[Reference]] ''see also: breathe, exercise, yoga, SacredGeometry'' http://www.youtube.com/user/yogayak#grid/user/F2C08449BC287BC5 . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/Tu-qZugHXfc&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> How . . . . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/p/603BD0B03E12F5A1&hl=en_US&fs=1"></param><param . . .
2K - last updated 2010-06-18 09:58 by Auriea
moon
[[Reference]] ''see also:time'' ||January|| Wolf Moon || ||February|| Snow Moon || ||March|| Worm Moon . . . [Polydeuces]is an example of a so-called Trojan . . .
3K - last updated 2007-01-13 21:57 by Auriea
nihongo-month
[[日本語]] || January || いちがつ ||睦月 (むつき)|| || February || にがつ ||如月 or . . . ||3||三日||みっか||4||四日||よっか|| ||5||五日||いつか||6||六日||むいか|| ||7||七日||なのか||8||八日||よううか|| . . . ||15||十五日||じゅうごにち||16||十六日||じゅうろくにち|| . . . ||25||二十五日||にじゅうごにち||26||二十六日||にじゅうろくにち|| . . .
3K - last updated 2005-06-13 10:47 by Auriea
numbers
[[Reference]] [[image:404]] <center>[[33]]</center> http://www.geocities.com/rmlyra/Numbers.html . . . http://3.141592653589793238462643383279502884197169399375105820974944592.com . . . of colors sufficient to color all planar maps. 5 is the number of Platonic solids. 6 is the smallest . . . numbers relatively prime to n smaller numbers. 15 is the smallest composite number n with the property . . . by all numbers less than its square root. 25 is the smallest square that can be written as a sum . . .
74K - last updated 2014-05-30 12:49 by Auriea
nyc
OutsideSomeplace ''lived in: 1989-1999'' [[image:GoingForthByDay]] ==next time== * TheMet, of course . . . [http://www.themorgan.org/visit/default.asp]: 225 Madison Avenue at 36th Street, New York, NY 10016 . . . are open Tuesday through Thursday: 10:30 a.m. to 5 p.m. Friday: 10:30 a.m. to 9 p.m. Saturday: 10 a.m. . . . Bowland exhibition: Driscoll Babcock Galleries, 525 W. 25th Street, New York, New York 10001 ** GALLERY . . . York, NY 10036-6603 * Drawing Center Location 35 Wooster Street, New York, NY, 10013 Hours Wednesday . . .
4K - last updated 2014-11-03 18:47 by Auriea
occult
[[mythology]] ''see also: TheUniverse, AncientReligions'' http://www.rinf.com/e-books/magick_books.html . . . <html> <object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/oqb6ndaHvO4&hl=en"></param><param . . . wmode="transparent" width="425" height="344"></embed></object> </html> . . .
1K - last updated 2010-11-23 13:26 by Auriea
ooOOooOOooOO
<html><object width="625" height="553"><param name="movie" value="http://www.youtube.com/v/gbXrdOwDlGc&rel=1"></param><param . . . wmode="transparent" width="625" height="553"></embed></object></html> . . .
1K - last updated 2007-10-07 11:41 by Auriea
painters
[[painting]] see also: Sculptors ==Old Masters== # Velazquez [http://www.metmuseum.org/special/Manet_Velazquez/frenchtaste_images.htm] . . . Yuqi Wang] !! [http://www.aprilgornik.com . . . * Nicola Samori [[tube:PRLI5GboG1s 320 240 0]] [[tube:-X7MEqCndlY 320 240 0]] . . .
2K - last updated 2014-09-11 11:23 by Auriea
pancakes
[[Food]] The recipe for u pancake peeps: 12 Tbsp dry (brown rice/tapioca/buckwheat/flax) +1Tbsp sugar+1tsp . . . + 1egg + 3/4 cp wet (yogurt/milk) 30 Jul 2009 19:50:14 via @zoecello . . .
1K - last updated 2009-07-30 20:11 by Auriea
particles
[[日本語]] I. Japanese particles are always attached to other words, phrases, and clauses, and act . . . I want to study, but don't have the time. (5) すこし さむい が がいとう を きない。 . . . Ichinen ni kanji o gohyaku naraimasu. I learn 500 Kanji per year. h. Following nouns ni indicates . . . ni komarimashita. I was troubled for an answer. 5. E a. Following nouns e indicates direction or place . . . I bring back. (4) Aruite kuru. I came walking. (5) Katte kuru. I go and buy. (6) Mite kuru. I go and . . .
40K - last updated 2005-06-13 00:06 by Auriea
pd
Open Frameworks plus PD https://forum.pdpatchrepo.info/topic/11259/ofelia-pd-external-library-written-with-openframeworks . . . https://forum.pdpatchrepo.info/uploads/files/1518488138074-objectlist.pdf . . .
1K - last updated 2019-07-07 13:16 by Auriea
perfect
[[Quoth]] == On seeing the 100% perfect girl one beautiful April morning== by HarukiMurakami One beautiful . . . experienced love again, sometimes as much as 75% or even 85% love. Time passed with shocking swiftness, . . .
8K - last updated 2005-06-16 09:46 by Auriea
photographers
CastOfThousands * William Eggleston [http://www.interviewmagazine.com/art/william-eggleston/] [http://www.egglestontrust.com/] . . . . . .
1K - last updated 2009-02-02 02:12 by Auriea
photography
ElegantMedia http://farm4.static.flickr.com/3397/3203934691_f52381bb57.jpg * polaroid * MediumFormat . . . ** [[MamiyaC3]] ** YashicaMAT ** BrownieBox * [[35mm]] ** CanonTX ** Olympus point n shoot * TheFourByFive . . . i used to shoot: * Polapan400 Type 72 * Type 55 <list "photography"> . . .
2K - last updated 2010-07-05 17:51 by Auriea
phreaking
SecretWriting Van Eck Phreaking is the name for a surveillance technology which is, that intelligence . . . Van Eck Phreaking] ------ http://www.phrack.org . . .
2K - last updated 2006-12-31 11:47 by Auriea
poetry
[[writing]] <html> <object id="thoughtphoto" style="margin:0; padding:0; overflow-y:hidden; . . . to write a sonnet [http://www.ehow.com/how_3335_write-sonnet.html] ---- <list "poetry"> . . .
2K - last updated 2013-01-07 12:34 by Auriea
portrait
[[Research]] [[Img:11th century portrait]] [[Img:12th century portrait]] [[Img:13th century portrait]] . . . [[Img:14th century portrait]] [[Img:15th century portrait]] [[Img:16th century portrait]] . . .
1K - last updated 2010-01-30 17:26 by Auriea
private.js
[[Reference]] <source> function translate() { thisText = document.forms[0].input.value.toLowerCase(); . . . . . .
2K - last updated 2008-01-11 14:55 by Auriea
procrastination
ProofOfMyExistence [[image:procrastination-image]] "... Dr. Piers Steel is probably the world's foremost . . . 691 other research sources. ''see also: [[2005-01-24_The_Most_depressing_Day_of_the_Year]]'' . . .
3K - last updated 2007-01-13 21:56 by Auriea
prozac
[[Quoth]] prozak{{as told by "Yasir Husain" on syndicate 2005-11-02 (Subject:Re: [syndicate] \\ O R D . . .
1K - last updated 2005-11-03 14:00 by Auriea
python
==Basics== * https://opentechschool.github.io/python-beginners/en/getting_started.html#what-is-python-exactly . . . * https://www.reddit.com/r/programming/comments/5manuj/python_poetry_generator_in_150_lines/ * https://www.kaggle.com/paultimothymooney/poetry-generator-rnn-markov/code . . .
1K - last updated 2019-07-14 13:25 by Auriea
risotto
[[Food]] ===Fresh Corn Risotto with Basil, Tomato, and Lime=== ~from The Joy of Cooking 1 cup peeled . . . 1 tablespoon fresh lime juice ¼ teaspoon salt 5 cups chicken stock 2 cups corn kernels from 4 or . . . 5 large ears (I used frozen corn once and it was still . . . the foam subsides. Cook the scallions for about 5 minutes, until translucent. Keep them from browning . . . while, until the rice is almost tender, about 15 minutes. Add the puréed corn mixture with some more . . .
7K - last updated 2014-06-26 10:56 by Auriea
romance
romance |rōˈmans; ˈrōˌmans| noun 1 a feeling of excitement and mystery associated with love : in . . . dates from the mid 17th cent. ----- [[2006-01-15]] Our next original project is to make a romantic . . .
4K - last updated 2006-12-25 22:00 by Auriea
sauna
[[Reference]] [[Gog:gent belgium sauna]] where i went with tamara: http://www.raj.be/ very nice! sauna . . . http://www.gent.be/eCache/THE/4/216.cmVjPTk5MDUw.html . . .
1K - last updated 2011-03-12 12:40 by Auriea
say
SongBook Learn to say the same thing Let us hold fast to sayin the same thing I hope all is well with . . . classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=7,0,0,0" . . .
2K - last updated 2007-06-05 17:09 by Auriea
scones
[[Food]] http://www.joyofbaking.com/SconesIntroduction.html Preheat the oven to 350 degrees Dry ingredients . . .
3K - last updated 2010-01-20 17:01 by Auriea
sea
[[Quoth]] ''see also: Ocean'' . [[vimeo:1444949 600 341 0]] . . Both elbows on the table, I covered my . . . [[background:HiroshiSugimoto-Seascapes|repeat #25e7d1]] ----- [[image:Twombly-PoemsToTheSea]] @SONG: . . .
3K - last updated 2017-02-27 18:26 by Au-Roma
seasons
[[Research]] '''Spring Begins''' The east wind melts the ice Feb 5-9 ~ Larvae twitch in their cocoons . . . upstream, breaking the ice with their backs Feb 15-19 '''Watery Rains''' River otters sacrifice fish . . . Feb 20-24 ~ Wild geese go north Feb 25-29 ~ Seedlings sprout March 1-5 '''Hibernators Awake''' . . . open March 6-10 ~ The skylark sings March 11-15 ~ Eaglehawks metamorphose into doves March 16-20 . . . Equinox''' The swallows return March 21-25 ~ Thunder lets loose its voice March 26-30 ~ The . . .
4K - last updated 2005-12-18 21:11 by Auriea
skinonskinonskin
[[Empire]] http://entropy8zuper.org/skinonskinonskin/onskin/ <html> <iframe align=center src=http://www.flickr.com/slideShow/index.gne?user_id=81482434@N00&set_id=72157594508283369 . . . frameBorder=0 width=500 scrolling=no height=500></iframe> </html> . . . 10 Euro for 5 days 100 Euro for a lifetime <source> breath.html . . . whispers[4] = "skin on skin on skin"; whispers[5] = "implode"; whispers[6] = "soft"; whispers[7] = . . . = "i want to breathe you"; whispers[15] = "we are smoke"; whispers[16] = "yesss"; whispers[17] . . .
11K - last updated 2007-01-30 17:19 by Auriea
sleep
[[Research]] # Sleep occurs in cycles of around 90-110 minutes each. Most people normally go through . . . 5 cycles during the night (7.5-8.5 hours). If you sleep . . . to be on a 4-cycle diet. # Each cycle includes 5 different stages occurring in particular order. ## . . . lasts longer than other stages - you spend 45-50% of your sleep in Stage 2. ## Stages 3 and 4 – . . . occurs in the first half of the night. ## Stage 5 – REM sleep. REM stands for Rapid Eye Movement. . . .
5K - last updated 2010-06-23 18:52 by Auriea
stemmen
[[Reference]] ==Hoe kan men geldig stemmen ?{{http://www.ibz.rrn.fgov.be/index.php?id=95&L=1 }}== . . .
1K - last updated 2010-06-13 10:48 by Auriea
swimming
<include "2005-01-11"> According to an [[Murakami_interview2|interview]] HarukiMurakami swims every . . .
1K - last updated 2005-01-11 15:17 by Auriea
syndicate
[[Empire]] http://anart.no/~syndicate http://syndicate.anart.no i became a "moderator" or "fire guard" . . . culture. In December 2001 there are around 365 subscribers to Syndicate mailing list from more than . . .
6K - last updated 2005-12-17 17:24 by Auriea
testimg
myImages[5][0] = "http://farm4.staticflickr.com/3447/3984562337_fb1ec28287_z.jpg"; myImages[5][1] = "http://farm2.staticflickr.com/1417/5125202669_dce2330777_z.jpg"; . . . myImages[5][2] = "http://farm3.staticflickr.com/2436/3985325644_b2b69df0eb_z.jpg"; . . . myImages[5][3] = "http://farm2.staticflickr.com/1071/5125813482_5805af3082_z.jpg"; . . . myImages[5][4] = "http://farm2.staticflickr.com/1172/5125808762_770179a56e_z.jpg"; . . . myImages[5][5] = "http://farm5.staticflickr.com/4066/5125811896_ec6eaf5bc8_z.jpg"; . . .
2K - last updated 2013-05-30 14:39 by Auriea
time
ElegantMedia * pagan clock http://www.archaeoastronomy.com/myclock.shtml * 10,000 year clock [http://www.longnow.org/projects/clock/prototype1/] . . . actually, i feel that i should be making clocks. . . .
2K - last updated 2010-04-08 11:12 by Auriea
tiramisu
[[Food]] '''maja's simple tiramisu recipe''' (serves about 10 ppl) 1 packet of savoiardi (italian biscuits . . . aka lange vingers in dutch) 4-5 cups of coffee 2-3 packets of vanilla sugar (or a . . . few spoonfuls of any sugar, to taste) 500g-750g of mascarpone cheese amaretto di saronno . . . ------- '''Simple Tiramisu''' (serves 6-8) 115 gram (4 oz) Bisconova savoiardi biscuits 397 gram . . . can sweetended condensed milk 500 gram (1 Lb 2 oz) Marscapone cheese 3 x 15 ml tbs . . .
2K - last updated 2006-09-01 13:16 by Auriea
topology
DigitalSculpture http://www.pig-brain.com/tut02/tut02_02.htm [[image:topology-elbowsknees]] ---- ===crisis . . . * http://forums.cgsociety.org/showthread.php?p=5101568 ===general tutorials=== * great low poly hair . . . * Bobo the Seal - http://www.bobotheseal.com/temp/WIP/ . . .
2K - last updated 2008-04-28 12:03 by Auriea
trees
[[Research]] [[background external:http://farm4.static.flickr.com/3155/2428209195_46906f733c_o.jpg|repeat . . . #845dd6]] http://farm5.static.flickr.com/4011/4521074821_20f846b0f7_b.jpg . . . http://farm5.static.flickr.com/4008/4519132068_2c517a372d_b.jpg . . .
2K - last updated 2010-04-15 11:13 by Auriea
typography
[[Research]] ==generally== http://typophile.com/ ==type Haute Couture== * hoefler - http://typography.com . . . ==other design== * Andrea Dezso http://a.parsons.edu/~andi/ . . .
1K - last updated 2008-06-27 13:28 by Auriea
videogames
ElegantMedia ''see also: MyCompleteResume'' I think older videogames have been lonely "by default". If . . . <center>[[thumb:BerniniDrawing-StPeters|250px]]</center> . . .
4K - last updated 2017-03-02 20:32 by Au-Mercury
visceral
[[Empire]] [[image:LadyInTheRadiator]] [[foreground external:http://visceral.net/autopsy/mid/02.jpg|repeat . . . http://visceral.net/autopsy http://farm5.static.flickr.com/4014/4479095654_c0f23bb7d3_z.jpg . . .
1K - last updated 2015-06-16 21:15 by Auriea
voyager
[[astronomy]] [[image:Voyager-image]] Launched thirty years ago, NASA's Voyager 1 and 2 spacecraft are . . . now respectively 15 billion and 12.5 billion kilometers from the Sun, . . . equivalent to about 14 and 11.5 light-hours distant. Still functioning, the Voyagers . . .
2K - last updated 2010-11-23 13:25 by Auriea
website
my first love. ha. ==2018== * name (home) * work ** 15-20 pieces. should show i've put effort into developing . . .
1K - last updated 2018-08-15 12:54 by Au-Mercury
worms
TuinPlanten Just adding a handful of earthworms to poor soil will probably not do much to improve it. . . . 200 sq ft garden with a worm population of only 5 worms/cubic foot will be provided with over 35 lbs . . . well managed, rich in humus may easily support 25 worms per cubic foot, which translates into at least . . . 175 lbs of fertilizer per year for the same 200 sq ft . . .
4K - last updated 2005-04-04 10:49 by Auriea
writing
ElegantMedia ''see also: CreativeWriting, [[poetry]], [[blog]]'' === hm. === WikiPedia:parataxis WikiPedia:hypotactaxis . . . 4. It is wrong to ever split an infinitive. 5. Avoid cliches like the plague. (They're old hat) . . . superfluous. 14. One should NEVER generalize. 15. Comparisons are as bad as cliches. 16. Don't use . . . correctly, irregardless of how others use them. 25. Understatement is always the absolute best way to . . .
3K - last updated 2017-02-12 14:53 by Auriea
yatate
ElegantMedia [[drawing]] http://www.stutler.cc/pens/yatate/index.html A yatate (pronounced yah-tah-teh) . . . has been around since the Kamakura period (1185-1333). It contains a traditional Japanese bamboo . . . field. Then sometime during the Kamakura era (1185-1333 ) someone came up with the clever idea of saturating . . .
2K - last updated 2008-12-26 22:55 by Auriea