1999-01-29
ProofOfMyExistence [[image:Riea-VSOP]] <tt>y must get tripod... just a sec [fakeshop]: telephone . . . now gate: actually its the camera gate: i am 13 like antiorp life: hehe signmonger: from sweden...long . . . Campari's and vomits all over the place :) lia: 3? gate: lovely life: there's her mother at the back... . . . = 0.6, gate = 0.4, fake = 0.1 zuper: wof now 4.3 life: yours ? [fakeshop]: (private) dont you think . . . yes !!! :) life: someone is doing black new G3's... signmonger: and square....compartmentalised. . . .
32K - last updated 2018-09-11 12:03 by Auriea.
1999-01-30
http://entropy8zuper.org/skinonskinonskin/onskin/breath.html . . .
1K - last updated 2007-01-30 13:31 by Auriea
1999-03-18
L-O-V-E spells love. . . .
1K - last updated 2013-03-18 15:50 by Auriea
1Q84
So funny, it took me 7 months to get through books 1 and 2 and then I breezed through book 3 in just . . .
2K - last updated 2013-01-07 11:54 by Auriea
2003-01-08
it is a funny thing, being married. i want nothing more than for us to be flowers together. ----- for . . .
2K - last updated 2013-01-08 20:38 by Auriea
2004-06-02
[[Diary]] my 33rd birthday. michael brought me huge lilies http://entropy8.com/live/index.php?dir=loot . . .
1K - last updated 2004-09-22 09:13 by wof
2004-11-04
http://womanonfire.livejournal.com/633234.html i thought i would never write here again but, here goes. . . .
4K - last updated 2012-06-05 13:49 by Auriea
2005-01-24 The Most depressing Day of the Year
==i don't feel so well. i think i have people poisoning.== the problem with people is that the talk too . . . formula for the day of misery reads 1/8W+(D-d) 3/8xTQ MxNA. <tt>Where W is weather, D is debt . . . background=http://www.askart.com/photos/sny5132003/5.jpg></html> . . .
3K - last updated 2005-01-25 19:30 by wof
2005-02-04
[[sound:test.mp3]][[sound:test.mp3]][[sound:test.mp3]] . . .
1K - last updated 2005-02-04 21:46 by wof
2005-02-09 The Day After
now it is The Day After I have a little headache from all the verdoving It was a strange way to spend . . . a day by 10:30 they had wheeled me into the operating room and . . .
1K - last updated 2006-06-05 10:26 by Auriea
2005-03-12 Middle Passage
Not much survived the move from New York to Gent. I am not sure how I chose which memories to keep, which . . . of my age hate it too or do many more people of 33 embrace the past and love feeling sentimental. i . . .
2K - last updated 2006-06-02 20:21 by Auriea
2005-03-18
today is our anniversary :) http://entropy8zuper.org/godlove/6years.html i guess we still love the net. . . . i put up the mp3s as an audio stream for two days only. in more evidence . . .
1K - last updated 2005-03-18 13:24 by me
2005-03-20 Love the poem, not the poet
I don't know why life has to be the way it is. i am not sure what force is at work. i do not pretend . . .
1K - last updated 2005-03-20 15:02 by me
2005-03-23 forsaken
My big monitor that i won in 1996 died today. Very sad, and now i am stuck working on a fuzzy and far . . .
2K - last updated 2005-03-23 20:17 by Auriea
2005-03-25 Last night's dream
I was still with Marc. I was looking at red stipples on his back he was white almost blue. I had different . . .
1K - last updated 2005-03-25 12:36 by Auriea
2005-03-26
spent the day making a new [[sketchbook]]. i was just in the mood. it is all uneven. i am calling it . . .
1K - last updated 2005-03-26 23:52 by Auriea
2005-03-30
i am paralyzed. -no you're not. . . .
1K - last updated 2006-06-13 17:31 by Auriea
2005-03-31
don't you dare be afraid now. i cleaned the koer but good today. it needs a table. i would love to spend . . .
1K - last updated 2005-03-31 22:03 by Auriea
2005-07-03 accidents happen
image/jpeg
66K - last updated 2006-06-19 21:11 by Auriea
2005-07-03 grr
image/jpeg
105K - last updated 2005-07-03 19:21 by Auriea
2006-02-17 3stags
image/jpeg
64K - last updated 2007-05-06 14:32 by Auriea
2006-03-13 sick of people heres an owl
image/jpeg
20K - last updated 2006-12-29 16:34 by Auriea
2006-03-31 PERFKT
image/jpeg
32K - last updated 2006-03-31 18:38 by Auriea
2006-04-30 deertile from chad
image/jpeg
53K - last updated 2006-05-02 20:01 by Auriea
2006-05-08 one last thing
3am normally i would be going to bed about now but instead i'm waking up and getting on a plane. so just . . . about encapsulated.... the condensed version of 34 years. maybe its the lack of sleep, if Michael's . . .
2K - last updated 2006-05-08 03:16 by Auriea
2006-05-30 muse 12h48
it occurs to me most accutely this day that my biggest problem is that i don't know what i want. that . . . a frog. both are very lovely. and to an amature 3d modeler like me, inspiring. . . .
1K - last updated 2006-05-30 12:51 by Auriea
2006-06-02
My 35th birthday. Michael brought me 8 of the most beautiful roses. They were pink at the middle and . . .
1K - last updated 2006-06-13 19:59 by Auriea
2006-06-10 08h37 Adam drawing
image/jpeg
145K - last updated 2006-06-17 21:10 by Auriea
2006-06-18 20h36 OFDW17-honglyfinal
image/jpeg
129K - last updated 2006-06-19 09:27 by Auriea
2006-06-30 21h25 Our Little Girl
image/jpeg
146K - last updated 2006-07-09 22:29 by Auriea
2006-07-03 20h45 limits of two revisited
image/jpeg
276K - last updated 2013-01-01 16:50 by Auriea
2006-07-07 22h30 OFDW18-Waterhouse-Circe
image/jpeg
75K - last updated 2006-12-26 17:33 by Auriea
2006-07-09 11h38 FiftyHeads-096-detail
image/jpeg
102K - last updated 2006-07-09 12:41 by Auriea
2006-07-12 01h13 FiftyHeads-096
image/jpeg
125K - last updated 2006-07-12 01:13 by Auriea
2006-08-02
[[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060801_maybesilenthill.flv|320|240|#000000|high|noscale]] . . .
1K - last updated 2006-08-02 04:30 by Auriea
2006-08-03
[[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060803-silenthill5.flv|320|240|#000000|high|noscale]] . . .
1K - last updated 2006-08-03 13:51 by Auriea
2006-11-23
http://www.bigproductions.fr/video_promo/doncavalli/video1.flv . . .
1K - last updated 2006-11-23 14:57 by Auriea
2006-11-24 00h13 dry vine
image/jpeg
46K - last updated 2006-11-24 01:13 by Auriea
2006-11-30 Bonnie and Clyde
image/jpeg
28K - last updated 2006-11-30 13:14 by Auriea
2006-12-23 cats and dogs
image/jpeg
81K - last updated 2006-12-23 14:12 by Auriea
2007-01-09
this town at night is DESERTED i had to go out at 2:30 am looking for a pharmacy, a night shop, something, . . . (long story) and let me just say this town at 3am is ready for the zombie invasion. (i need to take . . . far off sound of a car or a person walking 3-4 blocks off in the distance but who knows, maybe . . .
1K - last updated 2007-01-09 19:34 by Auriea
2007-02-13
image/jpeg
132K - last updated 2007-02-07 15:03 by Auriea
2007-02-23
image/jpeg
323K - last updated 2007-02-23 13:21 by Auriea
2007-03-01
image/jpeg
44K - last updated 2007-03-02 00:31 by Auriea
2007-03-03
image/png
166K - last updated 2007-05-07 10:41 by Auriea
2007-03-15
RandomIdeas ==thoughts?== * talked to Android extolled the virtues of the super-large wacom tablet. he . . .
1K - last updated 2007-03-20 17:28 by Auriea
2007-03-15 gfreject1
image/jpeg
43K - last updated 2007-03-15 17:32 by Auriea
2007-03-15 gfreject2
image/jpeg
41K - last updated 2007-03-15 17:31 by Auriea
2007-03-17
RandomIdeas after seeing Even More Footage from Little Big Planet i can't help but think that this is . . .
1K - last updated 2007-03-20 17:28 by Auriea
2007-03-20
RandomIdeas games are mostly thought of as systems, as numbers. but i think we try to come at it as if . . .
1K - last updated 2007-03-20 17:27 by Auriea
2007-03-21
image/jpeg
250K - last updated 2007-03-21 20:22 by Auriea
2007-03-26
I belong in this other place. . . .
1K - last updated 2007-03-26 20:44 by Auriea
2007-05-03
image/jpeg
107K - last updated 2007-05-03 22:30 by Auriea
2007-06-13
image/jpeg
254K - last updated 2007-06-13 01:51 by Auriea
2007-06-30
image/png
9K - last updated 2007-06-30 19:46 by Auriea
2007-07-13
image/jpeg
318K - last updated 2007-07-13 18:00 by Auriea
2007-07-30
image/jpeg
126K - last updated 2007-07-30 00:40 by Auriea
2007-07-31
image/jpeg
199K - last updated 2007-07-31 09:45 by Auriea
2007-08-30 redrum
image/jpeg
95K - last updated 2007-08-30 22:54 by Auriea
2007-09-05 30MinutesOrLess
image/jpeg
127K - last updated 2007-09-05 01:41 by Auriea
2007-09-09 u92
once again too many thoughts. the fact that i am in a country which could be falling apart. my insistence . . . at a time [http://www.last.fm/forum/21717/_/323980 when i refuse to believe in flags]. got me thinking . . .
2K - last updated 2007-09-09 21:49 by Auriea
2007-10-13
image/jpeg
36K - last updated 2007-10-15 00:11 by Auriea
2007-10-31
image/jpeg
82K - last updated 2007-10-31 17:28 by Auriea
2007-10-31 again
image/jpeg
17K - last updated 2007-10-31 17:34 by Auriea
2007-11-03
image/gif
100K - last updated 2007-11-03 21:43 by Auriea
2007-11-23
image/jpeg
79K - last updated 2007-11-23 19:02 by Auriea
2007-12-13
image/jpeg
126K - last updated 2007-12-13 14:38 by Auriea
2007-12-31
image/jpeg
303K - last updated 2007-12-31 12:23 by d54C6FF9F.access.telenet.be
2007-12-31 song of the year
image/jpeg
208K - last updated 2008-01-01 15:11 by Auriea
2008-01-13
image/jpeg
138K - last updated 2008-01-13 20:29 by Auriea
2008-01-31
image/jpeg
156K - last updated 2008-01-31 11:35 by Auriea
2008-01-31-2
image/jpeg
13K - last updated 2008-01-31 20:33 by Auriea
2008-02-03
image/jpeg
81K - last updated 2008-02-03 14:04 by Auriea
2008-02-03-2
image/jpeg
50K - last updated 2008-02-03 14:12 by Auriea
2008-03-05
image/jpeg
70K - last updated 2008-03-05 01:46 by d54C6FF9F.access.telenet.be
2008-03-05-02
image/jpeg
181K - last updated 2009-01-10 18:18 by Auriea
2008-03-09
image/jpeg
33K - last updated 2008-03-09 01:44 by d54C6FF9F.access.telenet.be
2008-03-10
image/jpeg
105K - last updated 2008-03-10 16:21 by d54C6FF9F.access.telenet.be
2008-03-10-02
image/jpeg
149K - last updated 2008-03-11 00:14 by d54C6FF9F.access.telenet.be
2008-03-11 00h20
image/jpeg
92K - last updated 2008-03-11 02:20 by d54C6FF9F.access.telenet.be
2008-03-11 11h32
image/jpeg
103K - last updated 2008-03-11 13:32 by d54C6FF9F.access.telenet.be
2008-03-15
image/jpeg
34K - last updated 2009-01-22 21:31 by Auriea
2008-03-19
image/jpeg
138K - last updated 2008-03-19 18:17 by d54C6FF9F.access.telenet.be
2008-03-29 18h36 SomewhereInTheMiddleLiesTheTruth
image/jpeg
207K - last updated 2008-03-29 21:06 by d54C6FF9F.access.telenet.be
2008-03-31 15h27 architecture
image/jpeg
171K - last updated 2008-03-31 22:31 by d54C6FF9F.access.telenet.be
2008-04-23
image/jpeg
38K - last updated 2008-04-23 22:18 by Auriea
2008-04-24 20h30 part2
image/png
29K - last updated 2008-04-24 22:31 by Auriea
2008-06-12 3
image/png
115K - last updated 2008-06-12 21:32 by Auriea
2008-06-13
image/jpeg
69K - last updated 2008-06-13 19:05 by Auriea
2008-07-03
image/jpeg
79K - last updated 2008-07-03 01:06 by Auriea
2008-07-13
image/jpeg
42K - last updated 2008-07-13 02:11 by Auriea
2008-09-23
image/png
33K - last updated 2008-09-23 12:34 by Auriea
2008-09-23 2
image/jpeg
232K - last updated 2008-09-23 14:31 by Auriea
2008-09-30
image/jpeg
39K - last updated 2008-09-30 14:21 by Auriea
2008-10-13
image/jpeg
45K - last updated 2008-10-13 13:46 by Auriea
2008-10-23
image/jpeg
41K - last updated 2008-10-23 12:31 by Auriea
2008-10-23 postulating theories formulating equasions
image/jpeg
63K - last updated 2008-10-23 12:50 by Auriea
2008-10-23 theres ones who are liars and those who dont know
image/jpeg
32K - last updated 2008-10-23 22:28 by Auriea
2008-11-03 fail
image/png
112K - last updated 2008-11-04 00:50 by Auriea
2008-11-13 GQmagazine
image/jpeg
81K - last updated 2008-11-13 18:31 by Auriea
2008-12-31 00h07 done
image/jpeg
261K - last updated 2008-12-31 02:40 by Auriea
2009-01-23
image/jpeg
110K - last updated 2009-01-23 22:56 by Auriea
2009-01-30
10 years. [[1999-01-29]], [[1999-01-30]] . . .
1K - last updated 2009-01-30 02:05 by d54C6FB6D.access.telenet.be
2009-02-13 hetparadijs-part2
image/jpeg
149K - last updated 2009-02-14 00:27 by Auriea
2009-03-03
image/jpeg
140K - last updated 2009-03-03 11:25 by Auriea
2009-03-10
image/jpeg
128K - last updated 2009-03-10 17:53 by Auriea
2009-03-11
image/jpeg
520K - last updated 2009-03-11 23:23 by Auriea
2009-03-17
image/jpeg
23K - last updated 2009-03-17 11:46 by Auriea
2009-03-17 thetaleofhow
image/jpeg
83K - last updated 2009-03-17 11:58 by Auriea
2009-03-20
image/jpeg
108K - last updated 2009-03-20 17:05 by Auriea
2009-03-21
image/jpeg
166K - last updated 2009-04-05 23:43 by Auriea
2009-03-24
image/jpeg
51K - last updated 2009-04-02 18:58 by Auriea
2009-03-30 gdc notes
<html><object width="480" height="295"><param name="movie" value="http://www.youtube.com/v/UcC9-HYX1Ek&hl=en&fs=1&color1=0x5d1719&color2=0xcd311b"></param><param . . . type="application/x-shockwave-flash" allowscriptaccess="always" . . . his slide: http://farm4.static.flickr.com/3426/3391916861_5ae5d64235.jpg Indeed it was a big . . . this is a goal. http://farm4.static.flickr.com/3618/3391916775_0ed0bf1bf4.jpg . . .
2K - last updated 2009-03-30 11:41 by Auriea
2009-06-03
image/jpeg
47K - last updated 2009-06-03 23:41 by Auriea
2009-11-13
image/jpeg
102K - last updated 2009-11-18 01:50 by Auriea
2010-03-01
image/jpeg
44K - last updated 2010-03-01 19:13 by Auriea
2010-03-25
[[image:2010-03-25_tarot]] tarot tries to make me feel better about work and all the critical children . . .
1K - last updated 2017-05-12 09:43 by Au-Danae
2010-03-25 paper universe
image/jpeg
164K - last updated 2010-03-25 19:49 by Auriea
2010-03-25 tarot
image/jpeg
129K - last updated 2017-05-12 09:47 by Au-Danae
2010-04-30
image/jpeg
125K - last updated 2012-09-18 11:30 by Auriea
2010-06-13 at 2009-47-36
image/jpeg
182K - last updated 2010-06-13 10:00 by Auriea
2010-06-30 myjrockfandom
image/jpeg
122K - last updated 2010-06-30 20:35 by Auriea
2010-07-03 painting
image/jpeg
103K - last updated 2010-07-03 21:29 by Auriea
2011-01-03
image/jpeg
285K - last updated 2011-01-03 19:17 by Auriea
2011-01-24
http://farm6.static.flickr.com/5217/5384081289_0c2f98d18c.jpg http://farm6.static.flickr.com/5220/5384685608_f29334f390.jpg . . .
1K - last updated 2011-01-24 18:09 by Auriea
2011-03-28 thinkpad EurekaMaru
image/jpeg
357K - last updated 2011-03-29 10:56 by Auriea
2012-03-12
sunny :) getting back to organized existence after the trip to trouville last week, which threw my schedule . . . . . .
1K - last updated 2012-03-16 19:57 by Auriea
2012-06-06 Transit of Venus
[[image:Book43_transit]] . . .
1K - last updated 2012-06-07 13:40 by Auriea
2012-10-30 the day ahead
image/jpeg
601K - last updated 2012-10-30 11:22 by Auriea
2012-11-13
[[image:Book45_CoverTemp]] . . .
1K - last updated 2012-11-22 12:01 by Auriea
2012-12-31
image/jpeg
49K - last updated 2013-01-01 16:40 by Auriea
2013-01-01 resolutions
to continue the [[drawing]] of recent years. to expand the [[sculpture]] quotient of my creative life. . . .
1K - last updated 2013-01-01 17:02 by Auriea
2013-01-01 studio sculpture
image/jpeg
70K - last updated 2013-01-01 16:45 by Auriea
2013-01-08
image/jpeg
1257K - last updated 2013-01-08 20:49 by Auriea
2013-01-18
image/jpeg
182K - last updated 2013-01-21 12:35 by Auriea
2013-02-24
image/jpeg
406K - last updated 2013-04-08 13:09 by Auriea
2013-07-21
image/jpeg
120K - last updated 2013-07-21 13:26 by Auriea
2013-12-18
image/jpeg
293K - last updated 2014-01-08 12:29 by Auriea
2015-08-03
image/jpeg
1227K - last updated 2015-08-07 13:30 by Auriea
2016-12-23-SelfPortrait
image/jpeg
60K - last updated 2018-09-29 18:13 by Auriea
2017-03-02 ArtCasting
image/jpeg
1809K - last updated 2017-03-02 17:48 by Au-Mercury
2017-03-07
image/png
720K - last updated 2017-05-09 10:55 by Au-Mercury
2018-09-30 deadbirdnotme
image/jpeg
145K - last updated 2018-09-30 12:16 by Au-Artemis
2019-03-14
image/jpeg
588K - last updated 2019-03-15 06:14 by Au-Artemis
2019-03-15
image/jpeg
596K - last updated 2019-04-03 16:53 by Auriea
2019-03-16
image/jpeg
521K - last updated 2019-04-03 16:52 by Auriea
2019-03-21
image/jpeg
267K - last updated 2019-04-04 10:55 by Auriea
2019-12-13
image/jpeg
201K - last updated 2019-12-11 13:03 by Auriea-Mercury
23
To talk little is natural. High winds do not last all morning. Heavy rain does not last all day. Why . . .
1K - last updated 2005-11-11 12:47 by Auriea
3
Not exalting the gifted prevents quarreling. Not collecting treasures prevents stealing. Not seeing desirable . . .
1K - last updated 2004-08-11 16:42 by wof
3.jpg
image/jpeg
23K - last updated 2007-05-08 22:06 by Auriea
33
jesus died --- i lost my uterus ---- Knowing others is wisdom; Knowing the self is enlightenment. Mastering . . . is to be eternally present. <center>[[34]]--></center> . . .
1K - last updated 2014-05-30 12:49 by Auriea
34
The great Tao flows everywhere. All things are born from it, yet it doesn't create them. It pours itself . . . thus it is truly great. <center><--[[33]] - [[35]]--></center> . . .
1K - last updated 2014-05-30 12:47 by Auriea
35
She who is centered in the Tao can go where she wishes, without danger. She perceives the universal harmony, . . . it, it is inexhaustible. <center><--[[34]] - [[36]]--></center> . . .
1K - last updated 2014-05-30 12:47 by Auriea
36
That which shrinks Must first expand. That which fails Must first be strong. That which is cast down . . . should not be displayed. <center><--[[35]] - [[37]]--></center> . . .
1K - last updated 2014-05-30 12:47 by Auriea
37
Tao abides in non-action, Yet nothing is left undone. If kings and lords observed this, The ten thousand . . . things would be at peace. <center><--[[36]] - [[38]]--></center> . . .
1K - last updated 2014-05-30 12:46 by Auriea
38
The Master doesn't try to be powerful; thus he is truly powerful. The ordinary man keeps reaching for . . . and lets all illusions go. <center><--[[37]] - [[39]]--></center> . . .
1K - last updated 2014-05-30 12:46 by Auriea
39
These things from ancient times arise from one: The sky is whole and clear. The earth is whole and firm. . . . clatter like stone chimes. <center><--[[38]] - [[40]]--></center> . . .
1K - last updated 2014-05-30 12:46 by Auriea
3D
ElegantMedia [[iframe:http://auriea.com/3d/index.html|100%|900px]] . . .
1K - last updated 2018-09-10 21:04 by Auriea.
3DPrintStudio
image/jpeg
2438K - last updated 2019-02-05 01:13 by Auriea
3dPrinting
DigitalSculpture <center>[[thumb:TestPrints.jpg|600px]]</center> ==3d Printers== # FDM [[Ultimaker3]] . . . - Angel # FDM DIY [[PrusaMk3]] - Antony # SLA [[Form2]] - Momus/Papposilenus * . . . ** see also: https://all3dp.com/1/3d-printing-ceramic-3d-printer/ ==On Demand== . . . tips and tricks== * Keys [[tube:Mz4ztiZDUt8 640 360 0]] . . .
1K - last updated 2020-10-11 11:12 by 93-39-148-182.ip76.fastwebnet.it
3dSoftware
Try these on a PC * http://www.russian3dscanner.com Wrap3 * http://www.marvelousdesigner.com * quixel . . .
1K - last updated 2016-10-11 18:24 by Auriea
3dsMax
[[Reference]] 3 point lighting tutorial: http://www.3dtotal.com/team/Tutorials/Jenns3pt_tut/3ptlighting.asp . . . Manuliscious 6th January 2007, 08:43 PM This . . . now and you safed my day ;) In fact, i'm using 3ds Max 8.0 and the path is - c:\docum...\all users\applicatio...\autodesk\software . . . ==that Material ID business== [[thumb:3dsMaxMatIds|100px]] ==Units== # Customize/ Units Setup . . .
2K - last updated 2008-08-05 14:37 by Auriea
3dsMaxMatIds
image/jpeg
94K - last updated 2007-01-18 20:15 by Auriea
40
The motion of the Way is to return; The use of the Way is to accept; All things come from the Way, And . . . Way comes from nothing. <center><--[[39]] - [[41]]--></center> . . .
1K - last updated 2014-05-30 12:46 by Auriea
42
The Tao begot one. One begot two. Two begot three. And three begot the ten thousand things. The ten thousand . . . of my teaching. <center><--[[41]] - [[43]]--></center> . . .
1K - last updated 2014-05-30 12:45 by Auriea
43
The softest water breaks the hardest stone carves the block with no effort that which lacks substance . . .
1K - last updated 2017-02-11 20:01 by Auriea
44
Fame or integrity: which is more important? Wealth or happiness: which is more valuable? Success or failure: . . . world belongs to you. <center><--[[43]] - [[45]]--></center> . . .
1K - last updated 2017-02-11 20:01 by Auriea
5YearPlan
twitter notes for a plan for the next 5 years of my life. http://storify.com/auriea/5yearplan year 1: . . . #youmustchangeyourlife year 2: #doingit year 3: year 4: year 5: . . .
1K - last updated 2017-08-23 17:13 by Au-Mercury
89SecondsAtAlcazar
ElegantMedia <html> <embed src='http://ubu.artmob.ca/video/flash/player-viral.swf' height='480' . . . flashvars='state=COMPLETED&file=http%3A%2F%2Fubu.artmob.ca%2Fvideo%2Fflash%2FSussman-Eve_89-Seconds-at-Alcazar_2004.flv&plugins=viral-1d'/> . . .
1K - last updated 2009-11-30 18:56 by Auriea
AShortHistoryOfMyth
FiftyBooks Notes, since i bought the book. * Like science and technology, mythology... is not about opting . . . by Karen Armstrong''' [http://odeo.com/audio/422132/view], [http://www.amazon.com/gp/product/184195716X/104-6287722-9418308?v=glance&n=283155] . . .
14K - last updated 2012-06-07 16:15 by Auriea
AbramovicAndUlay-3
image/jpeg
24K - last updated 2006-07-11 18:33 by Auriea
Abraxas
[[mythology]] A term used by the Basilideans, a Gnostic sect of the second century, designating the Supreme . . . when computed numerically equaled the number 365, which is the number of days in the year. It was . . . further believed that Abraxas commanded 365 gods, each possessing a virtue, so there was a . . . amulets. Also, a favorite amulet bore the number 365. Later Gnostic symbols were adopted by many societies . . .
2K - last updated 2005-10-22 12:53 by Auriea
AllYouEverWantedToKnowAboutTempest
[[Tempest]] ==== All you Ever Wanted to Know About TEMPEST ==== from http://library.psyon.org/tempest.txt . . . pushed renovation costs from $1.5 million to $3 million just to ensure two US programs could not . . . plans. (.PDF format) PC Week, March 10, 1987 v4 p35(2) has an article by Vin McLellan about emanation . . . against remote access (1992 Patent number 4932057 - Parallel transmission to mask data radiation . . . about patent 5297201. It references patent 2476337 that was issued July 1, 1949. Unfortunately, the . . .
44K - last updated 2008-05-02 21:50 by Auriea
AltLJAlt
LiveJournal ==ways to backup lj== http://www.mirrorservice.org/sites/download.sourceforge.net/pub/sourceforge/l/lj/ljarchive/ . . . Leaving LiveJournal?===== [new:Auriea:2006-03-14 16:26 UTC] So, I'm seriously considering leaving . . .
4K - last updated 2009-01-08 13:49 by Auriea
Ana
CastOfThousands http://profile.myspace.com/index.cfm?fuseaction=user.viewProfile&friendID=227408394 . . . http://farm3.static.flickr.com/2463/3722815466_35162e7cdc_b.jpg . . .
1K - last updated 2010-04-14 23:40 by Auriea
Anaxagoras
[[LeonardoDaVinci]] Anaxagoras: Every thing proceeds from every thing, and every thing becomes every . . . http://interconnected.org/home/more/davinci/1473.html . . .
1K - last updated 2008-12-14 00:03 by Auriea
AnimalCrossing
[[Games]] http://www.communauteanimalcrossing.fr/jukebox.php <source> Animal Crossing: Wild World . . . <source> Angelfish -- 3,000 -- May-October, 4pm-9am (river, pond) Arapaima . . . (possibly all year, but unconfirmed) Bass -- 300 --All year, all day (river, pond) Bitterling -- . . . 1,300 -- December-February, all day (river, pond) Blue . . . Trout -- 150 -- All year, all day (pond) Carp -- 300 -- All year, all day (river, pond) Catfish -- 200 . . .
10K - last updated 2009-01-14 12:16 by Auriea
Anime
[[Movies]] http://www.animenewsnetwork.com/encyclopedia/anime.php?id=6733 the girl who lept through time . . .
1K - last updated 2007-04-02 22:46 by Auriea
AnnaKarenina
FiftyBooks [http://www.bartleby.com/316/] . . .
1K - last updated 2006-05-31 17:39 by Auriea
AnneCarson
CastOfThousands my favorite living poet... if i could be said to have a favorite poet * http://www.poetryfoundation.org/bio/anne-carson . . . ErosTheBittersweet [[tube:zK44lArPXYc&hl 480 385 0]] [[image:GriefLessons]] . . .
1K - last updated 2013-01-06 12:30 by Auriea
AnneSexton
CastOfThousands <html> <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/L4VlcVfgFJk&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> </html> . . .
1K - last updated 2010-05-05 00:26 by Auriea
Aphrodite
<html><iframe id='embed3DViewer' src='http://www.123dapp.com/fullpreview/embedViewer?assetId=1950236&size=small' . . . scrolling='no' style='border:none; width: 338px; height: 390px'> </iframe></html> . . .
1K - last updated 2014-01-08 12:20 by Auriea
ApprenticeBookbinder
RandomIdeas http://www.geocities.com/SoHo/Lofts/2123/coperta_08.html seriously, I want to learn a craft. . . . woman,[http://www.geocities.com/SoHo/Lofts/2123/index.html Josée Van Loon], or take her classes. . . . to contact me earlyer you can phone me 0475/47.23.65 greetings Josée -- Josee Van Loon - Atelier Coperta, . . . 2 Zwijnaarde B9052 Gent-Belgium Tel. & Fax: 32-(0)9-221.33.68 Email: josee.vanloon@skynet.be Internet: . . . and Archives Bibliotheca Wittockiana, 21-23 rue de Bemel, 1150 Bruxelles 32 2 770 5333 Tues-Sat . . .
3K - last updated 2005-04-29 09:52 by Auriea
Ariadne
FataleVrouwen + Minos + Minotaur + Theseus + Naxos + Dionysus [WikiPedia:Ariadne], [Mythica:Ariadne] . . . mortal or a goddess varying in those accounts.[3][4] [[image:Titian-Bacchus-Ariadne]] . . .
1K - last updated 2018-09-10 16:26 by 78-22-179-76.access.telenet.be
ArtSchool
''see also: OntwikkelingsgerichteBeurs'' ==Online Classes== * http://www.livepaintinglessons.com/colour.php . . . -Waichulis core drawing inst. 3DVDs and forms * http://www.studiorealism.com - sculpting . . .
2K - last updated 2013-02-15 14:26 by Auriea
ArtSupplies
CurrentObsession ===making paint=== http://www.paintmaking.com/index.html ===Pastels=== * sudden, uncontrollable . . . http://farm4.static.flickr.com/3102/2664426137_6ccf6b1874.jpg ----- http://www.stutler.cc/other/sketchbook/images/waterbrushes.jpg . . .
1K - last updated 2010-08-08 12:21 by Auriea
ArtSuppliesRoma
[[Rome]] Ordered Sculpture supplies from here: https://www.antichitabelsito.it/ Possible online bronze . . . . . .
1K - last updated 2021-06-05 14:02 by Auriea
ArtistStatement
I create sculptures using digital processes and handwork which are either shown as physical artefacts . . . from my own clay sculptures, digitally-crafted 3D sculptures made from drawings or from my imagination, . . . each part contributing to the narrative. Through 3D scanning and modeling, I can combine elements that . . . Hellenistic art, the ancient time period between 300BC and 31AD. I get a pleasant jolt from acknowledging . . . from disparate contexts are combined within 3D modeling software. As I mould the works, I also . . .
5K - last updated 2021-02-23 12:21 by Auriea
ArtistStatement old
[[About]] An engagement with images of things/people/stories which don’t exist but are believed to . . . a trusted persons hot takes. So it is also with 3d models. Always the truth, always a lie. A sculpture . . . exists as: The object as it is created in 3d, its photorealistic rendering, its physical manifestation, . . . or clay, and yet more versatile. The data of a 3d model is numeric and can be opened in any text editor. . . . An illusion created inside a computer screen. A 3d model has no true size. On screen it can be as small . . .
13K - last updated 2020-05-07 17:23 by Auriea-Mercury
Athens
OutsideSomeplace If I ever get back to Athens, go to the Museon Hill. Monument to "Uncle Phil" and fabulous . . . against the wind. the whole island is only 3o skm, but there is lot to explore, i visit every . . .
2K - last updated 2011-01-11 00:24 by Auriea
AugmentedReality
DigitalSculpture ==Tools I can use== * ARToolkit https://artoolkit.org/download-artoolkit-sdk ** ARToolkit . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/fWSSdUQF3J0&hl=en_US&fs=1?color1=0xe1600f&color2=0xfebd01"></param><param . . . src="http://www.youtube.com/v/fWSSdUQF3J0&hl=en_US&fs=1?color1=0xe1600f&color2=0xfebd01" . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . . about! ----- http://drawlogic.com/2008/11/17/as3-augmented-reality-in-flash-and-papervision-3d-flartoolkit/ . . .
2K - last updated 2017-03-09 16:39 by Au-Mercury
August2006Travel
DarkSecret SALES PERSON: WM ITINERARY DATE: 25 MAY 06 CUSTOMER NBR: CREATIVE00 LRKYSE PAGE: 01 TO: CREATIVE . . . 7TH FLOOR NEW YORK NY 10012 FOR: HARVEY/AURIEA 31 JUL 06 - MONDAY AIR DELTA AIR LINES INC FLT:141 . . . COACH LUNCH LV BRUSSELS 1130A EQP: BOEING 767 08HR 10MIN AR NEW YORK JFK 140P . . . NON-STOP ARRIVE: TERMINAL 3 REF: PVVLPE HARVEY/AURIEA SEAT-22F 14 AUG 06 - MONDAY . . . AIR DELTA AIR LINES INC FLT:5372 COACH NEW YORK JFK-INDIANAPOLIS OPERATED BY COMAIR . . .
2K - last updated 2006-06-19 10:16 by Auriea
AurieaDrawing3
image/jpeg
82K - last updated 2008-06-24 15:47 by Auriea
AurieaXLVII
----- <aggregate "Example_No.22"> ----- [[image:TheFlowerSeller-raw]] [[image:2014-01-08]] [[image:2ndStreet]] . . . [[image:AurieaDrawing3]] [[image:Ingres-vs-Delacroix_illustration1]] [[image:ArmyOfShe]] . . .
1K - last updated 2018-11-14 20:38 by Auriea.
AutobiographyOfRed
FiftyBooks While not as spectacular as TheBeautyOfTheHusband this book has it's moments. It scared me . . . terrible - * Geryon moved the focal ring from 3 to 3.5 meters ''Maybe I'll just keep talking and . . .
5K - last updated 2012-06-05 13:48 by Auriea
AutopsyFAQ
[[autopsy]] From: Ed Uthman <uthman@neosoft.com> Newsgroups: sci.med.pathology,sci.med,sci.answers,news.answers . . . 1.004) Followup-To: poster Date: 4 Mar 1998 19:43:24 GMT Organization: Pathanarchy, Inc Message-ID: . . . <6dkass$fl3$1@uuneo.neosoft.com> Summary: This is a narrative . . . Nuntius 2.0_PPC X-XXMessage-ID: <B1230C586501092E@scooter-ppp-port-23.neosoft.com> X-XXDate: . . .
27K - last updated 2007-05-18 12:10 by Auriea
BBCOresteia
<img src="http://auriea.com/wp-content/uploads/Screenshot-2015-06-08-18.57.28.png" alt="Screenshot . . . height="472" class="alignnone size-full wp-image-335" /> <em>"This version of the Oresteia . . . National Theatre, a TV production filmed in 1983, directed by Peter Hall using the Tony Harrison translation . . . class="alignleft size-large wp-image-438" /> The story of Clytemnaestra's killing of Agamemnon . . . me, either.) <iframe width="420" height="315" src="https://www.youtube.com/embed/O7sdZQ1BDs0?rel=0" . . .
5K - last updated 2017-02-12 14:48 by Auriea
Baden
[[Switzerland]] went there for the [http://www.fantoche.ch/2010/ Fantoche] animation festival. Where . . . about our work and more specifically ''RealTime 3d Aesthetics'' . . .
1K - last updated 2010-09-13 10:11 by Auriea
Baklava
[[Food]] Baklava or Baklawa, depends on your preference {{from LJ:roshi}} '''Ingredients''' 10 sheets . . . 200gms walnut pieces/kernels 1/2 cup water 2/3 cup sugar 2 tsp lemon juice '''Directions''' First . . . tin or ovenproof dish, sprinkle with about 3-4 teaspoons of the walnuts. Repeat the layers, finishing . . . but that would have left heaps over. I used 3-4 teaspoons of walnuts each layer. If you've got . . .
2K - last updated 2007-01-02 16:24 by Auriea
Barcelona
OutsideSomeplace ==some places== * fabra observatory http://www.observatorifabra.com/es/ ----- ==net . . . EAT AND DRINK Inopia Classic Bar, Tamarit 104; (34-93) 424-5231; www.barinopia.com. Irati, Cardenal . . . Casanyes 17; (34-93) 302-3084. Mamacafé, Doctor Dou 10; (34-93) . . . 301-2940. Origen 99.9%, four locations; www.origen99.com. . . . Rossell, Tamarit 109; (34-93) 424-1505. La Cova Fumada, Baluard 56; (34-93) . . .
3K - last updated 2008-07-19 20:49 by Auriea
BargueDrawings
[[Drawing]] [[thumb:FloweringStaircase|frame|300px|the master teacher and student relationship in classical . . . http://conceptart.org/forums/showthread.php?t=113729 on finding animal shapes to aid in sight training: . . .
4K - last updated 2012-02-11 14:41 by Auriea
Barry
CastOfThousands [[background:TheHangedMan|repeat #000000]] http://farm3.static.flickr.com/2446/3714923618_1c449775d3_b.jpg . . .
1K - last updated 2010-04-14 23:38 by Auriea
Bauhaus
ElegantMedia <html> <img src="http://www.auriea.org/index.pl/download/BauhausPhoto" USEMAP="#meisterfoto" . . . <AREA SHAPE=RECT COORDS="0,16,17,113" HREF="http://images.google.com/images?q=Josef Albers" . . . true"> <AREA SHAPE=RECT COORDS="67,8,94,131" HREF="http://images.google.com/images?q=Georg Muche" . . . return true"> <AREA SHAPE=RECT COORDS="120,31,143,126" HREF="http://images.google.com/images?q=Laszlo . . . <AREA SHAPE=RECT COORDS="229,19,255,53" HREF="http://images.google.com/images?q=Marcel Breuer" . . .
4K - last updated 2005-11-15 14:15 by Auriea
BeautyInTheAgeOfDigitalArt
ElegantMedia moderators: Maja Kuzmanovic (FoAM) and Michael Samyn (Tale of Tales) wednesday may 24, 2006 . . . 3pm matrix art project, brussels [[thumb:BeautyLecture1]][[thumb:BeautyLecture2]][[thumb:BeautyLecture3]][[thumb:BeautyLecture4]] . . . the surface of what one can see. As a creator of 3D interactive environments I feel there is an opportunity . . . age of digital art Date: 2006年5月18日 18:15:35 GMT+02:00 To: me Hi, Thank you for accepting to . . . panel will take place on Wednesday 24 May from 3 to 4.30 PM at Matrix Art Project, Koolmijnenkaai . . .
10K - last updated 2018-09-11 10:24 by Au-Mercury
BeautyLecture3
image/jpeg
98K - last updated 2014-04-05 20:00 by Auriea
BeerScallionPanckakes
[[Food]] '''Beer-Cake Scallion Breakfast Pancakes''' 2 envelopes dry yeast 2 cups flour 1/2 cup, plus . . . 1 tsp. salt 2 cups, plus one splash beer 3 Tbs. warm vegan butter 1.5 cups diced scallions 1/2 . . . whisk in the Levitation and the vegan butter. 3. Check your yeast. If it looks like a baby blob out . . . skillet and grease it with vegetable oil. Dump 1/3 cup globs of batter onto your pan, flipping them . . .
1K - last updated 2007-01-11 00:05 by Auriea
Bernini
CastOfThousands ''see also: ElegantMedia'' <html> <p>The following table lists Bernini’s . . . <td>Ciborium above St. Peter's tomb </td> </tr> <tr> <td . . . (staircase from Vatican Palace to St. Peter's)</td> </tr> <tr> <td align="right"> </td> . . . <td align="right">Ponte Sant' Angelo</td> <td align="center">S</td> . . . <tr> <td align="right">Sant' Agostino </td> <td align="center">S</td> . . .
8K - last updated 2010-06-21 00:09 by Auriea
BetterOutput
ElegantMedia Digital techniques with traditional materials and traditional techniques with digital materials. . . . * 3d printed painting * CNC marble milling * BronzeCasting . . .
1K - last updated 2016-05-02 16:02 by Auriea
BientotlEte
[[Games]] http://farm9.staticflickr.com/8351/8290258741_f2dea181b6_b.jpg http://farm9.staticflickr.com/8492/8291317362_c12fef80e5_b.jpg . . .
1K - last updated 2013-01-14 14:11 by Auriea
BillViola
CastOfThousands ''see also: ElegantMedia'' much more to mention here later * http://www.museumca.org/exhibit/exhi_viola.html . . . http://farm3.static.flickr.com/2787/4382767139_9457d3faf6.jpg . . . <html> <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/D_urrt8X0l8&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> <object width="480" . . . <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/E7a8R8Oynj4&hl=en_US&fs=1&"></param><param . . .
2K - last updated 2010-02-24 16:38 by Auriea
Biography
'''AURIEA HARVEY''' digital sculptor / videogame designer b. 1971 Indianapolis, IN 1989-1999 New York . . . video games, she has now turned her attention to 3D modeling, printing, and mixed reality. The work . . . NYC. ''[https://docs.google.com/document/d/1VUssu3jIWZHuOBEAwn5QYC6bhuEUlwiNDyVU-R0LtaY/edit?usp=sharing . . .
2K - last updated 2021-07-09 09:52 by Auriea
Blender
DigitalSculpture ''see also, [[topology]]'' * Creating Blendshapes for facial animation [https://cgi.tutsplus.com/tutorials/create-a-facial-animation-setup-in-blender-part-1--cg-32251] . . . * Auto rig pro [http://www.lucky3d.fr/auto-rig-pro/doc/#install] * Asset Manager [http://www.pitiwazou.com/asset-management-documentation_us/] . . . <html><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/_igp7TyRGnU&hl=en&fs=1&"></param><param . . . allowfullscreen="true" width="425" height="344"></embed></object></html> . . . ==Lightmaps== BlenderLightmapTutorial ==Multiresolution . . .
7K - last updated 2018-11-22 18:08 by Auriea.
BlenderAnimation
[[Blender]] ==Morph Targets== Morph targets in Blender are also known as relative vertex keys. On the . . . [http://en.wikibooks.org/wiki/Blender_3D:_Noob_to_Pro/Advanced_Tutorials/Advanced_Animation/Guided_tour/Armature/index . . . * [http://en.wikibooks.org/wiki/Blender_3D:_Noob_to_Pro/Advanced_Tutorials/Advanced_Animation/Guided_tour/Mesh/vg . . . rotate bones, select bones, I-KEY (in 3d view), Rot-Loc ==Using Motion Capture files== http://www.elysiun.com/forum/viewtopic.php?t=38685 . . .
6K - last updated 2010-03-25 17:25 by Auriea
BlenderGameEngine
[[Blender]] http://tba-creations.leveluphost.com/index.php/Tutorials/using-the-mouse-in-the-ge-theory.html . . . that :p) *[http://www.blendernation.com/2007/10/03/making-a-skybox-with-blender/ how to make a skybox] . . . Tutorials [http://en.wikibooks.org/wiki/Blender_3D:_Reference_Guide/Buttons_Reference/Logic] ; SENSORS: . . . 3rd person camera collision detection] * [http://www.elysiun.com/forum/viewtopic.php?t=45163 . . . following thread on elYsiun] * [http://blender3d.org/cms/3D_Walkthrough.340.0.html Walkthrough camera] . . .
3K - last updated 2009-04-22 18:34 by 78-21-206-53.access.telenet.be
BlenderHA
[[Blender]] BPy script repository (sometimes you will get an error message that one or the other of these . . . GENERATOR SCRIPT - http://www.geocities.com/bgen3/ ==HUMANITARIAN ASSISTANCE== http://www.blender.org . . . http://blender3d.org http://www.elysiun.com/forum/index.php ''Blender3D . . . ==Direct X exporters== Official . . . * http://www.elysiun.com/forum/viewtopic.php?t=36714 * and more by the same guy (hes pretty good) . . .
3K - last updated 2007-02-24 20:00 by Auriea
BlenderKeys
[[Blender]] ==Basic editing== Quit Q Abort command ESC Erase CTRL-X all X selected Editmode on/off TAB, . . . ENTER, SPACE Cursor Lclick Snap to grid (SHFT-S 3) or to selected object (SHFT-S 4) ==Selection== (De)Select . . . lclick / lclick+CTRL View buttons SHFT+F7 in a 3D view Allows setting a background image, grid size . . . and extent, clipping and focal length for the 3D view (each view has own) Function keys F1 File open, . . . F2 File save, F3 Image save, F4 Lamp, F5 Material, F6 Texture, F7 . . .
11K - last updated 2006-09-04 10:56 by Auriea
BlenderNormalMaps
Blender ==Step by Step== * material node tutorial and reference http://www.geneome.net/blender/writtentutorials/matnodes.html . . . <html> <object width="320" height="265"><param name="movie" value="http://www.youtube.com/v/qDOI-31jVzE&hl=en&fs=1"></param><param . . . src="http://www.youtube.com/v/qDOI-31jVzE&hl=en&fs=1" type="application/x-shockwave-flash" . . . allowfullscreen="true" width="320" height="265"></embed></object> . . .
2K - last updated 2009-08-01 17:17 by Auriea
BlenderRendering
[[Blender]] * Node Editor tutorial - http://www.blender.org/cms/Blender_Material_Nodes.743.0.html Preview . . . render, 3D window * Previews can also be rendered in the 3D . . .
1K - last updated 2006-12-20 00:08 by Auriea
BlueHeart
SongBook [[日本語]] [[sound:blueheart.mp3]] ===== Japanese Lyrics ===== Do-bun ne zu-ni Mita-ini Utsukushiku . . .
2K - last updated 2007-06-06 13:31 by Auriea
BlueberryMuffins
[[Food]] 1 1/2 teacups (which are probably about the right size) of this flour that says its for fijngebak... . . . hope that is what i'm making anyway. 3/4 teacup candico blonde sugar (Z! says: "hey that . . . "Baking Powder" too, at last, something easy.) 1/3 teacup vegetable oil (is the Sunflower a vegetable, . . . happy chicken egg, from a bio-organic farm 1/3 teacup bio halfvolle milk (no worries) 1 package . . . that teacup. have second thoughts about if the 1/3 cup oil isn't a bit much (or if your estimation is . . .
3K - last updated 2008-02-15 22:37 by d54C6FF9F.access.telenet.be
BoardGames
[[Games]] http://www.4colorrebellion.com/archives/2008/10/18/boardgaming-101/#more-6139 . . .
1K - last updated 2008-10-18 22:49 by Auriea
BodufSongs
http://farm4.static.flickr.com/3391/3509373923_608241d89a_o.jpg FM:Boduf+Songs seen at croxhapox on may . . .
1K - last updated 2009-05-18 14:57 by Auriea
Book12A
'''C.I.M.L''' sept 1991 [[thumb:Book12A_Cover|300px]] . . .
1K - last updated 2012-09-06 13:18 by Auriea
Book12B
'''sketchbook #12-B46A6/Q''' sept 1991 - feb 1992 [[thumb:Book12B_Cover|300px]] . . .
1K - last updated 2012-09-06 13:19 by Auriea
Book13
TableOfContents '''unknown''' feb 1992 - may 1992 [[image:Book13_Cover]] . . .
1K - last updated 2007-05-19 15:24 by Auriea
Book13 Cover
image/jpeg
86K - last updated 2012-09-04 12:49 by Auriea
Book15
SketchBooks May 1992 - Sept 1992 store bought, laserprint on old bookpaper cover, 8x7 inches [[thumb:Book15_Cover|350px]] . . . [[thumb:Book15_BackCover|350px]] [[thumb:Book15_ana-mom|200px]] [[thumb:Book15_the_foolish_virgin|200px]] . . .
1K - last updated 2012-09-04 12:35 by Auriea
Book16A
'''for mature readers only''' sept 1992 [[thumb:Book16A_Cover|300px]] [[thumb:Book16A_BackCover|300px]] . . .
1K - last updated 2012-09-06 13:15 by Auriea
Book16B
'''experiments in masochism''' sept 1992 - jan 1993 [[thumb:Book16B_Cover|300px]] . . .
1K - last updated 2012-09-06 13:15 by Auriea
Book17
SketchBooks '''millions of secrets are generated every day''' january 1993 - april 1993 [[thumb:Book17_Cover|300px]] . . . [[thumb:Book17_BackCover|300px]] <include "millions.pdf"> [[foreground:paper_bkg2|repeat . . .
1K - last updated 2012-09-17 14:25 by Auriea
Book18
SketchBooks '''Sermons''' 24 April 1993 - July 1993 handbound with rusted paper, collage, wrapped in . . . plastic [[thumb:Book18_Cover|300px]] [[thumb:Book18_BackCover|290px]] [[thumb:Book18_finalshow|100px]] . . .
1K - last updated 2018-09-11 15:59 by Au-Artemis
Book19
SketchBooks '''everyday kinds of peace and violence''' july 1993 - september 1993 23.5 x 31 cm; handbound . . . on cardboard, photograph [[thumb:Book19_Cover|300px]] [[thumb:Book19_NeverDoubt|500px]] [[vimeo:48441613 . . .
1K - last updated 2012-09-06 12:31 by Auriea
Book2
TableOfContents '''diary of a megalomaniac''' 21 may 1989 - 3 oct 1989 [[image:Book2_Cover]] . . .
1K - last updated 2007-05-19 16:46 by Auriea
Book20
SketchBooks '''Psyche Story''' Oct 1993 - Apr 1994 20 x 25.5 cm; handbound, found cover w/collage <center>[[vimeo:3065816 . . .
1K - last updated 2020-04-09 12:01 by Auriea-Mercury
Book20 3
image/jpeg
117K - last updated 2006-05-25 14:31 by Auriea
Book21A
'''Night; stars and a bright moon.''' used briefly in 1994 and 1995 17.5 x 25 cm; handbound, velvet and . . . on recycled bookboards [[thumb:Book21A_Cover|300px]] . . .
1K - last updated 2012-09-06 12:25 by Auriea
Book21B
'''The Disease Manifesto''' July 1994 - winter 1994 33.5 x 25.5 cm; handbound, velvet and gold paint . . . [[thumb:Book21B_Cover|300px]] [[vimeo:914110 500 300 0]] [[foreground:paper_bkg2|repeat . . .
1K - last updated 2012-09-06 12:20 by Auriea
Book22A
SketchBooks '''present''' winter 1994 - winter 1995 [[thumb:Book22A_Cover|300px]] . . .
1K - last updated 2012-09-06 12:36 by Auriea
Book22B
SketchBooks '''Chinese Wedding'' summer - winter 1995 [[thumb:Book22B_Cover|350px]] [[thumb:Book22B_BackCover|350px]] . . . [[thumb:Book22B_img2|200px]] [[thumb:Book22B_img3|200px]] [[thumb:Book22B_img4|200px]] [[thumb:Book22B_img5|200px]] . . . [[thumb:Book22B_img7|200px]] [[vimeo:3061212 600 382 0]] . . .
1K - last updated 2012-09-06 12:49 by Auriea
Book22B img3
image/jpeg
267K - last updated 2012-09-06 12:50 by Auriea
Book23
SketchBooks [[Book23B]] <include "Book23B"> ------- [[Book23A]] <include "Book23A"> . . .
1K - last updated 2012-09-06 13:56 by Auriea
Book23A
[[image:Book23A_Cover]] used only briefly in 1995 then dismembered, didn't like the feel of it, or something . . .
1K - last updated 2012-09-06 14:00 by Auriea
Book23A Cover
image/jpeg
98K - last updated 2012-09-03 15:17 by Auriea
Book23B
'''''Like Being Awake Sleeping And Hearing Seeing''''' Oct. 1995 - June 1996 [[thumb:Book23B_Cover|250px]] . . . [[thumb:Book23B_BackCover|250px]] "She is a living example of the . . . of note: Dover http://farm4.staticflickr.com/3492/3220016947_6592702ddb_z.jpg Iceland http://farm4.staticflickr.com/3403/3220856292_ee834ca8c2.jpg . . . http://farm4.staticflickr.com/3350/3220857040_48e56f5eeb.jpg first ever trip to London . . . http://farm4.staticflickr.com/3494/3220003661_a98e4b51a4_z.jpg . . .
1K - last updated 2012-09-06 13:59 by Auriea
Book23B BackCover
image/jpeg
67K - last updated 2012-09-03 15:13 by Auriea
Book23B Cover
image/jpeg
120K - last updated 2012-09-03 15:11 by Auriea
Book24
SketchBooks '''illustrated encyclopedia of the modern world''' july 1996 - july 1997 [[thumb:Book24_Cover|300px]] . . .
1K - last updated 2012-09-07 15:01 by Auriea
Book25
SketchBooks 16 july 1997 - jun 1999 '''2 million year-old light''' [[image:Book25_Cover]] [[vimeo:48442206 . . . 500 375 0]] [[thumb:Book25_TheOnlyKnownDrawingOfRickInMaine|250px]] . . . also: CraterLake'' http://farm4.staticflickr.com/3471/3259850143_f259922420_z.jpg http://farm4.staticflickr.com/3436/3260683536_227165209e_z.jpg . . . http://farm4.staticflickr.com/3428/3277767783_c5d8e60b4a_z.jpg . . .
1K - last updated 2012-11-20 18:27 by Auriea
Book28
SketchBooks '''bandaged (elegantly)''' 24 aug 2001 - 18 oct 2003 10.5 x 17 cm [[image:Book28_Cover]] . . .
1K - last updated 2012-09-01 17:50 by Auriea
Book29
SketchBooks '''Really Big Fires''' oct 2003 - apr 2005 Daler-Rowney sketchbook [[thumb:Book29_Cover|300px]] . . . <table/booknav prev, next> prev/l=[[Book30|30.]] next/r=[[Book28|28.]] . . .
2K - last updated 2018-09-09 21:18 by Auriea
Book3
TableOfContents '''ignis fatuus''' 3 oct 1989 - 1 jan 1990 [[image:Book3_Cover]] . . .
1K - last updated 2007-05-19 16:41 by Auriea
Book30
SketchBooks '''In-Between''' April 2005 - 4 August 2005 17 x 30.5 [[thumb:Book30_Cover|300px]] [[thumb:Book30_HecubaBlindsPolymnestor|150px]] . . . <table/booknav prev, next> prev/l=[[Book31|31.]] next/r=[[Book29|29.]] ----- . . .
1K - last updated 2018-09-09 21:17 by Auriea
Book30 Cover
image/jpeg
153K - last updated 2012-09-01 17:16 by Auriea
Book30 HecubaBlindsPolymnestor
image/jpeg
107K - last updated 2006-05-25 14:55 by Auriea
Book31
SketchBooks '''"In case of loss, please return to: THAT PLACE IN YOUR HEART WHERE ALL THINGS ARE REAL"''' . . . Sketchbook, January 2006 - June 2006 [[thumb:Book31_Cover|300px]][[thumb:Book31_BackCover|300px]] [[thumb:Book31_Roma00|200px]] . . . [[thumb:Book31_Roma01|200px]] [[thumb:Book31_Roma02|200px]] [[thumb:Book31_Roma03|200px]] . . . [[thumb:Book31_Roma04|200px]] [[thumb:Book31_Roma05|200px]] [[thumb:Book31_Roma06|200px]] . . . [[thumb:Book31_Roma07|200px]] [[thumb:Book31_Roma08|200px]] [[thumb:Book31_Roma09|200px]] . . .
2K - last updated 2018-09-09 21:17 by Auriea
Book31 BackCover
image/jpeg
39K - last updated 2012-09-01 16:32 by Auriea
Book31 Cover
image/jpeg
42K - last updated 2012-09-01 16:31 by Auriea
Book31 Roma00
image/jpeg
180K - last updated 2006-05-15 01:01 by Auriea
Book31 Roma01
image/jpeg
109K - last updated 2006-05-14 21:10 by Auriea
Book31 Roma02
image/jpeg
127K - last updated 2006-05-14 21:13 by Auriea
Book31 Roma03
image/jpeg
168K - last updated 2006-05-14 21:13 by Auriea
Book31 Roma04
image/jpeg
256K - last updated 2006-05-14 21:13 by Auriea
Book31 Roma05
image/jpeg
179K - last updated 2006-05-14 21:14 by Auriea
Book31 Roma06
image/jpeg
212K - last updated 2006-05-14 21:14 by Auriea
Book31 Roma07
image/jpeg
98K - last updated 2006-05-14 21:14 by Auriea
Book31 Roma08
image/jpeg
87K - last updated 2006-06-27 13:05 by Auriea
Book31 Roma09
image/jpeg
202K - last updated 2007-05-07 10:41 by Auriea
Book31 Roma10
image/jpeg
125K - last updated 2006-05-14 21:16 by Auriea
Book31 Roma11
image/jpeg
110K - last updated 2006-05-28 23:05 by Auriea
Book31 Roma12
image/jpeg
80K - last updated 2006-05-14 21:16 by Auriea
Book31 Roma13
image/jpeg
107K - last updated 2006-05-28 23:06 by Auriea
Book31 Roma14
image/jpeg
95K - last updated 2006-05-14 21:17 by Auriea
Book31 Roma15
image/jpeg
75K - last updated 2007-01-18 22:40 by Auriea
Book31 Roma16
image/jpeg
115K - last updated 2006-05-28 23:08 by Auriea
Book32
SketchBooks '''Beautiful Lightside/Beautiful Darkside''' June 2006 - March 2007 16.3 x 24.3 cm; handbound, . . . player piano roll, silk, cardboard [[thumb:Book32_Cover_Lightside|300px]] [[thumb:Book32_Page10|200px]] . . . [[thumb:Book32_Page11|150px]] [[thumb:Book32_Page18-19|300px]] . . . [[thumb:Book32_Page20-21|300px]] [[thumb:Book32_Page26-27|300px]] . . . [[thumb:Book32_Page30|140px]] [[thumb:Book32_Page34|140px]] [[thumb:Book32_Page36-37|300px]] . . .
2K - last updated 2018-09-09 21:17 by Auriea
Book32 Cover Darkside
image/jpeg
137K - last updated 2012-09-01 16:40 by Auriea
Book32 Cover Lightside
image/jpeg
46K - last updated 2012-09-01 16:43 by Auriea
Book32 Cover Lightside2
image/jpeg
159K - last updated 2012-09-01 16:42 by Auriea
Book32 Page10
image/jpeg
276K - last updated 2006-07-27 18:31 by Auriea
Book32 Page11
image/jpeg
99K - last updated 2006-07-09 21:17 by Auriea
Book32 Page18-19
image/jpeg
265K - last updated 2006-08-22 17:33 by Auriea
Book32 Page20-21
image/jpeg
83K - last updated 2006-07-27 13:48 by Auriea
Book32 Page22-23 darkside
image/jpeg
230K - last updated 2009-01-16 22:46 by Auriea
Book32 Page24-25 darkside
image/jpeg
364K - last updated 2007-01-10 12:39 by Auriea
Book32 Page26-27
image/jpeg
91K - last updated 2007-01-10 11:56 by Auriea
Book32 Page30
image/jpeg
262K - last updated 2009-01-16 22:39 by Auriea
Book32 Page30-31 darkside
image/jpeg
153K - last updated 2006-08-23 20:53 by Auriea
Book32 Page34
image/jpeg
133K - last updated 2006-08-22 18:32 by Auriea
Book32 Page36-37
image/jpeg
223K - last updated 2006-08-22 09:08 by Auriea
Book32 Page38-39
image/jpeg
256K - last updated 2006-08-23 21:32 by Auriea
Book32 Page40-41
image/jpeg
256K - last updated 2009-01-16 22:42 by Auriea
Book32 Page44-45
image/jpeg
206K - last updated 2006-08-23 21:33 by Auriea
Book32 Page44-45 darkside
image/jpeg
152K - last updated 2006-10-15 12:49 by Auriea
Book32 Page47 darkside
image/jpeg
173K - last updated 2006-10-15 12:50 by Auriea
Book32 Page48-49
image/jpeg
289K - last updated 2006-08-18 06:02 by Auriea
Book32 Page48 darkside
image/jpeg
184K - last updated 2007-01-10 12:37 by Auriea
Book32 Page49 darkside
image/jpeg
197K - last updated 2006-10-15 12:51 by Auriea
Book32 Page50-51 darkside
image/jpeg
234K - last updated 2007-01-10 12:35 by Auriea
Book32 Page52-53 darkside
image/jpeg
160K - last updated 2006-10-15 12:52 by Auriea
Book32 Page53
image/jpeg
29K - last updated 2007-02-06 15:39 by Auriea
Book32 Page54-55 darkside
image/jpeg
158K - last updated 2007-01-10 12:26 by Auriea
Book32 Page60-61
image/jpeg
197K - last updated 2007-02-06 15:39 by Auriea
Book33
SketchBooks '''how to read notes''' 20 march 2007 - November 2007 [[thumb:Book33_BackCover|300px]][[thumb:Book33_Cover|300px]] . . . [[thumb:Book33_Page9-10|100px]] [[thumb:Book33_Page13|200px]] [[thumb:Book33_Page99-100|200px]] . . . [[thumb:Book33_Page111-112|200px]] <table/booknav prev, next> . . . prev/l=[[Book34|34.]] next/r=[[Book32|32.]] ----- . . .
1K - last updated 2018-09-09 21:17 by Auriea
Book33 BackCover
image/jpeg
98K - last updated 2012-09-01 16:55 by Auriea
Book33 Cover
image/jpeg
57K - last updated 2012-09-01 16:51 by Auriea
Book33 Page111-112
image/jpeg
149K - last updated 2007-08-17 22:35 by Auriea
Book33 Page13
image/jpeg
332K - last updated 2012-09-17 13:07 by Auriea
Book33 Page9-10
image/jpeg
132K - last updated 2012-09-17 12:54 by Auriea
Book33 Page99-100
image/jpeg
125K - last updated 2007-08-14 16:27 by Auriea
Book34
SketchBooks '''i sing anyway''' february 2008 [[thumb:Book34_Cover|300px]] <table/booknav prev, next> . . . prev/l=[[Book35|35.]] next/r=[[Book33|33.]] ----- . . .
1K - last updated 2018-09-09 21:17 by Auriea
Book34 Cover
image/jpeg
113K - last updated 2012-09-06 13:37 by Auriea
Book35
SketchBooks '''talking to myself''' [[thumb:Book35_Cover|300px]] [[thumb:Book35_Untitled1|200px]][[thumb:Book35_Untitled2|200px]][[thumb:Book35_Untitled3|200px]][[thumb:Book35_Untitled4|200px]] . . . <html> <object width="400" height="300"> <param name="flashvars" value="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Ftags%2Ftesters%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Ftags%2Ftesters%2F&user_id=81482434@N00&tags=testers&jump_to=&start_index="></param> . . . . . . width="400" height="300"></embed></object> </html> . . . <table/booknav prev, next> prev/l=[[Book36|36.]] next/r=[[Book34|34.]] ----- . . .
2K - last updated 2018-09-09 21:14 by Auriea
Book35 Cover
image/jpeg
72K - last updated 2012-07-16 18:02 by Auriea
Book35 Untitled1
image/jpeg
423K - last updated 2008-12-27 23:41 by Auriea
Book35 Untitled2
image/jpeg
463K - last updated 2008-12-27 22:46 by Auriea
Book35 Untitled3
image/jpeg
440K - last updated 2009-01-10 02:58 by Auriea
Book35 Untitled4
image/jpeg
514K - last updated 2008-12-28 22:35 by Auriea
Book36
SketchBooks [[thumb:Book36_Cover|300px]] [[thumb:2008-12-31_00h07_done|200px]] <table/booknav prev, . . . next> prev/l=[[Book37|37.]] next/r=[[Book35|35.]] ----- . . .
1K - last updated 2018-09-09 21:13 by Auriea
Book36 Cover
image/jpeg
109K - last updated 2012-09-01 14:02 by Auriea
Book37
SketchBooks [[thumb:Book37_Cover|300px]] <table/booknav prev, next> prev/l=[[Book38|38.]] next/r=[[Book36|36.]] . . .
1K - last updated 2018-09-09 21:13 by Auriea
Book37 Cover
image/jpeg
102K - last updated 2012-09-01 14:02 by Auriea
Book38
SketchBooks '''Der Geist Des Rokoko''' spring 2010 - october 2010 9 x 13 cm [[thumb:Book38_Cover|300px]] . . . . . . [[thumb:Book38_page4-5|200px]] [[thumb:Book38_page1|200px]] [[thumb:Book38_jellyfish|200px]] . . . [[thumb:Book38_towers|200px]] [[thumb:Book38_oudenaarde|200px]] . . . [[thumb:Book38_garden1|200px]] [[thumb:Book38_garden2|200px]] [[thumb:Book38_botanictree|200px]] . . .
2K - last updated 2018-09-09 21:13 by Auriea
Book38 BackCover
image/jpeg
111K - last updated 2012-09-01 13:10 by Auriea
Book38 Cover
image/jpeg
68K - last updated 2012-09-01 13:09 by Auriea
Book38 InsideBackCover
image/jpeg
228K - last updated 2010-04-30 17:11 by Auriea
Book38 airplanetobe
image/jpeg
193K - last updated 2012-09-06 10:55 by Auriea
Book38 banana
image/jpeg
141K - last updated 2012-09-07 23:08 by Auriea
Book38 botanictree
image/jpeg
231K - last updated 2012-09-07 23:07 by Auriea
Book38 charlesbridge
image/jpeg
170K - last updated 2012-09-06 10:51 by Auriea
Book38 garden1
image/jpeg
160K - last updated 2012-09-07 23:06 by Auriea
Book38 garden2
image/jpeg
133K - last updated 2012-09-07 23:07 by Auriea
Book38 gutshoftirol
image/jpeg
130K - last updated 2012-09-06 10:58 by Auriea
Book38 jellyfish
image/jpeg
249K - last updated 2012-09-06 10:36 by Auriea
Book38 nightblooming
image/jpeg
213K - last updated 2012-09-07 20:00 by Auriea
Book38 oudenaarde
image/jpeg
188K - last updated 2012-09-06 11:03 by Auriea
Book38 page1
image/jpeg
187K - last updated 2012-09-07 22:59 by Auriea
Book38 page4-5
image/jpeg
208K - last updated 2010-05-06 00:09 by Auriea
Book38 pear
image/jpeg
255K - last updated 2012-09-07 23:09 by Auriea
Book38 prague
image/jpeg
191K - last updated 2012-09-06 17:19 by Auriea
Book38 prague2
image/jpeg
168K - last updated 2012-09-06 11:05 by Auriea
Book38 schwanaubridge
image/jpeg
110K - last updated 2012-09-07 23:04 by Auriea
Book38 tea
image/jpeg
92K - last updated 2012-09-07 23:20 by Auriea
Book38 theroofview
image/jpeg
86K - last updated 2012-09-06 10:39 by Auriea
Book38 theroofview2
image/jpeg
155K - last updated 2012-09-06 10:40 by Auriea
Book38 theroofview3
image/jpeg
174K - last updated 2012-09-06 10:45 by Auriea
Book38 towers
image/jpeg
124K - last updated 2012-09-06 10:56 by Auriea
Book39
SketchBooks '''sketchbookipod''' october 2010 - not finished (may use it again sometime) 8.5 x 14.8 cm . . . [[thumb:Book39_Cover|300px]] [[thumb:Book39_img1|250px]] [[thumb:Book39_lamp|250px]] . . . [[thumb:Book39_moon|200px]] [[thumb:Book39_bunny|200px]] [[thumb:Book39_marcel|200px]] . . . [[thumb:Book39_body|200px]] [[thumb:2010-10-26_sketchbookipod|400px]] . . . next> prev/l=[[Book40|40.]] next/r=[[Book38|38.]] . . .
1K - last updated 2018-09-09 21:12 by Auriea
Book39 Cover
image/jpeg
80K - last updated 2012-09-01 13:23 by Auriea
Book39 body
image/jpeg
63K - last updated 2012-09-17 14:11 by Auriea
Book39 bunny
image/jpeg
35K - last updated 2012-09-17 14:10 by Auriea
Book39 img1
image/jpeg
58K - last updated 2012-09-01 13:37 by Auriea
Book39 lamp
image/jpeg
202K - last updated 2012-09-17 14:03 by Auriea
Book39 marcel
image/jpeg
52K - last updated 2012-09-17 14:11 by Auriea
Book39 moon
image/jpeg
27K - last updated 2012-09-17 14:10 by Auriea
Book3 Cover
image/jpeg
89K - last updated 2012-06-07 15:46 by Auriea
Book40
SketchBooks '''#planV''' 2011 april 2011 - 17 Aug 2011 16 x 24.4 cm [[thumb:Book40_Cover|300px]] [[thumb:Book40_MapOfPlanV|300px]] . . . next> prev/l=[[Book41|41.]] next/r=[[Book39|39.]] ----- . . .
1K - last updated 2018-09-09 21:12 by Auriea
Book41
SketchBooks '''BELGIË/BELGIQUE''' 18 Aug 2011 - 17 feb 2012 25.5 x 20 cm [[thumb:Book41_Cover|300px]] . . . [[thumb:Book41_page2-3|200px]] [[thumb:Book41_page10-11|200px]] [[thumb:Book41_page33|200px]] . . . [[thumb:Book41_page43|200px]] [[thumb:Book41_page50-51|200px]] [[thumb:Book41_page68-69|300px]] . . . [[thumb:Book41_page70-71|300px]] [[thumb:Book41_page80-81|300px]] [[thumb:Book41_page92|200px]] . . . src="http://w.soundcloud.com/player/?url=http%3A%2F%2Fapi.soundcloud.com%2Ftracks%2F23627412&show_artwork=true"></iframe></html> . . .
1K - last updated 2018-09-09 21:12 by Auriea
Book41 page2-3
image/jpeg
274K - last updated 2012-09-11 12:10 by Auriea
Book41 page33
image/jpeg
215K - last updated 2012-09-11 12:10 by Auriea
Book41 page43
image/jpeg
161K - last updated 2012-09-11 12:11 by Auriea
Book42
SketchBooks '''GLAMOUR''' December 20, 2011 - February 29, 2012 12 x 18.5 [[thumb:Book42_Cover|300px]] . . . [[thumb:Book42_page3|100px]] [[thumb:Book42_page6-7|200px]] [[thumb:Book42_page8-9|200px]] . . . [[thumb:Book42_page12-13|200px]] [[thumb:Book42_page14|100px]] [[thumb:Book42_page24|100px]] . . . [[thumb:Book42_page29-30|200px]] [[thumb:Book42_page35-36|200px]] [[thumb:Book42_page57-58|200px]] . . . [[thumb:Book42_page129-130|200px]] '''42b - Rome, supplement''' [[thumb:Book42b_belvedereapollo|200px]] . . .
1K - last updated 2018-09-09 21:11 by Auriea
Book42 page12-13
image/jpeg
180K - last updated 2012-09-07 14:10 by Auriea
Book42 page129-130
image/jpeg
212K - last updated 2012-09-07 14:16 by Auriea
Book42 page29-30
image/jpeg
166K - last updated 2012-09-07 14:11 by Auriea
Book42 page3
image/jpeg
138K - last updated 2012-09-07 13:05 by Auriea
Book42 page35-36
image/jpeg
168K - last updated 2012-09-07 14:11 by Auriea
Book43
SketchBooks '''De Rerum Natura''' March 18, 2012 - June 25, 2012 17 x 25.5 cm; handbound cover: canvas, . . . gesso, silver-leaf, graphite [[thumb:Book43_cover|300px]] ------ [[thumb:Book43_dedication|200px]] . . . [[thumb:Book43_thefootdrag|200px]] [[thumb:Book43_thethingsithinkabout|200px]] . . . [[thumb:Book43_womanonfiresdayoff|200px]] [[thumb:Book43_natureisorganized|200px]] . . . [[thumb:Book43_straat44room03|200px]] [[thumb:Book43_twins|200px]] . . .
3K - last updated 2018-09-09 21:08 by Auriea
Book43 cover
image/jpeg
271K - last updated 2012-09-01 10:58 by Auriea
Book43 dedication
image/jpeg
321K - last updated 2012-06-26 15:06 by Auriea
Book43 flowersforever
image/jpeg
277K - last updated 2012-09-06 10:27 by Auriea
Book43 natureisorganized
image/jpeg
218K - last updated 2012-09-06 10:11 by Auriea
Book43 straat44room03
image/jpeg
184K - last updated 2012-09-06 10:16 by Auriea
Book43 thefootdrag
image/jpeg
134K - last updated 2012-09-06 09:52 by Auriea
Book43 thethingsithinkabout
image/jpeg
132K - last updated 2012-09-06 09:59 by Auriea
Book43 transit
image/jpeg
92K - last updated 2012-06-07 13:50 by Auriea
Book43 twins
image/jpeg
150K - last updated 2012-09-06 10:23 by Auriea
Book43 womanonfiresdayoff
image/jpeg
175K - last updated 2012-09-06 10:06 by Auriea
Book44
SketchBooks '''FEU ET FLAMME''' June 26, 2012 - November 12, 2012 16x24 cm.; handbound, found cover w/collage . . . [[thumb:Book44_Cover|300px]] ------- [[thumb:Book44_intropages|200px]] [[thumb:Book44_chapitrepremier|100px]] . . . [[thumb:Book44_priveemodel3|200px]] [[thumb:Book44_orchid|120px]] [[thumb:Book44_chapter3chapter4|200px]] . . . [[thumb:Book44_indiecade3|200px]] [[thumb:Book44_indiecade4|200px]] [[thumb:Book44_pacificocean|200px]] . . . next> prev/l=[[Book45|45.]] next/r=[[Book43|43.]] ----- . . .
3K - last updated 2018-09-09 19:25 by Auriea
Book44 chapter3chapter4
image/jpeg
314K - last updated 2012-09-23 10:26 by Auriea
Book44 indiecade3
image/jpeg
795K - last updated 2012-10-13 14:34 by Auriea
Book44 priveemodel3
image/jpeg
224K - last updated 2012-12-02 17:28 by Auriea
Book45
SketchBooks [[thumb:Book45_Cover|400px]] '''Mars Black''' 13 November 2012 - 5 March 2013 ----- [[thumb:Book45_InsidePortrait|200px]] . . . [[thumb:Book45_figure3|200px]] [[thumb:Book45_redmartha|200px]] [[thumb:Book45_BackOfMarthasHead|110px]] . . .
1K - last updated 2018-09-09 21:07 by Auriea
Book45 figure3
image/jpeg
284K - last updated 2013-04-08 13:38 by Auriea
Book46
SketchBooks '''Σκύρος''' 06 March 2013 - 26 July 2013 14 x 25 cm handmade, canson mi-tientes paper, . . . watercolor, colored pencil [[thumb:Book46_Cover|300px]] [[thumb:Book46_frontpiece-AEStallings|300px]] . . . . . .
1K - last updated 2018-09-09 21:06 by Auriea
Book46 3
image/jpeg
1573K - last updated 2014-09-01 23:41 by Auriea
Book47
SketchBooks '''Costumes Anciens et Modernes''' 26 July 2013 - 25 Sept 2013 14.5 x 23 cm handmade, found . . . Coast, Cologne, Vienna [[thumb:Book47_Cover|300px]] [[thumb:Book47_inserts|550px]] ------- [[thumb:Book47_1|200px]][[thumb:Book47_2|200px]][[thumb:Book47_3|200px]][[thumb:Book47_4|200px]][[thumb:Book47_5|200px]][[thumb:Book47_6|200px]][[thumb:Book47_7|200px]][[thumb:Book47_8|200px]][[thumb:Book47_9|200px]][[thumb:Book47_10|200px]][[thumb:Book47_11|200px]][[thumb:Book47_12|200px]][[thumb:Book47_13|200px]][[thumb:Book47_14|200px]][[thumb:Book47_15|200px]] . . .
1K - last updated 2018-09-09 21:05 by Auriea
Book47 13
image/jpeg
370K - last updated 2014-09-08 19:26 by Auriea
Book47 3
image/jpeg
405K - last updated 2014-09-08 19:22 by Auriea
Book48
SketchBooks [[thumb:Book48_Cover|300px]] [[thumb:Book48_BackCover|300px]] '''Paris''' 25 Sept 2013 - . . . 21 Dec 2013 17cm x 13cm Gent, Coimbra, Los Angeles, Nottingham, . . . [[thumb:Book48_2|200px]] [[thumb:Book48_3|200px]] [[thumb:Book48_4|200px]] [[thumb:Book48_5|200px]] . . . [[thumb:Book48_12|200px]] [[thumb:Book48_13|200px]] [[thumb:Book48_14|200px]] [[thumb:Book48_15|200px]] . . . [[thumb:Book48_22|200px]] [[thumb:Book48_23|200px]] [[thumb:Book48_24|200px]] [[thumb:Book48_25|200px]] . . .
2K - last updated 2018-09-09 21:05 by Auriea
Book48 13
image/jpeg
396K - last updated 2014-09-09 13:37 by Auriea
Book48 23
image/jpeg
240K - last updated 2014-09-09 13:42 by Auriea
Book48 3
image/jpeg
272K - last updated 2014-09-09 13:33 by Auriea
Book49
SketchBooks [[thumb:Book49_Cover|400px]] [[thumb:Book49_BackCover|400px]] '''La salle des Caryatides''' . . . 21 Dec 2013 - 1 June 2014 21.5cm x 15cm bought at the Sennelier . . . [[thumb:Book49_2|200px]] [[thumb:Book49_3|200px]] [[thumb:Book49_4|200px]] [[thumb:Book49_5|200px]] . . . [[thumb:Book49_12|200px]] [[thumb:Book49_13|200px]] [[thumb:Book49_14|200px]] [[thumb:Book49_15|200px]] . . . [[thumb:Book49_22|200px]] [[thumb:Book49_23|200px]] [[thumb:Book49_24|200px]] [[thumb:Book49_25|200px]] . . .
2K - last updated 2018-09-09 21:04 by Auriea
Book49 13
image/jpeg
236K - last updated 2014-09-09 14:14 by Auriea
Book49 23
image/jpeg
228K - last updated 2014-09-09 14:16 by Auriea
Book49 3
image/jpeg
289K - last updated 2014-09-09 14:11 by Auriea
Book49 30
image/jpeg
266K - last updated 2014-09-09 14:18 by Auriea
Book49 31
image/jpeg
354K - last updated 2014-09-09 14:19 by Auriea
Book49 32
image/jpeg
349K - last updated 2014-09-09 14:19 by Auriea
Book49 33
image/jpeg
274K - last updated 2014-09-09 14:19 by Auriea
Book49 34
image/jpeg
207K - last updated 2014-09-09 14:19 by Auriea
Book49 35
image/jpeg
340K - last updated 2014-09-09 14:19 by Auriea
Book49 36
image/jpeg
361K - last updated 2014-09-09 14:20 by Auriea
Book5
SketchBooks '''Pseudo Quasi Real''' 15 Apr 1990 - 27 May 1990 31 x 31 cm; spiral bound sketchbook w/added . . . covers and polaroid [[thumb:Book5_Cover|300px]] [[foreground:paper_bkg2|repeat transparent]] . . . [[thumb:Book5_life closed twice|300px]] [[thumb:Book5_scroll|350px]] [[thumb:Book5_selfportrait|200px]] . . .
1K - last updated 2012-09-07 11:00 by Auriea
Book50
SketchBooks [[thumb:Book50_KittenAsMuse|300px]] [[thumb:Book50_Mauritshuis|300px]] . . .
1K - last updated 2014-09-28 13:07 by Auriea
Book6
SketchBooks 8 may 1990 - 20 aug 1990 '''sex, life, and the cosmos''' [[thumb:Book6_Cover|300px]] [[thumb:Book6_SecretWriting|200px]] . . .
1K - last updated 2012-09-25 11:12 by Auriea
Book8
TableOfContents '''Fragile''' 26 Sept 1990 - 19 Dec 1990, store bought 9x12 [[thumb:Book8_Cover|110px]][[vimeo:2783622 . . . 600 338 0]] covers part of the year in college, when i . . .
1K - last updated 2009-01-10 23:38 by Auriea
Books
ElegantMedia [[Books]] ''see also: FromLibrary, SketchBooks, FiftyBooks, ApprenticeBookbinder'' [[tube:sUgjlJ5hEbw . . . 320 240 0]] A short History of Books http://www.librarydesigns.com/HistoryOfBooks.htm . . .
1K - last updated 2012-12-19 12:34 by Auriea
BorisVian
CastOfThousands [[image:BorisVianAaZ]] books: [http://www.artworldbooks.com/pages/search.php?words=Vian&theme=0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16] . . . vols. He died in a Parisian cinema at the age of 39 while watching a preview of the film I'll Spit on . . . Vercoquin et le plancton. It was written in 1943, but published in 1946. After the war he played trumpet . . . perpetuate the memory of Alfred Jarry. On June 23, 1959, the poorly made film version of I'll Spit . . .
8K - last updated 2012-07-02 13:21 by Auriea
BronzeFoundryNotes
ObjectSeries Meeting with ArtCasting in Oudenaarde on [[2017-03-02]]: <center>[[image:2017-03-02_ArtCasting]] . . . with the texture left over on the model from the 3d printed wax process. Yes. ## never expect the work . . .
3K - last updated 2017-03-02 18:38 by Au-Mercury
BronzeMagdalenes3
image/jpeg
405K - last updated 2019-02-25 23:05 by Auriea
BrownieBox
http://farm4.static.flickr.com/3220/2511129142_6526e97e16.jpg . . .
1K - last updated 2009-01-05 00:37 by Auriea
CCcaseStudy
[[CCretreat2009]] # The idea for The Path grew out of our desire to make games based on folk tales. Our . . . we were getting up at 9 am and working till 2-3am ==what went wrong== # Our belief that we had to . . . alone ## Michael had to program an entire 3d game alone and while we did have a consultation . . . under review. in the end we spent around 300,000 Euro making the game which is nothing by game . . .
5K - last updated 2009-07-23 23:17 by Auriea
CCpresentation2006
[[CCretreat2006]] # introduction '''''slide 01 - ToT''''' ## Hi, I am Auriea Harvey. # ToT ## I have . . . Tale of Tales dedicated to making realtime 3D interactive entertainment software, more commonly . . . known as video games. I am co-designer, lead 3d artist and Art Director on the games. Our projects . . . for our games. # endless forest '''''slide03 - TEF''''' ## Our second game is called The Endless . . . In terms of structure; This is a game played in 3 Acts and 6 episodes. 3 acts because there are only . . .
7K - last updated 2009-06-29 11:09 by Auriea
CCpresentation2009
[[CCretreat2009]] '''''slide 01 - ToT''''' # Hello, I am Auriea Harvey he is Michael Samyn, we are Tale . . . in a magical idyllic forest. '''''slide 03 - 6sisters''''' # But our most devisive game to date . . .
3K - last updated 2009-07-23 22:58 by Auriea
CCretreat2006
OutsideSomeplace ''see also ToDo, [[August2006Travel]], nyc, [[CCpresentation2006]]'' ==Contacts== Connor . . . Kalista: 315-560-9307 Katrina Grigg-Saito: 315-560-9223 ==things . . . ==documents for the retreat== '''FOR PDW (aug 2-3 8:45a-5:30p)''' Lawrence Hall -Ho Lecture room- Room . . . 1. Barbara London - moma 2. Ruth Keffer - sfmoma 3. Jonah Peretti - eyebeam 4. Pam Winfrey - exploratorium . . .
2K - last updated 2009-06-29 11:10 by Auriea
CaesarSalad
[[Food]] '''Green Garlic Caesar Salad With Anchovy Croutons''' 1/2 cup olive oil 7 anchovy fillets, finely . . . layer, stalk and root end removed) or substitute 3 large garlic cloves, finely chopped 3 ounces crusty . . . day-old bread in 3/4-inch cubes (about 2 cups) 1/8 teaspoon kosher salt, . . . Worcestershire sauce 2 large eggs 2 large or 3 small heads romaine lettuce, separated into leaves . . . and torn into pieces, if desired (about 10 cups) 3/4 cup Parmesan cheese, grated. 1. Make croutons: . . .
2K - last updated 2010-06-14 20:58 by au
CaproniCasts
SketchBook [[thumb:CaproniCasts-Cover|right|300px|frame| Not sure where I got the catalog anymore but . . . It seems the one I have is from 1923. I would love to order one of the reproductions... . . .
2K - last updated 2006-06-17 20:54 by Auriea
CastOfThousands
CastOfThousands any proper account of my life will have to include all of the following people. <list . . . <html><object width="480" height="360"><param name="movie" value="http://www.dailymotion.com/swf/video/x7y80w_1914_creation?additionalInfos=0"></param><param . . . width="480" height="360" allowfullscreen="true" allowscriptaccess="always"></embed></object><br . . .
1K - last updated 2010-08-01 14:24 by Auriea
CatIdeas
[[Ling]] ==Catification== * plank above michael's desk -> 1m x 30cm ** connect to the projector platform . . . * http://www.zooplus.nl/shop/katten/krabpaal_krabmeubels/krabtonnen/krabtonnen/277865 . . . http://www.bol.com/nl/p/krabpaal-serpa-zwart-40x40x90/9200000025083080/ . . . http://www.bol.com/nl/p/krabmeubel-segra-35x35x44/9200000026309213/ http://www.scratchycats.com/kitten_sisal_cat_scratching_post.html . . . Expensive: http://www.purrfectdesign.net/en/nekozen-bamboo.html?id=13891499 . . .
4K - last updated 2014-10-29 18:32 by Auriea
CauliflowerSoup
[[Food]] cauliflower soup 11/2 c. onion 1 1/2 lb cauliflower 12 tsp salt 1/8 tsp cayenne 3 tblsp fresh . . . 1/2 c milk 1/2 cream) onion in oil oil, brown, 3 min. add cauliflower, salt, cayenne, 2 tblspn dill . . . and stock. cook 25-30 min, puree (i will puree all but 2 cups, i think), . . .
1K - last updated 2009-09-12 23:09 by 78-21-206-50.access.telenet.be
Celtic Holidays
[[Research]] ==Samhain== (sow-een or sow'-inn) Traditional date: October 31 to November 1 Actual astrological . . . ==Beltaine== or Beltane Traditional date: April 30 and/or May 1 Actual astrological date: May 6th in . . . 21 Actual astrological date: September 23 in 2006 and 2007 Autumn Equinox, first day of Autumn, . . .
6K - last updated 2007-08-19 10:25 by Auriea
CeremonyOfInnocence
[[Games]] <html> <object width="700" height="525"><param name="allowfullscreen" value="true" . . . value="http://vimeo.com/moogaloop.swf?clip_id=6743011&server=vimeo.com&show_title=1&show_byline=1&show_portrait=1&color=00adef&fullscreen=1" . . . src="http://vimeo.com/moogaloop.swf?clip_id=6743011&server=vimeo.com&show_title=1&show_byline=1&show_portrait=1&color=00adef&fullscreen=1" . . . ==A CD-ROM== [[thumb:CeremonyOfInnocence-image|130px|right]]somewhere between a game, a novel, a short . . . Amazon]! ;)}} The books themselves were quite . . .
10K - last updated 2009-10-29 13:04 by Auriea
CharacterDesigners
CastOfThousands [[drawing]] Some CharacterDesigners I admire: '''[::AkihikoYoshida]''' Final Fantasy . . . Interview - http://www.1up.com/do/feature?cId=3152237&did=1 '''[::TetsuyaNomura]''' Final Fantasy . . .
3K - last updated 2006-09-24 20:10 by Auriea
Chowder
[[Food]] ; To serve about eight . . .: 4 oz. bacon 1 lg. onion, chopped 1 stalk celery, chopped . . . kernels cut from the cob to equal about 3 c. (or substitute frozen) salt and pepper 2 . . . the vegetables, stirring and cooking for about 3 to 4 minutes. • Add the potatoes, chicken stock, . . . fish broth, plus enough boiling water, to make 3 cups liquid. Add to pot and simmer 30 minutes. Add . . . cup salt pork 1 medium onion 1 - 1 1/2 (2 1/2 to 3 3/4 dl) cup fish meat '''Cream Sauce:''' 1/4 (1./2 . . .
5K - last updated 2006-03-20 12:33 by Auriea
Cinema2007
[[Movies]] I'm sure i'm forgetting some! :( # Evil Dead 1 # Evil Dead 2 # Evil Dead 3 # Reniassance # . . . # The Girl from Monday # Simple Men # Spy Kids 3 # Labyrinth (but i fell asleep on it, did they get . . .
2K - last updated 2007-06-02 22:20 by Auriea
ClipStudioPaint
[[Reference]] ==using vector tools== [[tube:deb3wLpjQTg 640 480 0]] . . .
1K - last updated 2014-06-18 15:27 by Auriea
Cluster
* [[3dPrinting]] * [[Botany]] * [[CreativeWriting]] * [[CastOfThousands]] * [[CurrentObsession]] * [[ObjectSeries]] . . .
1K - last updated 2018-11-01 14:28 by Auriea
ConfigPage
package OddMuse; $CookieName = 'akiw'; $SiteName = 'Auriea L'; $HomePage = 'AurieaL'; $RCName = 'About'; . . . $KeepDays = 365; $defaultTZ = 2; $UploadAllowed = 1; @UploadTypes . . . ''; $SurgeProtection = 1; $SurgeProtectionTime = 30; $SurgeProtectionViews = 100; $MaxPost = 10000 * . . . $ImageUrlPath = '/static'; $SoundUrlPath = '/mp3'; # URL where the mp3 files are to be found $LocalNamesCollect . . . met in hell %s years ago today.", '1999-01-30'=>"Michael sends Auriea breath.html beginning . . .
6K - last updated 2023-10-25 14:36 by au
Contact
==EMAIL ME== <center>For direct inquiries please contact: studio@auriea.art</center> ==FIND . . . * http://e8z.org/html/BLINK.php3 . . .
2K - last updated 2025-02-17 10:10 by AuOG
Context
* [http://instagram.com/auriea.harvey.studio|SCULPTURE] * [https://vimeo.com/showcase/7076574|SIMULATIONS] . . . * http://e8z.org/html/BLINK.php3 TEACHING http://khkgames.de http://gamedesign.university/ . . .
1K - last updated 2020-12-28 18:30 by Auriea
Cornbread
[[Food]] ===Ingredients=== 1 cup all-purpose flour 1 cup yellow cornmeal 2/3 cup white sugar 1 teaspoon . . . salt 3 1/2 teaspoons baking powder 1 egg 1 cup milk 1/3 . . .
1K - last updated 2010-01-20 16:59 by Auriea
CountessTheWorldHasChanged
[[TheLessonOfNN]] [http://amsterdam.nettime.org/Lists-Archives/nettime-bold-0106/msg00183.html Countess, . . .
2K - last updated 2008-01-21 16:20 by Auriea
CraterLake
OutsideSomeplace [[background external:http://farm4.static.flickr.com/3311/3220926576_c92fc88cbc_b.jpg|repeat . . . <html><object width="400" height="300"> <param name="flashvars" value="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Ftags%2Fcraterlake%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Ftags%2Fcraterlake%2F&user_id=81482434@N00&tags=craterlake&jump_to=&start_index="></param> . . . . . . width="400" height="300"></embed></object></html> . . .
1K - last updated 2010-04-06 00:16 by Auriea
CurrentObsession
[[Projects]] I like things to be super clear. I like them to be -rich. I like JazzStandards and FairyTales. . . . * [[Astrology]] * MovingToRome * [[3dPrinting]] * DigitalSculpture * [[kHkGames]] * [[Form2]] . . . ----- [[2018-02-16]] * [[Clay3dPrinting]] * [[3dPrinting]] * OldMasters * OilPainting . . . of the world, ancient visions of the cosmos # [[3dPrinting]] # ProjectorBeamer # OneMillionDollars . . . ---- LearningToDrive ----- something about: * 3d polygons * 3d printed objects as sculpture * application . . .
4K - last updated 2019-05-18 16:46 by Auriea
Cyberspace
ElegantMedia [[image:CyberMapLandmarks]] ''lifted from: https://web.archive.org/web/19970207225527/http://pespmc1.vub.ac.be:80/CYBSPACE.html'' . . . is to integrate the intuitive geometry of 3-D virtual reality, with the more general, but cognitively . . .
5K - last updated 2020-01-03 00:31 by Au-Elektra
DHTML
[[Reference]] ==css== Listamatic - http://css.maxdesign.com.au/listamatic/ make a list look "different" . . . Server Side Includes] * [http://www.ericmeyeroncss.com/bonus/render-mode.html . . . Ten CSS Tricks You May Not Know] * http://www.smashingmagazine.com/2007/01/19/53-css-techniques-you-couldnt-live-without/ . . .
2K - last updated 2007-05-14 13:54 by Auriea
DSBrowserTranslation
[[Games]] ===== ===== NINTENDO DS OPERA WEB BROWSER FAQ (INCLUDES A SETTINGS MENU TRANSLATION) 4.05 ===== . . . 2. Where to Buy the Nintendo DS Browser [SEC2] 3. Browser Function [SEC3] DS Region Compatibility . . . [SEC3A] Limitations [SEC3B] Extending the DS Battery Life . . . [SEC3C] Wireless Communication [SEC3D] Browser Compatibility . . . with Web Page Sign-Ins [SEC3E] Using the Browser to Enable DS WiFi Games [SEC3F] . . .
27K - last updated 2007-01-10 13:03 by Auriea
DadaManifesto
[[Reference]] <html><div align=right><font size=-1><font color=000000>(The signatories . . . color=black><font size=+3><b>DADA</b> EXCITES . . . align=center><b><font size=+3>BUT . . . . . . . . .</font><p></div><div . . . align=left><font size=+3> <b>NEVER NEVER NEVER</b><p></font></div><div . . . align=left><font size=+3><b>THE MINISTRY IS OVERTURNED.</b></font><font . . .
6K - last updated 2007-05-22 22:55 by Auriea
DancingDrawing
[[Writing]] DrawingDancing [[background:DancingDrawing-image2|repeat #00FF00 scroll top]] '''A report . . . https://c1.staticflickr.com/1/649/23386951742_41aa815b47_b.jpg . . . a next step. https://c1.staticflickr.com/1/716/23413091441_f9d8573256_z.jpg I am an artist who Draws. . . . [https://www.icloud.com/keynote/000LZSpLbedhTA3nZntPYM7Xg#D&D]. I expressed my confusion and . . . [https://www.icloud.com/keynote/000LZSpLbedhTA3nZntPYM7Xg#D&D], William Kentridge [https://www.youtube.com/watch?v=2-n5Kvw9v4A], . . .
13K - last updated 2017-02-12 14:58 by Auriea
DancingDrawing-image3
image/jpeg
69K - last updated 2015-12-23 00:52 by Auriea
DasLook
TuinPlanten [[Gog:Allium Ursinum]] http://www.bioimages.org.uk/HTML/R140989.HTM basically, it's wild . . . Height: 12-18 in. (30-45 cm) 18-24 in. (45-60 . . . cm) Spacing: 3-6 in. (7-15 cm) Sun Exposure: Light Shade Danger: . . .
1K - last updated 2005-12-21 12:23 by Auriea
DavidBowie
CastOfThousands http://womanonfire.livejournal.com/823684.html . . .
1K - last updated 2007-11-12 14:25 by Auriea
DeepPaint
[[Reference]] I've chosen to learn DeepPaint3d instead of BodyPaint3d because it has '''less''' features. . . . menu options or other choices within Deep Paint 3D, without having to search through menus or dialog . . . accelerate your work within Deep Paint 3D. Wherever possible, Deep Paint 3D uses the same . . . <strong class="specialbold"><3</strong>></p> </td> </tr> . . . <strong class="specialbold"><F3</strong>></p> </td> </tr> . . .
23K - last updated 2006-07-15 13:35 by Auriea
DesktopSculpture
[[Projects]] This relates to ideas started by our project '''[http://kiss.entropy8zuper.org The Kiss]''' . . . about ElegantMedia I think that RealTime 3d is under utilized as an artistic medium. It is used . . . [[Zbrush]] QuartzComposer [[Blender]] [[Quest3D]] MaxMsp DesktopSculptures are RealTime 3D trinkets . . .
1K - last updated 2005-11-30 15:06 by Auriea
DigitalPainting
SketchBook ''see also: [[Painter]] (software) ==How detailed is detailed== close up of leaves, photos . . . - http://forums.cgsociety.org/showthread.php?t=236250 * http://features.cgsociety.org/story_custom.php?story_id=3275&page=1 . . .
2K - last updated 2014-09-29 13:27 by Auriea
DigitalPhotography
[[photography]] ===Problems=== # Digital photography is too beholden to past paradigms ## the framing . . . a ton of examples of digital imaging gone awry [3]. In a way, these are the digital analogues of dust, . . . #http://flickr.com/photos/duchamp/2643457119/in/set-72157605106384679/ . . .
4K - last updated 2008-11-11 22:55 by Auriea
DigitalPuppetry
ElegantMedia I'm not a big fan of machinima... or at least what people have done with it thus far... . . . the insertion of drama. I would love to make a 3d ShadowPlay (nog altijd) [http://www.linuxdevices.com/articles/AT6435065918.html . . .
1K - last updated 2007-05-23 22:30 by Auriea
DigitalSculpture
[[Sculpture]] <center><html><iframe width="240" height="480" src="https://sketchfab.com/models/43253ee0013a4603a7af20069a7c9383/embed?autostart=1&ui_infos=0" . . . [[image:2007-05-20]] striving to take my 3d to the next level (as they say) ------ ===web3d=== . . . day! * OLD --> http://code.google.com/apis/o3d/ O3D is an open-source web API for creating rich, . . . interactive 3D applications in the browser. This API is shared . . . about establishing an open web standard for 3D graphics. ===3dScanning=== * StructureSensor * [[Kinect]] . . .
2K - last updated 2017-08-24 00:42 by Au-Danae
DigitalSketchBook
SketchBook images drawn on a HomebrewDS using http://www.collectingsmiles.com/colors/ <html><object . . . width="400" height="300"> <param name="flashvars" value="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157605335422304%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157605335422304%2F&set_id=72157605335422304&jump_to="></param> . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157605335422304%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157605335422304%2F&set_id=72157605335422304&jump_to=" . . . width="400" height="300"></embed></object></html> . . .
1K - last updated 2009-02-01 14:14 by Auriea
Dimensions360Render
application/pdf
490K - last updated 2017-02-28 15:39 by Auriea
DontReadComments
<html><blockquote class="twitter-tweet" lang="en"><p>You have time to create something . . . time to do both.</p>— Don't Read Comments (@AvoidComments) <a href="https://twitter.com/AvoidComments/status/498506564270301185">August . . .
1K - last updated 2015-02-24 16:07 by Auriea
DorothyParker
[[Quoth]] [[image:MarieOfRoumania]] [[tube:7TMb8yImWSU 380 300 0]] . . .
1K - last updated 2007-04-05 20:44 by Auriea
Dracaena
TuinPlanten Dracaena marginata is een struikachtige plant met slanke, vertakte twijgen, die door de littekens . . . Deze plant staat graag op een lichte plaats (3 meter van het venster). Voorkom direct middag- en . . . lux nodig om te overleven, met een optimum van 1300 lux. Dracaena marginata kan schaduw verdragen. . . . een rust aanbevolen met een temperatuur rond de 13 °C. Bruine bladtoppen zijn een symptoom van op de . . .
2K - last updated 2008-09-10 00:59 by Auriea
DramaPrincess
ElegantMedia Drama Princess is a research project by Tale of Tales (Auriea Harvey & Michael Samyn). . . . characters, reusable in different realtime 3D environments and situations. The characters should . . .
1K - last updated 2006-07-30 23:18 by Auriea
Drawing
ElegantMedia ''see also: Projects, ElegantMedia, RandomIdeas, Books, Raphael, DancingDrawing, TheLivingLine'' . . . [[thumb:2014-09-24|200px]] [[vimeo:49597331 160 120 0]] [[thumb:AurieaDrawing2|200px]] [[thumb:AurieaDrawing3|200px]] . . . Art Collections – Royal Museum . . .
2K - last updated 2017-08-23 13:18 by Au-Mercury
DrawingDay
[[Drawing]] '''DrawingDay is currently Saturday.''' ==The Rules of Drawing Day== # Feel like you can . . . waste time. [https://www.goodreads.com/quotes/51360-draw-antonio-draw-antonio-draw-and-don-t-waste-time] . . .
1K - last updated 2014-05-08 18:17 by Auriea
DrawingHardware
[[Research]] ''...artists can stylize their curves while drawing by dynamically adjusting line thickness . . . by applying pressure against an imaginary 3D surface, making drawing in the air feel similar . . .
1K - last updated 2010-10-19 00:43 by Auriea
DymaxionMap
[[Reference]] http://upload.wikimedia.org/wikipedia/commons/b/bb/Dymaxion_2003_animation_small1.gif <tt>The . . .
1K - last updated 2008-09-24 10:06 by Auriea
EagleCreek
[[park]] [[image:EagleCreek-imgFromMomsCellPone]] [[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060815-eaglecreektrees1.flv&repeat=true|320|240|#000000|high|noscale]] . . . [[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/MOL004.ASF.ff.flv&repeat=true&clicktext=1.|176|144|#000000|high|noscale]] . . . . . .
1K - last updated 2007-08-25 19:03 by Auriea
ElectronicPaper
ElegantMedia ''see also: DigitalBookBinding, handscroll, ProsperosBooks'' <html><object width="586" . . . classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000"><param name="movie" value="http://www.sony.co.jp/video3/player.swf?lang=en"></param><param . . . name="flashVars" value="config=/video3/201005/10-0526/config.xml&lang=en"></param><param . . . src="http://www.sony.co.jp/video3/player.swf?lang=en" type="application/x-shockwave-flash" . . . flashVars="config=/video3/201005/10-0526/config.xml&lang=en" allowFullScreen="true" . . .
2K - last updated 2010-05-27 12:17 by Auriea
ElegantMedia
[[background:TheZone|repeat #000000]] all the things i wouldn't throw away ''related: beauty, romance, . . . ----- part of the reason i [[Book31|went to rome]] is because after all these years . . . that all my stuff, since i started working on 3d, has been an attempt to get back to the origins . . .
3K - last updated 2020-04-08 17:46 by Auriea-Mercury
Empire
''see also: ComputerHistory'' ==DOMAINS.== <center>'''''Because [http://art.teleportacia.org/Location_Yes|Location . . . * http://e8z.org ** http://e8z.org/html/BLINK.php3---EVERYTHING up to 2003 *** http://entropy8zuper.org/airport/experts.html . . . * http://www.facebook.com/auriea (CLOSED, <3 YES!) * http://www.flickr.com/photos/entropy8/, see . . . ** http://zauriea.tumblr.com/ -- for my 3d obsessions ** http://fuckyeahtarot.tumblr.com -- . . . * http://mubi.com/users/81386 * http://mixi.jp (womanonfire) * http://sixteenpages.net . . .
4K - last updated 2019-12-11 12:59 by Auriea-Mercury
EncyclopediaOfEverything
[[Quoth]] In "TheAnalyticalLanguageOfJohnWilkins" Borges describes 'a certain Chinese Encyclopedia,' . . . that belong to the Emperor, 2. embalmed ones, 3. those that are trained, 4. suckling pigs, 5. mermaids, . . . with a very fine camelhair brush, 12. others, 13. those that have just broken a flower vase, 14. those . . .
1K - last updated 2012-07-03 18:05 by Auriea
Entropy8.com
[[Empire]] <center> [[image:flames.gif]] http://entropy8.com/NetscapeNavigator.gif http://entropy8.com/painting/ . . . http://30.media.tumblr.com/tumblr_l6cddiftt11qzs56do1_500.gif . . .
1K - last updated 2018-09-10 19:42 by Auriea.
EnvironmentModeling
DigitalSculpture ==tips and tutorials== http://www.3dtotal.com/team/Tutorials_2/making%20of_urban-environment/urban_01.asp . . . http://forums.cgsociety.org/showthread.php?f=39&t=444791&page=1&pp=15 . . .
1K - last updated 2008-05-02 22:18 by Auriea
ErikSatie
CastOfThousands Erik Satie (1912–13) Memories of an Amnesiac (Fragments) 1. What I Am Everyone . . . F sharp, of a very common type, registered 93 kilograms. It came out of a very fat tenor whose . . . Get up: at 7:18 a.m.; inspired: from 10:23 to 11:47. I lunch at 12:11 p.m. and leave the table . . . horse to the end of my grounds: from 1:19 to 2:53. More inspiration: from 3:12 to 4:07. Various . . . Going to bed to takes place regularly at 10:37. Once a week I awake with a start at 3:19 a.m. . . .
5K - last updated 2009-11-27 18:52 by Auriea
EveryIcon
[[Empire]] <center><html> <iframe src="http://auriea.org/everyIcon.html" width="450" height="420"> . . . of infinity! some text: <source> Given: A 32 X 32 Grid Allowed: Any element of the grid to be . . . The total number of black and white icons in a 32 X 32 grid is: 1.8 X 10308(a billion is 109). Though, . . . a typical desktop computer), it will take only 1.36 years to display all variations of the first line . . .
3K - last updated 2016-08-11 14:09 by Auriea
ExLibris
[[Empire]] want to design an ExLibris for our library. Not sure if it should be printed for co-ownership . . . four general types: the heraldic, as in Fig. 32, consisting of crests, designs in armor, and traditional . . . aith the individual or his library, Fig. 33; the conventional, which introduces a purely decorative . . . to render the design unique and beautiful, Fig. 34; and the pictorial, Fig. 35, which includes designs . . .
2K - last updated 2010-08-24 17:19 by Auriea
Example No.22
[[Exhibitions]] <center>[[thumb:Example_No.22_install01|650px]]</center> '''A lecture/performance . . . Kasseler Dokfest] 2018 Exhibition of 3D printworks: 13-18 Nov, Lecture: 15 Nov Location: . . .
1K - last updated 2020-12-29 01:30 by Auriea
Example No.22 Installation Images
[[thumb:Example_No.22_install01|left|300px]] [[thumb:Example_No.22_install02|left|400px]] [[thumb:Example_No.22_install03|left|300px]] . . . [[thumb:Example_No.22_install06|left|300px]] [[thumb:Example_No.22_install07|left|400px]] . . .
1K - last updated 2018-11-23 21:11 by Auriea.
Example No.22 install03
image/jpeg
1595K - last updated 2018-11-23 21:02 by Auriea.
Example No.22 lables
[[Example_No.22]] '''Magdalene''' These sculptures were inspired by various tales about the life of biblical . . . she regrets nothing. The form is based on the 3D scan of a model, manipulated with 3D software, then . . . three ages. '''Example #22''' An exhibition of 3D Printworks by Auriea Harvey (auriea.org) Made with . . . the technique of 3D printing and handcraft A collaboration between herself . . .
2K - last updated 2018-11-14 20:34 by Auriea.
Exhibitions
* '''[[YEAR_ZERO]]''' * '''[[Synthetic_Corpo-Reality]] * '''[[In_The_Kingdom_No._19]]''' * '''[[Example_No.22]]''' . . . Kasseler Dokfest] 2018 Exhibition of 3D printworks: 13-18 Nov, Lecture: 15 Nov Location: . . .
1K - last updated 2021-02-23 12:40 by Auriea
ExoticFood
[[Food]] http://www.chefkoch.de/rezepte/2351371373904775/Bulgur-Salat.html http://www.chefkoch.de/rezepte/904381195730161/Dolmades.html . . . http://www.chefkoch.de/rezepte/259631101560945/Reitersuppe.html . . .
1K - last updated 2013-09-18 13:38 by Auriea
FataleVrouwen
[[Mythology]] == [::Eve] == [[thumb:Eve-Snake|right]] the first woman. ==TheGraeae== : Mythica:Graeae . . . said police officer Ram Bharose. The woman, 35, told police she had gone to a nearby forest to . . . Related == http://pages.infinit.net/cadieux3/fairytail.html ArmlessMaiden . . .
16K - last updated 2013-01-05 20:57 by Auriea
Fauna
[[thumb:Fauna-image.jpg|700px]] Fauna, 2018 3d printed plaster, 3d printed bronze, terracotta clay, natural . . . bronze paint dimensions: 16.9cm-w\20.0cm-h\14.3cm-d <center> [[model:Fauna/gltf/scene.gltf|Fauna/Fauna.usdz|Fauna|width:300px;height:500px;]] . . .
1K - last updated 2020-11-16 14:44 by Auriea-Mercury
FavoriteApps
[[Empire]] * = not for iPad but i use it on iPad anyway ! = Don't know what I would do without it. Convert* . . . IncrediBooth - fun photo booth app by . . . https://itunes.apple.com/be/app/incredibooth/id378754705?mt=8 if you don't have the apps for these . . . Tweetbot! - may absolute favorite twitter . . . https://itunes.apple.com/be/app/ifiles/id336683524?mt=8 Stuff Apple makes that I find goo to . . .
6K - last updated 2013-01-04 14:55 by Auriea
FavoritePodcasts
[[Empire]] ===Antiquity Podcasts=== # Dan Carlin's Hardcore History - https://itunes.apple.com/be/podcast/dan-carlins-hardcore-history/id173001861?mt=2 . . . # Early Middle Ages (Yale) - https://itunes.apple.com/be/course/early-middle-ages/id519131977 . . . # Jennifer Lockett's Classical Archeology . . . # The Roman World - http://itunes.apple.com/be/itunes-u/the-roman-world/id547152737 . . . ===Knowledge=== # The History of Philosophy . . .
3K - last updated 2013-01-07 11:59 by Auriea
FieldRecordings
MySong http://www.quietamerican.org/ a great place to contribute sounds to: http://soundtransit.nl/ http://www.arteradio.com/wai/rubrique.do?num=17057 . . . recorder from way back when. its a SONY MZ-R30 [http://www.minidisc.org/part_Sony_MZ-R30.html] . . . i need a new microphone. thus,... LJ:751903.html I am most interested in the OKM soundman [http://www.soundman.de], . . . RUE LESBROUSSART 1050 BRUSSELS BELGIUM tél. 0032 2 648.47.09 fax 0032 2 648.45.86}} ;) http://www.soundman.de/usa/usa.htm . . . . . .
2K - last updated 2009-05-27 14:03 by Auriea
FiftyBooks
''see also: http://www.goodreads.com/user/show/5685418-auriea, FavoritePodcasts, FromLibrary '' ::: Murderous . . . - ChimamandaNgoziAdichie ===2013=== # The Iliad # InSearchOfLostTime - Marcel Proust . . . # Harrient The Spy # [[1Q84]] (bk.1&2&3) - HarukiMurakami # The Classic Point of View - Kenyon . . . - Patrick Suskind # Fables (1-63) - Bill Willingham # TheUnbearableLightnessOfBeing . . . J.D. Salinger # [http://www.bibliomania.com/0/2/332/2435/28336/1/frameset.html The Wanderings of Oisin] . . .
5K - last updated 2015-01-03 13:37 by Auriea
FilamentList
[[3dPrinting]] <center>[[thumb:FilamentHeads|400px]]</center> <center>'''FILAMENT LIST'''</center> . . . Moldlay ||[https://www.matterhackers.com/store/3d-printer-filament/moldlay-filament-3.00mm FAQ] print . . . it and it´s bendable|| || || Wood || Laywoo-D3 ||[https://orbi-tech.de/shop/3D-Filaments/LayWoo-d3:::72_76.html] . . . || Felt || Layfelt ||[https://orbi-tech.de/shop/3D-Filaments/Poro-Lay:::72_125.html] to be tried. || . . . || || || || || PET ||clear ||print very high @232°, bed at 100°. don't like it as much as PP. stringy, . . .
4K - last updated 2020-11-19 14:39 by 93-39-148-182.ip76.fastwebnet.it
FinalFantasy
[[Games]] <html><embed style="width:400px; height:326px;" id="VideoPlayback" type="application/x-shockwave-flash" . . . flashvars=""> </embed></html> . . . <html><object width="425" height="353"><param name="movie" value="http://www.youtube.com/v/Q02ompQhtY8&rel=1"></param><param . . . wmode="transparent" width="425" height="353"></embed></object></html> . . .
1K - last updated 2007-10-15 01:13 by Auriea
Flash
[[Reference]] ==''"The only HTML i need is the embed tag"''== I will begin again my learning of flash. . . . Page turn effect] * [http://kirupa.com/developer/mx/photogallery.htm . . . <source> <TABLE WIDTH="100%" HEIGHT="316" BORDER=0 CELLPADDING=0 CELLSPACING=0 BGCOLOR="#000000"> . . . classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,0,0" . . . WIDTH="100%" HEIGHT="300" id="panorama" ALIGN=""> <PARAM NAME=movie . . .
2K - last updated 2007-05-05 13:47 by Auriea
FlashSettings
[[Flash]] http://livedocs.macromedia.com/flash/mx2004/main_7_2/wwhelp/wwhimpl/common/html/wwhelp.htm?context=Flash_MX_2004&file=00000484.html . . . configuring a web server for . . . HTML publishing templates</a>) . . . publish settings for Flash Player . . .
12K - last updated 2006-09-04 10:58 by Auriea
FlatFoot
==How to cure Flat Feet== strange because i'm sure i researched this before and there was nothing on . . . ** <html><iframe width="560" height="315" src="https://www.youtube.com/embed/QY5FW9BPbBg" . . . the pressure from the right to the left. After 2-3 minutes shift the ball towards the front foot, heels . . .
3K - last updated 2016-05-14 19:05 by Auriea
Flickr
<html> <a data-flickr-embed="true" href="https://www.flickr.com/photos/entropy8/albums/72157669842528051" . . . width="480" height="640" alt="L.O.C.K."></a><script . . . src="https://farm4.staticflickr.com/3906/14457304234_384a863716.jpg" width="500" height="281" . . .
1K - last updated 2017-08-01 22:49 by Au-Mercury
Florence
OutsideSomeplace <html><iframe width="100%" height="166" scrolling="no" frameborder="no" src="http://w.soundcloud.com/player/?url=http%3A%2F%2Fapi.soundcloud.com%2Ftracks%2F14166762&show_artwork=true"></iframe></html> . . .
1K - last updated 2012-06-07 15:50 by Auriea
Form2
[[3dPrinter]] Momus and Papposilenus eagerly await! [[thumb:2018-08-24_MagsFirstForm|350px]] LUC IS CURRENTLY . . .
1K - last updated 2018-10-08 22:06 by Au-Roma
FoundScripts
[[Empire]] http://www.naarvoren.nl/artikel/hover.html Pulldown Links with text description underneath . . . align="left" style="font:italic 13px Arial"> </span> </form> <!--Example . . . size="1" style="background-color:#E3FFDF" onChange="displaydesc(document.form2.select2, . . . align="left" style="font:italic 13px Arial"> </span> </form> <!--IMPORTANT: . . . to date news on the technology front" thetext1[3]="News.com- The #1 technology News site." thetext1[4]="Web . . .
16K - last updated 2005-08-09 17:17 by AurieaHarvey
FourteenHolyHelpers
SaintChristopher and Saint Giles were invoked against the plague itself. Saint Denis was prayed to for . . . ||Against fever and sudden death|| ||Blaise ||3 February ||Against illness of the throat and for . . . family discord|| ||George (Georgius) ||23 April ||For the health of domestic animals|| ||Giles . . .
2K - last updated 2017-09-05 12:11 by Au-Mercury
Framelessness
[[Simulation]] ==Equirectangularity== # I’ve got a 360 camera and It’s given me complicated thoughts . . . of the golden section. [[tube:MyFp5joAd7s 320 240 0]] . . .
1K - last updated 2018-12-05 22:22 by Au-Roma
French
[[Language]] FrenchClassNotes ==words i love== * '''ainsi''' Ainsi va la vie (Such is life) Ainsi soit-il . . . so forth) * '''ailleurs''' elsewhere [[vimeo:2113477 320 240 0]] i want to learn french FROM HER! ==new . . . Henleykaai 83 * Maandag tot vrijdag van 9u tot 11u30 en van 13u30 . . . tot 19u30 * Zaterdag van 9u tot 11u30 started september 3rd . . .
1K - last updated 2009-01-27 00:11 by Auriea
FromLibrary
FiftyBooks ''see also: [[bibliotheek]], FiftyBooks, Books'' # [[Bib:Tintoretto]] # [[Bib:Kathe Kollwitz]] . . . Di Lampedusa [http://www.amazon.com/gp/product/0375714790?ie=UTF8&tag=morbanat-20&linkCode=as2&camp=1789&creative=9325&creativeASIN=0375714790] . . . * http://zoeken.bibliotheek.gent.be/?q=Amos+Tutuola . . .
2K - last updated 2015-10-18 12:14 by Auriea
FumitoUeda
[[Games]] [[image:KenjiKaidoAndFumitoUeda]] 海道賢仁と上田文人 Pictures:Ueda IcoAndYorda WandaAndTheColossus . . . and innovative without looking like just another 3D adventure title. ICO was originally developed as . . . http://www.psillustrated.com/teamps2/ip_ico_fumito.html . . . interview was conducted for Gamasutra by [http://livejournal.com/users/108 . . .
9K - last updated 2005-11-30 23:56 by 84.193.164.170
GameEngines
[[Games]] ''see also: InteractiveFiction, Unity3d, Quest3d'' ==IF== * http://www.inklestudios.com/inklewriter . . .
1K - last updated 2013-01-07 15:00 by Auriea
Games
ElegantMedia == Definition == # I would say that all good art contains all the arts. # with videogames . . . ==Game companies composed of one or two or 3 people== Bit Blot - http://www.bit-blot.com/ ABA . . . cheats [http://www.mycheats.com/view/section/6153/6242/hotel_dusk_215/nintendo_ds] . . . walkthrough: http://faqs.ign.com/articles/734/734985p1.html * Guild Wars ** wiki: http://gw.gamewikis.org/wiki/Main_Page . . .
3K - last updated 2017-06-07 16:45 by Au-Mercury
GamesImLookingForwardTo
[[Games]] <html><object id="flashObj" width="486" height="412" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" . . . /><param . . . /><param name="flashVars" value="videoId=35247354001&playerID=22881388001&domain=embed&" . . . bgcolor="#FFFFFF" . . . flashVars="videoId=35247354001&playerID=22881388001&domain=embed&" . . .
3K - last updated 2009-09-26 22:27 by Auriea
GamesWithoutShooting
[[Games]] I mean something very specific. not only without shooting but '''with''' a story. Not "adventure" . . . point and click. I mean games which are realtime 3d and immerse you in the story you play. Most likely . . . these will be avatar based 3rd person perspective games. * Raw Danger [http://forums.selectbutton.net/viewtopic.php?t=11192] . . . [[tube:NzHDnEf1z2A 320 240 0]] * Shadow of Memories/Destiny [[tube:f9e4fkop7CE . . . 320 240 0]] . . .
1K - last updated 2008-01-05 14:23 by Auriea
GardenArt
[[Botany]] http://www.vvork.com/wp-content/uploads/2007/08/ga.jpg http://www.icaphila.org/exhibitions/washburn.php . . . http://imomus.livejournal.com/309161.html http://echostudiochicago.com/learn/patrick-blancs-vertical-gardens . . . http://www.heavypetal.ca/archives/2007/03/a_brief_history_of_seedballs.html http://www.pathtofreedom.com/pathproject/gardening/seedballs.shtml . . .
1K - last updated 2007-08-22 12:28 by Auriea
GawkerArtists
<html> <a href='http://d1.openx.org/ck.php?n=a4b76645&cb=12345' target='_blank'> <img . . .
1K - last updated 2009-04-08 14:39 by Auriea
German
[[Language]] ==Hörspiel== bayern 2 Hörspiel Pool, right now it seems they are doing a lot of novels . . . * https://www.deutschlandfunk.de/lange-nacht.703.de.html And I just started listening to this (while . . . or elsewhere) * https://www1.wdr.de/radio/wdr3/programm/sendungen/wdr3-hoerspiel/der-dunkle-wald-science-fiction-hoerspiel-100.html . . .
1K - last updated 2019-04-19 21:52 by Au-Roma
Godot
needs a serious look https://docs.godotengine.org/en/3.1/ . . .
1K - last updated 2020-01-05 14:20 by Au-Elektra
GoodPosture
Because i have terrible posture and must make it better (to quit injuring my neck e.g.) ---- == Exercises . . . You'll be surprised how much exercise fits into 30 seconds. . . .
2K - last updated 2012-02-27 13:36 by Auriea
GoogleCardboard
==dev== * https://forum.unity3d.com/threads/how-to-use-cardboard-reticle-vr-gaze-pointer-cursor-cardboard-button-gaze-input.388492/ . . .
1K - last updated 2017-05-05 11:15 by Au-Danae
GoogleMaps
OutsideSomeplace <source> <script src="http://maps.google.com/maps?file=api&v=2&key=ABQIAAAA8gziLuG785smzT0a6REW3xSFtqeBGFMupH7NOyruGQrymP0yWxSFFVhoZ1mjmkxdzEiGTARy75-iVw" . . .
1K - last updated 2006-06-05 11:03 by Auriea
GreekTragedy
CreativeWriting * [[WikiPedia:Choerilus (playwright)|Choeriluĉs]] * [[WikiPedia:Aeschylus]] (c. 525–456 . . . (467 BCE) ** [[WikiPedia:The Suppliants]] (463 BCE) ** [[WikiPedia:The Oresteia]] (458 BCE, a trilogy . . . Œdipus * [[WikiPedia:Achaeus of Syracuse]] (c. 356 BCE) * [[WikiPedia:Agathon]] (c. 448–400 BCE) . . . ** [[WikiPedia:Alcestis (play)|Alcestis]] (438 BCE) ** [[WikiPedia:Medea (play)|Medea]] (431 BCE) . . . (unknown) ** [[WikiPedia:Phaesus]]" (411-321 BCE) . . .
3K - last updated 2011-01-26 01:33 by Auriea
HandsInXR
hold these links for me * https://github.com/jmmmp/Pd_Leapmotion_win * https://github.com/NeoSpark314/godot_oculus_quest_toolkit . . .
1K - last updated 2020-01-05 14:19 by Au-Elektra
HappyBirthday
ProofOfMyExistence [[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060820-sharis_birthday_song.flv|320|240|#000000|high|noscale]] . . .
1K - last updated 2006-12-18 14:09 by Auriea
HardBoiledWonderlandAndTheEndOfTheWorld
FiftyBooks This is the book that [http://cocooncharacters.com Lina] said she would most like to illustrate. . . . reminded me of the Sadawaar and [[SketchBook:Book32]]. It is a sci-fi (not too distant future, not too . . .
2K - last updated 2006-07-09 22:54 by Auriea
Havana
OutsideSomeplace [[image:HavanaShore-image]] Where we stayed: http://fr.bedycasa.com/bed-and-breakfast/la-havane-27030?ac=BE7Dlq87KWqHBOQl4CgNXZ6PuHJfuKy6 . . .
1K - last updated 2014-10-31 16:16 by Auriea
History
<center>[[thumb:2019-12-11|frame|600px]]</center> Auriea Harvey b.1971 USA (Indianapolis)/EU . . . 2019 The Coming World: Ecology as New Politics 2030-2100, Game Club, Garage Museum, Moscow * 2019 Cricoterie . . . W3 Professor, Kunsthochschule Kassel] (Game Design)'' . . . ''Teaching: IULM Milan, Games MFA (Experimental 3D)'' * 2017 ''Clay Modeling with Jason Arkles, Studio . . . School of Design, Paris (Drawing, Imaging, 3D)'' * '''2016 transition to [http://song-of-songs.org . . .
6K - last updated 2019-12-16 13:21 by Au-Elektra
HomebrewDS
[[Games]] MakingDSGames latest firmware - http://dshere.com/ http://www.handheldsources.com/M3DS/Download_M3DSS.html . . . ----- I ordered the M3 Simply[http://www.m3adapter.com/SLOT-1/main.htm] . . . from: http://www.divineo.cn/cgi-bin/div-cn/dsl-m3dsssimp.html ** it was chearper to get it from Hong . . . they have even better prices! ==playing with 3d== * 3d model viewer - http://boards.polycount.net/showthread.php?t=51691 . . . that looks like this: <code>const extern u32 Suzanne[]; </code> where "Suzanne" is the . . .
5K - last updated 2010-10-06 10:27 by Auriea
HomepageContestJudging
ToDo ==2005== this year Michael and I are giving the prize for Best Homepage made by a Couple. http://art.teleportacia.org/1000$/page2.html . . . * 10 cents, coin, Bahamas, 1973 * 500 yen, coin, Japan * 2 dollars, coin, Hong Kong, . . . 1993 * 1 guilder, coin, Netherlands, 1978 * 1 króna, . . . USA, 1976 * 50 Piastres, banknote, Egypt * 3, 100 franc banknotes, Belgium * 50,000,000 Marks, . . . Reichsbanknote, Germany 1923 ----- ==2004== for olia's 1000$ homepage contest: . . .
2K - last updated 2007-05-29 13:29 by Auriea
HonorineJobert
TuinPlanten [[Gog:Honorine Jobert]] http://www.mobot.org/gardeninghelp/plantfinder/Plant.asp?code=B340 . . . Anemone x hybrida 'Honorine Jobert' . . . Kemper Code: B340 Common Name: Japanese anemone Zone: 4 to 8 Plant . . . perennial Family: Ranunculaceae Height: 3 to 4 feet Spread: 1.5 to 2 feet Bloom Time: August . . . anemone hybrid cultivar which typically grows to 3-4' tall and spreads by creeping rhizomes. Single . . .
3K - last updated 2005-04-04 10:20 by Auriea
HowToGrowHerbs
TuinPlanten How to Grow Mint - http://www.patrickdepinguin.com/mint/howtogrow/ How to Grow Rosemary - . . . http://www.ehow.com/how_321_grow-rosemary.html . . .
1K - last updated 2005-06-11 18:34 by Auriea
Hucisko
[[Poland]] <center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" . . . src="https://sketchfab.com/models/04d4f3a310d742fc8a71498ffc8917ef/embed" frameborder="0" . . .
1K - last updated 2017-08-14 14:35 by Au-Mercury
Hypnosis
[[Research]] <tt>'''Hypnotist thief hunted in Italy'''[http://news.bbc.co.uk/2/hi/europe/7309947.stm] . . . <html><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/nUFYJ2Nppfg&hl=en&fs=1&color1=0x2b405b&color2=0x6b8ab6"></param><param . . . allowfullscreen="true" width="425" height="344"></embed></object></html> . . .
2K - last updated 2009-10-17 17:14 by Auriea
ICO
[[tube:SEMdx6fPkoA 640 480 0]] [[tube:F0b3sOJ6BeM 640 480 0]] . . .
1K - last updated 2007-12-18 19:48 by Auriea
IULM
[[Projects]] GAME LAB: Studio for Experimental Asset Creation Professor AURIEA HARVEY M.A. IN GAME DESIGN . . . into no software left untested methods, for 3D, VR, animation, sound, scanning, capture, input, . . . results to each other. Attendance is mandatory. 3 Tardies = Absence, 3 Absence = Fail. Though we will . . . 2. To work creatively, and enjoy the work. 3. To clarify ideas through Art. 4. To overcome technical . . . SOFTWARE: I will instruct with Blender 3d but students may use their 3d package of choice. . . .
4K - last updated 2017-09-22 13:55 by Au-Danae
Ikiru
[[tube:XjIZP5dMkl0 425 335 0]] . . .
1K - last updated 2007-07-21 12:26 by Auriea
ImmortalComputing
RandomIdeas ''see also: MemoriesWereMeantToFade, NothingEverDiesOnTheNet'' Microsoft is trying to patent . . . which would let people . . . http://seattlepi.nwsource.com/business/300636_msftimmortal22.html E-mail from the grave? Microsoft . . .
8K - last updated 2007-05-10 15:48 by Auriea
InSearchOfLostTime
FiftyBooks == ...in Proust the present is always absent. == # SwannsWay # -- # -- # -- # -- # -- # -- . . . http://www.goodreads.com/group/show/75460-2013-the-year-of-reading-proust Final Reading Schedule . . .
1K - last updated 2013-01-07 11:50 by Auriea
Indianapolis
OutsideSomeplace http://farm4.static.flickr.com/3518/3718279091_d2008057b9_b.jpg ==free wifi== * http://www.wififreespot.com/in.html . . . Abbey Coffeehouse - 825 N. Pennsylvania St. - (317) 269-8426 Ah Barista Cafe - 201 S. Capitol Ave . . . Suite 110 - 317-638-2233 Au Bon Pain - 901 Indiana Ave Bjava Coffee . . . and Tea - 5510 Lafayette Rd - 317 280 1236 Boulevard Place Caf� - Butler Tarkington . . . Boulevard Place Broadripple (eWireless.com) - 6304 Guilford Ave. - 316-536-0400 Buffalo Wild Wings . . .
4K - last updated 2020-04-06 17:14 by Auriea-Mercury
IndrasNet
[[Mythology]] http://www.heartspace.org/misc/IndraNet.html References to in Buddhism - http://www.cs.kent.ac.uk/people/staff/saf/networks/networking-networkers/indras-net.html . . . http://www.everything2.com/index.pl?node_id=1302991 Indra is the Vedic deity associated with rain . . .
5K - last updated 2007-06-02 19:59 by Auriea
InterMap
This is the intermap -- it lists all URL abbreviations for this site. Only the lines starting with exactly . . . . . .
2K - last updated 2015-08-07 17:35 by Auriea
InteractiveFiction
[[Games]] ==Notes:== * A Definition of Narrative: http://en.wikipedia.org/wiki/Narrative * ChrisCrawfordsDefinitionOfInteractivity . . . Chris @ http://erasmatazz.com) * [http://www.w3.org/Terms.html Hypertext Terms] * [http://ist-socrates.berkeley.edu/~arcadia/tesseract/lexicon.html . . . the structure http://grandtextauto.gatech.edu/2003/09/02/choose-one-of-four-deep-paths/ Computerized . . . * ''Voodoo Castle'': http://www.ifiction.org/games/play.php?cat=44&game=47&mode=html . . .
4K - last updated 2007-12-11 13:42 by Auriea
Istanbul
OutsideSomeplace <html><iframe width="100%" height="166" scrolling="no" frameborder="no" src="http://w.soundcloud.com/player/?url=http%3A%2F%2Fapi.soundcloud.com%2Ftracks%2F23627412&show_artwork=true"></iframe></html> . . .
1K - last updated 2012-06-07 15:49 by Auriea
JadePlant
TuinPlanten [[thumb:2005-06-04 JadePlant|frame|right|I bought this at the plant store around the corner. . . . a miniature clone of the parent plant in about 2-3 months. Stem cuttings should be set about 1-2 inches . . .
5K - last updated 2005-06-04 22:00 by Auriea
JaquesDerrida
CastOfThousands ==Derrida and Deconstruction== ''knip & plak from - http://130.179.92.25/Arnason_DE/Derrida.html'' . . .
17K - last updated 2005-10-23 20:39 by Auriea
Jitter
MaxMsp Jitter + Ogre = [http://www.cycling74.com/forums/index.php?t=msg&goto=168555&rid=0&S=8278e7f3ba1a06d814259eea9ff20297] . . . Ogre Blender exporter: http://www.ogre3d.org/forums/viewtopic.php?t=45922 . . .
1K - last updated 2009-06-26 14:36 by Auriea
JoyouKanji
[[日本語]] These are the 常用漢字 (Jouyou Kanji), which have been specified for use in schools . . . 歌 算 語 読 聞 線 親 頭 曜 顔 ==Grade 3== 丁 予 化 区 反 央 平 申 世 由 氷 主 . . .
10K - last updated 2005-06-22 11:37 by Auriea
JudasPenning
TuinPlanten [[Gog:Lunaria]] ooh, it turns into this! [[image:lunaria]] Family: Brassicaceae (brass-ih-KAY-see-ee) . . . biennis Category: Biennials Height: 24-36 in. (60-90 cm) Spacing: 15-18 in. (38-45 cm) Sun . . .
1K - last updated 2007-01-05 12:32 by Auriea
KasselDokFest-ArtistStatement
[[Example_No.22]] I was born in Indianapolis Indiana in 1971. After graduating high school, at age 18 . . . our Playstation. We wondered so much how these 3d games were made that we decided to find out. And . . . we did. In 2003 we turned our attention to videogames by founding . . . for. The transition into “Game Designer” and 3D Artist was significant for me. I believed that videogame . . . technology, Realtime 3D, would prove to be just as significant a medium . . .
13K - last updated 2018-11-15 02:51 by Auriea.
KikiSmith
CastOfThousands i loved her work, i hated her work. i am still envious of her work in a way. [[image:KikiSmith-photo]] . . . http://www.moma.org/exhibitions/2003/kikismith/ I am finding that the stuff i remember . . .
1K - last updated 2006-11-25 22:12 by Auriea
Kinect
DigitalSculpture in addition to the main microsoft SDK you can install: * [https://developer.leapmotion.com/get-started . . . Language packs] . . .
1K - last updated 2017-08-24 00:41 by Au-Danae
KrzesloKantora
<center>[[vimeo:229539717 160 120 0]][[vimeo:229539724 160 120 0]][[vimeo:229539728 160 120 0]][[vimeo:229539735 . . . 160 120 0]][[vimeo:229539738 160 120 0]][[vimeo:229539744 160 120 0]][[vimeo:229539751 . . . 160 120 0]][[vimeo:229539754 160 120 0]][[vimeo:229539763 160 120 0]][[vimeo:229539774 . . . 160 120 0]][[vimeo:229539783 160 120 0]][[vimeo:229539616 160 120 0]][[vimeo:229539621 . . . 160 120 0]][[vimeo:229539626 160 120 0]][[vimeo:229539633 160 120 0]][[vimeo:229539638 . . .
1K - last updated 2017-09-06 19:12 by Au-Mercury
KunstendecreetVisieMateriaal
||''P A S T''' || || <center>[[thumb:ToTGames|1020px]]</center> || ||My work with Tale of . . . exhibition in 2017|| ||[[thumb:Minorinth-studio|430px]][[thumb:Minorinth-simulation|600px]]|| ||More . . . #22 (2018)''|| ||A mini-solo exhibition of my 3d printed sculpture experiments|| ||[[thumb:Example_No.22_install01|160px]] . . . [[thumb:Example_No.22_install03|160px]] [[thumb:Example_No.22_install05|160px]] [[thumb:Example_No.22_install04|160px]] . . . ||'''3D - SCANNING-SCULPTING-PRINTING'''|| ||SCANNING|| . . .
5K - last updated 2019-02-26 00:56 by Auriea
LJCustomization
[[Reference]] Learning S2 http://www.livejournal.com/support/faqbrowse.bml?faqid=172 Tags http://www.livejournal.com/manage/tags.bml . . . S2 http://www.livejournal.com/community/lj_style/369738.html Journal (lastn) -> styleid=596008 Day . . . -> styleid=596315 Other People (friends) -> styleid=596256 Time . . .
1K - last updated 2005-10-04 13:47 by Auriea
LaVitaNova-3
image/png
516K - last updated 2021-02-23 12:32 by Auriea
La Vita Nova
[[thumb:LaVitaNova-1|700px]] [[thumb:LaVitaNova-2|700px]] [[thumb:LaVitaNova-3|700px]] [[thumb:LaVitaNova-4|700px]] . . .
1K - last updated 2021-02-23 12:42 by Auriea
Lain
[[Reference]] [[Anime]] [[image:LainComputes-img]] WikiPedia:Serial_Experiments_Lain good analysis: http://www.cjas.org/~leng/lain.htm . . . it alone, on Melody, in the hospital (see 33.) then, it was beautiful. the graphic style is quite . . .
1K - last updated 2010-04-08 15:51 by Auriea
LastFM
RssFeeds http://loczek.webd.pl/cover/?u=womanonfire&i=10&s=100 <html> <a href="http://www.last.fm/user/womanonfire/?chartstyle=basicrt10"><img . . . classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" width="184" height="284" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab%23version=7,0,0,0"><param . . . name="bgcolor" value="d01f3c" /><param name="movie" value="http://panther1.last.fm/widgets/playlist/2.swf" . . . value="lfmMode=playlist&resourceType=37&resourceID=104213&radioURL=user%2Fwomanonfire%2Fplaylist&username=womanonfire&title=womanonfire%E2%80%99s+Playlist&theme=red&autostart=" . . . name="widgetPlayer" bgcolor="d01f3c" width="184" height="284" quality="high" pluginspage="http://www.macromedia.com/go/getflashplayer" . . .
4K - last updated 2010-05-21 13:48 by Auriea
LastLifeInTheUniverse
[[Quoth]] http://film.indiefilipino.com/item.php?id=93 http://filmbrain.typepad.com/filmbrain/2004/05/found_in_transl.html . . . Last Life in the Universe (2003) (Thai and Japanese with English subs) ----- A mysterious, . . . Movie Name: Ruang rak noi nid mahasan (2003) Running Length: 1:47:41 Resolution: 704x400 Aspect . . . Ratio: 16:9 Frame Rate: 23.976 fps Video Bitrate: 908 kbps Video Codec: XviD . . . Audio: 48000hz, 16bps, 2ch MP3 VBR File Size: 716.7 MB Genre: Thriller / Drama Language: . . .
27K - last updated 2005-07-24 13:56 by Auriea
LeNombril
<html><iframe width="560" height="315" src="https://www.youtube.com/embed/Pw9ARZJf75U?ecver=1" . . .
1K - last updated 2017-07-31 23:50 by Au-Mercury
LearningToDrive
ProofOfMyExistence ==internationaal rijbewijs== * http://www.gent.be/eCache/THE/412.cmVjPTM3NzYw.html . . . avondles van maandag tot en met donderdag van 18u30 tot 21 uur." Geslaagd op [[2012-09-24]] [[thumb:2012-09-24_LearningToDrive_TheoretischExamenGeslaagd|400px]] . . .
1K - last updated 2014-09-16 15:45 by Auriea
LeonardoDaVinci
RssFeeds [[thumb:DaVinci-opus1]] [[thumb:DaVinci-opus2]] Draings of LDV - http://www.visi.com/%7Ereuteler/leonardo.html . . . . . .
1K - last updated 2008-05-06 10:33 by Auriea
LetsMakeAVideogame
[[tube:-LCHPrRZA3s 425 350 0]] . . .
1K - last updated 2014-05-30 12:35 by Auriea
Leviticus
[[Projects]] [[vimeo:231733 410 300 0]] Rearranging the letters of 'leviticus' gives: Visit clue. Is . . .
3K - last updated 2007-07-05 21:16 by Auriea
LifeDrawing
[[Drawing]] ''see also: drawing, anatomy, LeonardoDaVinci, CaproniCasts, SightSize'' ''also! also!: http://atelierauriea.tumblr.com/'' . . . summer only?)http://www.kunstwerkt.be/zoekertje/389/levend-model-tekenen-in-Gent * vzw Whisper http://www.wisper.be . . . is er vrij atelier. Deelname voor de leden € 3,- per dag ter dekking van de kosten. De koffie is . . . door de aanwezigen. . Vooraf aanmelden (0475.65.39.11) maakt het ons organisatorisch makkelijk. * in . . . [http://forums.cgsociety.org/showthread.php?p=3622448 anatomy thread] on CGTalk. (terribly outdated . . .
4K - last updated 2014-09-29 17:47 by Auriea
LinasSite
ToDo '''will be at http://cocooncharacters.com''' I am using [http://gallery.menalto.com/ Gallery] * . . . * http://codex.gallery2.org/index.php/Gallery2:UserContributions . . .
2K - last updated 2006-11-11 20:38 by Auriea
Ling
'''Nicci-Ling Levka Almere de la Perla de las Esmereldas van Gent''' b. [[04-15-2014]] to [http://www.katten-enzo.nl/2014-Delphine-Vladimir.htm . . . src="https://vine.co/v/Mx0OJWJBn3V/embed/simple" width="600" height="600" frameborder="0"></iframe><script . . .
2K - last updated 2014-11-13 15:33 by Auriea
Links
A traditional links page. More to this when I have time and inspiration. * http://stanleylieber.com * . . . things They will fear http://additivism.org. The 3D Additivist Cookbook is my favorite thing I've seen . . . which you can apply to any model to make your 3D renders -look- like they've been 3D printed. ¡*genius*! . . . ** http://graphics.stanford.edu/data/3Dscanrep/ * Medieval POC - People of Color in European . . .
2K - last updated 2018-04-06 17:40 by Au-Mercury
Linux
[[Reference]] ==Vanilla Ubuntu== ===Links=== * https://www.infofuge.com/how-to-install-ubuntu-18-04-on-microsoft-surface-book-2/ . . . things=== * https://askubuntu.com/questions/1143/how-can-i-uninstall-software If the application has . . .
4K - last updated 2020-01-07 20:15 by Au-Elektra
Lli93
image/jpeg
190K - last updated 2009-01-22 21:06 by Auriea
LliWilburn
CastOfThousands [[thumb:Lli93|500px]] http://www.pernoctalian.com/~lli/art/ http://pernoctalian-sketchbooks.net/ . . . LJ:lli <3 The one thing I loved most about her back in the . . .
1K - last updated 2009-01-22 21:28 by Auriea
LocalNames
These are LocalNames for external links. whenever your use them they will be automatically linked. <tt> . . . . . .
2K - last updated 2014-01-21 13:54 by Auriea
Lolita
FiftyBooks ''She was Lo, plain Lo, in the morning, standing four feet ten in one sock. She was Lola in . . . beautiful and dreamy fantasy and lets you dwell 317 pages in his exstasy. Even when Lolita is a washed . . .
5K - last updated 2005-08-13 10:11 by Auriea
London
OutsideSomeplace ''Next time:'' * John Soane museum - http://www.soane.org ------ [[2004-08-31]] - [[2004-09-04]] . . .
1K - last updated 2015-08-31 13:15 by Auriea
LouiseBourgeois
CastOfThousands [[image:Louise]] 25/12/1911- 31/05/2010 [[Img:Louise Bourgeois]] http://www.deutsche-bank-kunst.com/art/2004/9/e/1/293.php . . . present than in Cell (Choisy) (1990–93), in which a guillotine hangs ominously over a scale . . .
3K - last updated 2010-06-01 19:24 by 78-21-207-92.access.telenet.be
Louvre-BoulogneReview
[[Paris]] # After class that day, shared a great bottle of Langudoc with Della and Ed whom Ive not seen . . . des saintes Proces et Martineien'' 1629-1630 ## i love painting tht speaks it's story plain. . . .
2K - last updated 2017-03-02 19:18 by Au-Mercury
LudisiaDiscolor
TuinPlanten the plant given to me by Lina. needs to be put in a terrarium. * http://www.speciesorchids.com/ludisiaDiscolor.html . . . * Gog:Ludisia_Discolor . . .
1K - last updated 2009-02-10 12:01 by Auriea
MacBookPro
[[Empire]] ''see also: OsX, emulation'' [http://www.ifixit.com/Guide/Repair/MacBook-Pro-15-Inch-Core-2-Duo-Model-A1211-Hard-Drive-Replacement/459/1 . . . [[image:2006-11-30_Bonnie_and_Clyde]] [[image:2009-09-10_Antonius_and_Faustina]] . . .
1K - last updated 2010-06-24 15:17 by Auriea
Madagascar
OutsideSomeplace some links about the place we will most likely retire to ;) * http://en.wikipedia.org/wiki/Madagascar . . . * http://valamaty.blogspot.com/2006_03_01_archive.html . . .
1K - last updated 2007-09-04 10:44 by Auriea
MagicMiraclesAndTechnology
[[Cathedral-in-the-Clouds]] Much about technology these days is treated like medival monks treated christian . . . universes. and as i escape into a world where 3d is art i find thesame problems. People want 3d to . . . the things we want to believe because a 3d reconstruction told us so. [image of: Nefertiti . . . 3d scan…] The things we want to believe will last . . . of the true crosrrrrrrrrrr Machina a punto as 123dcatch Thinking that the games you make don't touch . . .
5K - last updated 2019-01-11 19:30 by Auriea.
MakeClothes
Blender3D http://workflows.grailmedia.com/makeclothes/ Step 1: Set up MakeClothes Open Blender Press . . . scale down that part Deselect that material Step 3: Create your clothing mesh Select the material for . . .
3K - last updated 2017-07-17 20:07 by Au-Roma
MakingDSGames
HomebrewDS http://forums.cgsociety.org/showthread.php?p=4727543 <source> Polycount per character . . . total polys in the view of camera, but generally 300-500 tris per character is ok. Total limit of tris . . . due to its size so, 64 or 128 texture plus 300-500 tris, 20-24 bones per character - just right. . . .
2K - last updated 2007-10-23 22:04 by Auriea
MamaDoris
CastOfThousands [[flash:http://auriea.com/live.swf?thePic=http://keystrokes.org/Webcam.jpg&|160|120|#000000|best|exactfit]] . . . MamaSkinner? (????-1980?) MamaDora? (november 13, 1923?-2002?) MamaDoris (march 8(9), 1939?-?) Michael . . .
1K - last updated 2010-05-21 13:37 by Auriea
MamasHouse
[[flash:http://auriea.org/media/flvplayer.swf?file=http://auriea.org/media/20060817-mamashallway.flv|240|320|#ff0000|high|noscale]] . . .
1K - last updated 2006-12-27 23:53 by Auriea
MamiyaC3
[[photography]] http://farm3.static.flickr.com/2134/2509929964_44896b16bc.jpg . . .
1K - last updated 2009-01-05 00:31 by Auriea
MargueriteDuras
CastOfThousands [[thumb:MD|left]] from:http://www.france.diplomatie.fr/label_france/ENGLISH/LETTRES/DURAS/duras.html . . . writer Marguerite Duras died in Paris, on March 3, 1996. Throughout her life and to her dying breath, . . . writings of Pierre Loti."{{Pierre Loti (1850-1923): Naval officer and impressionist novelist famous . . . published her first novel, The Impudents, in 1943, and the following year, La Vie Tranquille, which . . . and a post at the Ministry of Colonies. In 1939, a marriage to the poet Robert Antelme and, in 1942, . . .
11K - last updated 2010-04-15 09:56 by Auriea
MarinaAbramovicAndUlay
CastOfThousands '''Abramovic, Marina; Ulay''' '''The Lovers – The Great Wall Walk''' ''The earth is . . . Duration: 90 days. Last meeting on June 3, 1988. Abramovic, Marina; Ulay [[image:AbramovicAndUlay-1]] . . . <html> <object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/VzelB74BJfI&color1=0xb1b1b1&color2=0xcfcfcf&hl=en_US&feature=player_embedded&fs=1"></param><param . . . allowScriptAccess="always" width="425" height="344"></embed></object> </html> . . . <html> <object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/zOuzzzltSOA&color1=0xb1b1b1&color2=0xcfcfcf&hl=en_US&feature=player_embedded&fs=1"></param><param . . .
3K - last updated 2012-09-22 20:01 by Auriea
MarmosetToolbag
[https://marmoset.co/posts/the-toolbag-baking-texturing-and-rendering-handbook/?utm_source=Marmoset+Newsletter&utm_campaign=74be762255-Email_Newsletter_22_Steph_Handbook&utm_medium=email&utm_term=0_5665c2c57f-74be762255-318423917&ct=t(Email_Newsletter_22_Steph_Handbook)&mc_cid=74be762255&mc_eid=81735d17a5 . . .
1K - last updated 2022-06-13 13:49 by Auriea
Martha
CastOfThousands [[background external:http://farm4.static.flickr.com/3182/2910930013_cb3490c72b.jpg|repeat . . . #fe62c9]] http://farm4.static.flickr.com/3169/2837461044_214dd5e8aa_b.jpg http://farm4.static.flickr.com/3200/2836838413_11cb9c931f_b.jpg . . . http://farm4.static.flickr.com/3217/2760938362_e34b452333_b.jpg http://farm4.static.flickr.com/3092/2636567843_6ef05fd885_b.jpg . . . http://farm4.static.flickr.com/3211/2711744348_8afe7809be_b.jpg http://farm4.static.flickr.com/3235/2700984718_9ec18476e5_b.jpg . . .
1K - last updated 2010-04-15 09:53 by Auriea
MarvelsOfThingsCreatedAndMiraculousAspectsOfThingsExisting
[[mythology]] A large animal, possibly big as an elephant which roams the perimeter of the world. His . . . Aspects of Things Existing''') composed in the 13th cent. by Zakariya' ibn Muhammad al-Qazwini. Undated: . . .
4K - last updated 2006-07-09 23:14 by Auriea
MaryMagdalene
ThreeMarys [https://www.biblegateway.com/passage/?search=Luke%208:2 Luke 8:2], [https://www.biblegateway.com/passage/?search=Mark+16%3A9&version=NIV . . . Mark 15:40], [https://www.biblegateway.com/passage/?search=John+19%3A25&version=NIV . . . Mark 15:47] (at burial); [https://www.biblegateway.com/passage/?search=John+20%3A14-18&version=NKJV . . . Luke 24:10], [https://www.biblegateway.com/passage/?search=Luke+7%3A36-50&version=NKJV . . . Luke 7:36-50] (sinful woman washing and anointing Jesus’ . . .
6K - last updated 2017-03-28 18:58 by Au-Danae
MassExtinction
[[Reference]] Earth’s five previous mass extinctions End-Ordovician, 443 million years ago A severe . . . the oceans starved of oxygen. Late Devonian, c 360 million years ago A messy prolonged climate change . . .
2K - last updated 2017-07-11 02:06 by Au-Roma
MaxMspJitter
VisualProgramming realtime audiovisual programming. ''see also: MySong, DigitalSculpture, RealTime'' . . . src="https://player.vimeo.com/video/13149959" width="500" height="281" frameborder="0" webkitallowfullscreen . . . http://www.mat.ucsb.edu/~whsmith/xray.html . . . . . .
4K - last updated 2017-04-18 19:34 by Au-Mercury
MediaterraPresentation
[[Projects]] ===Introduction...=== # '''SLIDE''' Hello, Good evening, We are Auriea Harvey & Michael . . . been locked in a very enthusiastic embrace with 3d game technology for the past 4 years. We feel that . . .
2K - last updated 2006-10-22 14:12 by Auriea
MediumFormat
[[photography]] http://farm4.static.flickr.com/3220/2511129142_9f8bf66ac0_o.jpg http://farm3.static.flickr.com/2321/2539059861_0ace5a9b75.jpg . . . http://farm3.static.flickr.com/2134/2509929964_70090a1737_o.jpg . . . http://www.freestylephoto.biz/c403-Black-and-White-Film-120-and-220-size?sp=d . . .
1K - last updated 2010-07-05 17:49 by Auriea
MemoriesWereMeantToFade
RandomIdeas ''see also: abyss, ImmortalComputing, NothingEverDiesOnTheNet'' * http://www.vmsweb.net/attachments/pdf/Useful_Void.pdf . . . EU | News | PC Pro http://www.pcpro.co.uk/news/362527/people-have-right-to-be-forgotten-online-says-eu#ixzz14QaGssYY . . .
4K - last updated 2010-11-05 18:53 by Auriea
MeshLab
DigitalSculpture ''see also: Zbrush, [[3dPrinting]]'' http://meshlab.sourceforge.net/ . . .
1K - last updated 2010-06-21 00:04 by Auriea
Metropolis
<html><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/DukMPx6Fn_c&hl=en&fs=1&color1=0x2b405b&color2=0x6b8ab6"></param><param . . . allowfullscreen="true" width="425" height="344"></embed></object></html> . . .
1K - last updated 2009-06-11 11:38 by Auriea
MexicoCity
OutsideSomeplace ==2014== In Mexico City there are a number of activities that may be appealing to them. . . . <html> <object width="400" height="300"> <param name="flashvars" value="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157601264837454%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157601264837454%2F&set_id=72157601264837454&jump_to="></param> . . . . . . width="400" height="300"></embed></object></html> . . . Frida Kahlo in Coyoacán that runs to Sept. 30. ----- some links http://www.lonelyplanet.com/worldguide/destinations/north-america/mexico/mexico-city/essential . . .
2K - last updated 2014-09-29 11:55 by Auriea
Minorinth
[[Simulations]] <center>[[vimeo:302579640 640 360 0]] '''VR Labyrith exploration, for a 4x4 meter . . . [[thumb:Minorinth-scrn3|400px]] [[thumb:Minorinth-scrn4|400px]] [[thumb:Minorinth-scrn5|400px]] . . .
2K - last updated 2020-12-29 00:57 by Auriea
Minorinth-scrn3
image/jpeg
579K - last updated 2018-09-29 19:53 by Auriea
MoederKruid
TuinPlanten '''early spring 2006:''' It didn't fair too well end of last summer. it was swarmed by bugs . . . Self Portrait" finished on 2006-03-13. a tribute to the first year of my garden (2005) . . . red rings. They originate in Morocco and grow 2-3 feet in height. C. maximum (Shasta Daisy) is a perennial . . . the summer, bear large, white flowers on 2- to 3-foot stems. Large plants of this variety tend to . . . that bears clusters of pale rose-pink flowers on 3-foot stems. C. cinerariaefolium's inflorescences . . .
4K - last updated 2006-03-18 16:57 by Auriea
Mother
[[Games]] [http://mother3.fobby.net/ Mother 3 fan translation project] [http://www.gamefaqs.com/portable/gbadvance/file/914622/42740 . . . Spookychee's walkthrough] [http://mother3.fobby.net/menupatch/ Mother 3 menu patch] reviews . . . a review of mother 3 (insertcredit.com GAME OF THE YEAR, 2006)] . . .
1K - last updated 2007-10-04 13:16 by Auriea
MotionTracking
[[3d]] see also: ''[[Photogrammetry]]'' ==via Kinect== * https://cycling74.com/toolbox/kinect-via-synapse-max-interface/#.VnlHBTZ0OUF . . .
1K - last updated 2015-12-22 14:45 by Auriea
Movies
[[Movies]] <list "Movies"> ----- ''see also: [[Cinema2007]]'', http://www.theauteurs.com/users/81386 . . . A Glass Darkly - Bergman # JEANNE DIELMAN, 23 QUAI DU COMMERCE, 1080 BRUXELLES - Chantal Ackerman . . .
1K - last updated 2009-07-06 12:34 by Auriea
MovingToRome
https://www.belgium.be/nl/huisvesting/verhuizen/naar_het_buitenland https://www.immobiliare.it/agenzie-immobiliari/168346/zanni-roma/ . . .
1K - last updated 2019-05-18 17:15 by Auriea
Murakami interview1
[[Quoth]] from: http://www.salon.com/books/int/1997/12/cov_si_16int.html BY LAURA MILLER | The heroes . . . an image, not an idea actually. A man who is 30, cooking spaghetti in the kitchen, and the telephone . . . very well. I am 48, and they are in their 20s or 30s, but I have a Web page and we're corresponding . . . train in Tokyo in March 1995. I interviewed 63 victims who were on the train that day. I did it . . . people. It was a weekday, a Monday morning -- 8:30 or something like that. They were commuting to the . . .
20K - last updated 2005-08-09 17:17 by AurieaHarvey
MushroomSoup
[[Food]] 1 lb. fresh mushrooms 2 c. onions 1 1/2 tsp. sugar 3 tbsp. flour 1 c. cold water 1 can chicken . . . sugar until brown. Add mushrooms and saute for 3 minutes. Stir in flour until smooth. Add cold water . . .
1K - last updated 2006-12-20 15:40 by Auriea
MuziekLes
MySong i will take music lessons in the summer. i want to better understand the music i love so much. . . . Gent <html> <iframe width="425" height="350" frameborder="0" scrolling="no" marginheight="0" . . . . . . . . . Tel 09.225.04.79 Fax 09.233.54.03 muziekacademie.gent@pantarhei.be <source> . . .
2K - last updated 2007-10-07 20:47 by Auriea
MySong
[[Projects]] ==instruments== * MU Midi Controller Wacom instrument - http://www.musicunfolding.com/MU_MIDI_Controller.html . . . Everybody does . . . [http://pitchforkmedia.com/article/feature/39700-interview-joanna-newsom] * Anni Rossi [http://www.myspace.com/annirossi] . . . http://docs.info.apple.com/article.html?artnum=304765 * tips http://www.apple.com/support/garageband/hottips/ . . . * pro mirco * upgrate for maxmsp/jitter * mp3 recorder * time . . .
5K - last updated 2018-09-10 17:47 by Auriea.
MyTopOneHundredSongsOfAllTime
SongBook upon a dare from LJ:hiphopdiary http://hiphopdiary.livejournal.com/488494.html?nc=5&style=mine . . . Dead Can Dance # Homogenic / Bjork # Silent Hill 3 OST / Akira Yamaoka # Histoire De Melody Nelson / . . .
5K - last updated 2006-12-15 12:13 by Auriea
NET.ARCHEOLOGY
I was online from the “beginning” and first made a reputation as a web designer/net artist in 1996. . . . and the acceptance speech . . . It was a web browser, a parser, which creates . . . p.s. kiss.entropy8zuper.com https://vimeo.com/365031 https://www.flickr.com/photos/entropy8/albums/72157594500928662 . . .
4K - last updated 2021-01-25 13:00 by Auriea
NURBS
DigitalSculpture http://www.pilot3d.com/NurbSecrets.htm . . .
1K - last updated 2009-01-27 15:22 by Auriea
NegusPoem1and2
SongBook NEGUS POEM 1&2 sleep in my eye but still I gotta rise we wind thru cycles of time yet we . . . real negus never die [[tube:awZQryp7v_I 560 315 0]] -KeiyaA . . .
1K - last updated 2020-09-03 10:33 by Auriea-Nero
NetHack
[[Games]] Mac OsX TerminalToy http://nethack.org learn to play. mac binaries http://www.nethack.org/v343/ports/download-mac.html . . .
1K - last updated 2006-12-03 21:14 by Auriea
NetochkaNezvanova
CastOfThousands http://www.0f0003.com/data/pikz/isea09/nn%20isea09.txt whew = [http://lists.puredata.info/pipermail/pd-ot/2001-01/thread.html] . . .
1K - last updated 2010-07-12 10:34 by Auriea
NewYearsResolutions
ProofOfMyExistence i want to believe that these can be constructive.... lets try. the wording is probably . . . line ** paint brown people * Italy * discover MY 3d art ==2015== * to get up earlier in the morning . . . (9:00am at the latest, be in the studio by 9:30am) * to stop doodling and make finished drawings. . . . * start and finish things (in general) ==2013== <aggregate "2013-01-01_resolutions"> ==2008== . . .
6K - last updated 2018-01-01 15:56 by Au-Mercury
NiceanCreed
[[Mythology]] THE CREED OF NICAEA - AGREED AT THE COUNCIL IN 325 Πιστεύομεν εἰς ἕνα . . .
4K - last updated 2018-12-28 12:58 by Au-Mercury
Nihonga
Outline of "Nihonga"-Traditional Japanese Painting Nihonga is one of the painting styles of Japapn. Fumiyo . . . painting into the medieval period (1105-1573). Yamoto-e was a major influence on subsequent painting . . . In Japan, ceramic suzuri was seen in Kofun-era (3rdC-7th C) and stone suzuri started to be seen in . . . by its size, No. 1 being the largest. No. 13 is the second smallest. The smallest size is called . . .
17K - last updated 2010-01-29 18:16 by Auriea
NinaSimone
CastOfThousands [[tube:GUcXI2BIUOQ 320 240 0]] [[tube:CJA69C6SlRk 320 240 0]] . . .
1K - last updated 2008-02-13 02:59 by Auriea
NoQuarter
''for screenshots see: [[Minorinth]]'' ==Working Title: MINORINTH/LABYTAUR== <center>[[thumb:Minorith-lookfeel|600px]] . . . [[thumb:Labyrinth-town|340px]][[thumb:Labyrinth-PisaBaptistry|380px]] A site-specific . . . Game Center's 8th annual No Quarter event], Nov. 3rd, 2017. </center> ===Principles=== You are . . . # design Minotaur [[thumb:MinoRinth-MinoJanus|300px]] [[thumb:MinoRinth-MinoRiea-Sculpt|300px]] ## . . . ===Conceptual=== * [[vimeo:130888009 560 315 0]] * [[tube:O0VIxubUu4c 560 315 0]] . . .
6K - last updated 2018-09-29 23:01 by Auriea.
NothingEverDiesOnTheNet
RandomIdeas ''see also: ImmortalComputing, MemoriesWereMeantToFade'' i used to believe this. not sure . . . WeAreNotIndividuals 1973 sociological paper by Mark Granovetter . . .
1K - last updated 2007-08-26 20:05 by Auriea
ObjectSeries
[[Sculpture]] * [[Object 01]] - head * [[Object 02]] - Magdalene * [[Object 03]] - the cup * [[Object . . .
1K - last updated 2018-09-13 15:43 by Au-Mercury
Object 01
ObjectSeries <center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" . . . height="320" src="https://sketchfab.com/models/c02f3c37cf0e42b8a59ce99686731943/embed?autostart=1&camera=0&transparent=1&ui_related=0" . . . <center>cm:3.07 x / 5.316 y / 3.696 z in:1.209 x / 2.093 y / 1.455 . . . width="560" height="315" src="https://www.youtube.com/embed/4VRe_OXnLGs?rel=0" . . .
1K - last updated 2017-02-27 14:08 by Auriea
Object 02
ObjectSeries <center><html><nobr><div class="sketchfab-embed-wrapper"><iframe . . . width="300" height="600" src="https://sketchfab.com/models/3d471d09451d46188b617228bdc0f47b/embed?autostart=1&camera=0&transparent=1&ui_related=0" . . . width="300" height="600" src="https://sketchfab.com/models/1a43c5fc8b0e4c39bace1891570f5684/embed?autostart=1&camera=0&transparent=1&ui_related=0" . . . ORDER 3D PRINTS of THESE OBJECTS]''' ''[https://www.patreon.com/posts/object-02-8598651 . . . style=" background:#FFF; border:0; border-radius:3px; box-shadow:0 0 1px 0 rgba(0,0,0,0.5),0 1px 10px . . .
6K - last updated 2017-03-28 19:42 by Au-Danae
Object 03
ObjectSeries # based on Palissy pottery # based on my biggest fear . . .
1K - last updated 2017-03-03 15:46 by Au-Mercury
Ocean
[[Quoth]] ''see also: sea'' [[image:VijaCelmins_ocean]] ''Call me Ishmael. Some years ago -- never mind . . . src="http://player.vimeo.com/video/15341669" width="400" height="225" frameborder="0"></iframe></html> . . .
2K - last updated 2010-11-26 13:27 by Auriea
OdeToSpot
[[Quoth]] [[tube:Jer7RhpD9DM 320 240 0]] '''Ode to Spot" by Lieutenant Commander Data''' Felis catus . . .
1K - last updated 2008-09-12 23:05 by Auriea
OilPainting
==INVOCATION== [[thumb:2014-09-24|frame|300px|sketching Rubens in Brussel.]] ==canvas== * http://www.claessenscanvas.com/en . . .
1K - last updated 2014-09-25 17:08 by Auriea
OnlineClasses
==Current== # New Masters Academy - [http://www.newmastersacademy.org/anatomy-instruction/ Anatomy & . . . # Udemy - [https://www.udemy.com/generate-a-3d-model-from-photos-using-agisoft-photoscan/learn/v4/content . . .
1K - last updated 2016-08-18 13:40 by Auriea
OntwikkelingsgerichteBeurs
ProofOfMyExistence [[thumb:2013-01-18|frame|150px|right|no comment.]] ''see also: ArtSchool'' . . .
1K - last updated 2018-09-10 13:04 by Auriea.
OsX
[[Reference]] ==Samba performance under Mac OS X== <source> I have a NetBSD/i386 3.0 file server . . . at home running Samba 3.x. Read and write access from NetBSD and Windows . . . (windows keyboard: ALT-C / apple Command-C) 3. Select the USB stick/drive and get the info of it. . . . download and install the Windows Server 2003 Resource Kit Tools from the [http://www.microsoft.com/downloads/ . . . * http://the.taoofmac.com/space/blog/2003-11-29 The Tao of Mac - blog/2003-11-29 * http://www.westwind.com/reference/OS-X/commandline/single-user.html . . .
13K - last updated 2008-10-31 17:04 by Auriea
Ouendan
[[Games]] I love playing games on my DS. Its the perfect way to play for me. I don't have much time to . . . I must have tried to make it through that one 30-40 times and never got past the second cut scene. . . .
6K - last updated 2007-06-08 22:57 by Auriea
Ovid-CadmusHarmonia
[[Quoth]] '''[[Ovid]] Metamorphoses Book IV:563-603 Cadmus and Harmonia become serpents''' The son of . . .
3K - last updated 2015-10-07 10:30 by Auriea
Painter
[[Reference]] to get Painter 6 to run on modern system: http://dev.depeuter.org/metacreations_fix_30.php . . . only the masked part will show. === Getting the 3d data out of Impasto=== * to import into blender . . . <3 http://blenderartists.org/forum/showthread.php?376974 . . . this add-on specifically to extract the impasto (3D) depth layer information found in RIFF files, but . . . RIFF files. Corel Painter can store up to 65536 levels of impasto depth information per layer in . . .
7K - last updated 2015-10-17 15:12 by Auriea
PaintingWithMaterials
DigitalSculpture [[image:VanGoghPaintImpasto]] [[thumb:LamiaSculpture|frame|right|200px]] an solution . . . Luxology Modo] * [http://mudbox3d.com Mudbox] * [http://zbrush.com Zbrush] * http://www.optipaint.com/ . . .
1K - last updated 2012-07-03 17:58 by Auriea
Panorama
exiftool -FullPanoWidthPixels=6000 -FullPanoHeightPixels=3000 -CroppedAreaLeftPixels=0 -CroppedAreaTopPixels=783 . . . -CroppedAreaImageHeightPixels=1433 -ProjectionType=cylindrical -Make="samsung" -Model="SM-G930F" . . .
1K - last updated 2016-08-17 18:05 by Auriea
Paris
OutsideSomeplace ==Next time== * http://www.bourdelle.paris.fr/en * another trip to musee moreau (recently . . . Stayed there the entire month of December 2013. Attending StudioEscalier for drawing workshop and . . . 19 October 2010 - 23 January 2011 Musée de l'Orangerie has panoramic . . . Amour (8, rue Navarin; Ninth Arrondisement; 33-1-4878-3180.) Each room is uniquely decorated on . . . literal embodiment at Hôtel du Petit Moulin (29-31 rue du Poitou; Third; 33-1-4274-1010; www.hoteldupetitmoulin.com), . . .
6K - last updated 2015-02-02 16:56 by Auriea
Passport
ProofOfMyExistence Dear Ms. Harvey: To issue a certificate of Nationality, we would have to see your . . . the certificate. Our opening hours are Mon-Thu 1.30-3.30 and Fri 9-11. The fee for the document will . . . be $30 or the equivalent in euros, to be paid cash or with . . . ---- i sent away for the new passport by mail . . . How to Apply by Mail Step-by-Step: * Read and . . .
5K - last updated 2008-09-08 11:47 by Auriea
PataBotany
[[Botany]] ''see also: PataX'' http://libarynth.org/patabotany ==== Patabotanical Morphology ==== For . . . etc. Miscellaneous: * dysteleology (Haeckel; 1834-1919) = study of purposelessness in nature (leer . . .
2K - last updated 2008-10-18 20:26 by Auriea
PataX
[[Research]] http://en.wikipedia.org/wiki/Alfred_Jarry Shoplifted from LibFoam:PataX LibFoam:pataphysics . . . to their presence. --''Marcel Duchamp, 1930, France.'' ; '''Patagraphics''': is the solution . . . to their lineaments. --''Arthur Rimbaud, 1932, France.'' ; '''Patalogic''': was the study upon . . . I actually prefer . . . . . .
7K - last updated 2008-10-31 00:04 by Auriea
PeaceInTheValley
[[Quoth]] When they closed the last shopping mall crickets sang in crumbling walls. Termites ate through . . . - Handsome Family''{{a gift from LJ:lli/297423.html}} . . .
1K - last updated 2007-01-10 11:54 by Auriea
PeachPlumPear
SongBook We speak in the store I'm a sensitive bore and you're markedly more and I'm oozing surprise . . . plum, pear. <html> <object width="13" height="13" classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" . . . name="FlashVars" value="resourceID=3428676&flp=false" /> <param name="movie" . . . quality="high" FlashVars="resourceID=3428676&flp=false" bgcolor="#ffffff" width="13" . . . height="13" name="inlinePlayer" allowNetworking="internal" allowScriptAccess="sameDomain" . . .
2K - last updated 2007-10-29 00:33 by Auriea
PeopleDie
CastOfThousands <tt> MamaSkinner.....18??-1980 MamaDora.....19??-2003? Uncle Ross.....?? Aunt Jo.....?? . . .
1K - last updated 2007-01-10 12:54 by Auriea
PerfumeTheStoryOfAMurderer
[[tube:cjxe3hVkNrU 425 335 0]] [[tube:Xcx1UU9fSrI 425 335 0]] . . .
1K - last updated 2007-07-21 12:27 by Auriea
Photogrammetry
[[3D]] ''see also: PhotogrammetryFromVideo'' <html> <iframe width="640" height="480" src="https://sketchfab.com/models/0aaf3716c92b4ffeba39ac82319b7d55/embed" . . . <p style="font-size: 13px; font-weight: normal; margin: 5px; color: #4A4A4A;"> . . . <a href="https://sketchfab.com/models/0aaf3716c92b4ffeba39ac82319b7d55?utm_source=oembed&utm_medium=embed&utm_campaign=0aaf3716c92b4ffeba39ac82319b7d55" . . . target="_blank" style="font-weight: . . . target="_blank" style="font-weight: . . .
2K - last updated 2017-05-30 19:08 by Au-Mercury
Photoshop
[[Reference]] ***44 Photoshop Tricks & Tips By - Xing Wei 1. Press Tab will hide tool bar and palette, . . . and pallette will move them to the nearest edge. 3. Double click the top blue bar for any pallette window . . . accuracy. 8. Press F button will switch between 3 different screen mode give you more working area. . . . into "Hand Tool" until you release Space bar. 13. While in Zoom Tool, Ctrl+space = zoom in, alt+space . . . of the original and merge all visible layers. 23. While using Marquee Tools, hold Alt will make the . . .
6K - last updated 2007-12-20 14:06 by Auriea
PlayForm
links to dreams: # [http://preview.playform.io/create/result/NDA0K2FyY2hhaWMgc2VycGVudGluYXRh Archaic . . . Crouching Venus] # [http://preview.playform.io/create/result/NDI0K3BhbGlzc3kgb2YgdGhlIGFlZ2Vhbg== . . . # [http://preview.playform.io/create/result/NTE4K3doZW4gaSBzYXkgcGVvcGxlIHRoYXRzIHdobyBpIG1lYW4= when . . . [http://preview.playform.io/create/result/NTI1K3doZW4gaSBzYXkgcGVvcGxlIHRoYXRzIHdoYXQgaSBtZWFu When . . . # [http://preview.playform.io/create/result/NTI2K3NjaG9sYXJzIG5hZ2Vs scholars nagel] # [http://preview.playform.io/create/result/NTMxK05hZ2VscyBSb2Nr . . .
2K - last updated 2019-08-13 10:32 by Auriea
PopularCulture
[[Quoth]] ''Excerpts{{lifted from http://pubpages.unh.edu/~dml3/880williams.htm}} from Raymond Williams{{linked . . . Ed. (NewYork: Oxford UP, 1983), pp. 87-93 and 236-8.}} == CULTURE == Culture is . . . in English culture as 'worship in Caxton (1483)). The French forms of cultura were couture, OF, . . . used for this. But there is a letter of 1730 (Bishop of Killala, to Mrs Clayton; cit. Plumb, . . . -- 'General Cultural History of Mankind (1843-52)-- which traced human development from savagery . . .
20K - last updated 2005-01-09 15:48 by Auriea
PorgyAndBess
OldManSorrow from http://www.neh.gov/news/humanities/1997-11/porgy.html ===The Complicated Life of Porgy . . . It opened on Broadway in 1927 and ran for 367 performances. A New York Times critic termed it . . . lines as well as the understudies did. In 1930 Gershwin received a commission from the Metropolitan . . . potential of Porgy, to announce in October of 1933 the composition of a folk opera based on the Heyward . . . stage version of Porgy into a libretto in late 1933 and early 1934, sending the typescript to Gershwin . . .
28K - last updated 2004-08-16 21:10 by wof
PotatoPancakes
[[Food]] 4 big potatoes 1 yellow onion 1 egg -- beaten 1 teaspoon salt 2 tablespoons all-purpose flour . . . 6 medium size (about 2 pounds) potatoes, about 3 cups grated. Heat in a heavy skillet over low heat, . . .
2K - last updated 2005-11-06 13:41 by Auriea
Prado
[[Madrid]] <html><img src=http://www.auriea.org/data/static/2010-02-19.jpg> Velazquez <3 . . . strokes being alive! The canvas is stitched in 3 parts "<a href=http://images.google.com/images?hl=en&tbs=&sa=1&q=La+venerable+madre+de+la+Fuente&aq=f&aqi=&aql=&oq=&start=0>La . . . DEI</a> Robert Campion "<a . . . . . . . . .
3K - last updated 2010-02-24 16:30 by Auriea
Prague
OutsideSomeplace little trip we decided to take summer, july 2010 with the kids. <html> <iframe . . . src="http://w.soundcloud.com/player/?url=http%3A%2F%2Fapi.soundcloud.com%2Ftracks%2F4197975&show_artwork=true"></iframe> . . .
1K - last updated 2012-06-07 15:49 by Auriea
PreComputationalGenerativeSystemsInArt
ElegantMedia * Underweysung der Messung, mit dem Zirckel und Richtscheyt, in Linien, Ebenen unnd gantzen . . . http://www.flickr.com/photos/85009674@N00/3037607129/ * And the Aolian harp, beloved of all Romantic . . . a small person disqualify? * Is 3-point perspective generative? Lots of rules... * . . .
3K - last updated 2009-10-13 10:53 by Auriea
PrintersSpreads
[[Books]] [20|01], [02|19], [18|03], [04|17], [16|05], [06,15], [14|07], [08|13], [12|09] and [10|11] . . .
1K - last updated 2009-06-25 09:18 by Auriea
ProjectProject
<center> [[thumb:2019-12-13|600px]] '''OPENING Friday the 13th December 2019''' '''DEATH HAS A . . . https://www.mtrldsgn.com/services * https://www.3dsystems.com/3d-printers/projet-cjp-660pro/specifications . . . (I like the [https://www.matterhackers.com/store/3d-printer-filament/ultimaker-silver-metallic-pla-filament-3.00mm . . . . . . . . .
3K - last updated 2019-12-30 19:28 by Au-Elektra
ProjectProject Cyclops
<html> <model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/Cyclops_standing/gltf/cyclops_standing.glb" . . . src="http://auriea.org/models/AR.png" width=30 height=30></button></model-viewer> . . .
2K - last updated 2020-02-26 00:28 by Au-Elektra
ProjectProject Leviathan
<html><model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/Leviathan/gltf/Leviathan.glb" . . . src="http://auriea.org/models/AR.png" width=30 height=30></button></model-viewer> . . .
2K - last updated 2020-02-26 00:30 by Au-Elektra
ProjectProject Polyphemau
<html><model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/Cyclops_head/gltf/Cyclops_head.glb" . . . src="http://auriea.org/models/AR.png" width=30 height=30></button></model-viewer> . . .
2K - last updated 2020-02-26 00:27 by Au-Elektra
ProjectProject TheMystery
<html><model-viewer poster="http://auriea.org/models/loading.png" src="http://auriea.org/models/TheMystery/gltf/TheMystery2.glb" . . . src="http://auriea.org/models/AR.png" width=30 height=30></button> </model-viewer> . . .
2K - last updated 2020-02-26 00:31 by Au-Elektra
ProjectionMapping
[[Research]] * http://projection-mapping.org ** Illustrated History of Projection Mapping http://projection-mapping.org/the-history-of-projection-mapping/ . . . * Lightform 3d+projection device - https://lightform.com/?kid=EQ9D9 . . .
1K - last updated 2017-03-30 14:08 by Au-Mercury
Projects
==Currently== [[In_the_Kingdom_No.19]] ------ == Queue == * Cyclops * StillLives ** Bugs ** The Cat * . . . * DeathDancesCloser ** LeNombril * [[Cricot3]] ** TheTwins * TheEndlessForest ------ ==Previously== . . . (5:49) # Nothingness (2:28) # Thanksgiving (3:57) # Ghettos Of The Mind (:35) # The RIGHT To Be . . . Wrong (4:18) # Blessed Marie (3:56) # Justice Isn't Blind (2:37) # Social Narcotics . . .
1K - last updated 2019-12-12 14:08 by Au-Elektra
ProsperosBooks
[[Movies]] The Books 1. A Book of Water This is a waterproof-covered book which has lost its colour by . . . whose purpose Prospero has yet to define. 3. A Book of Mythologies This is a large book. Prospero . . . all the architectural ideas of the Renaissance. 13. The Ninety-Two Conceits of the Minotaur This book . . . the possibilities for dance in the human body. 23. The Book of Games This is a book of board games . . . merely occupying two pages, pages 112 and 113. The book contains board games to be played with . . .
16K - last updated 2009-05-22 16:51 by Auriea
PrusaMk3
[[3DPrinting]] https://www.prusaprinters.org/ A DIY 3d printer of good quality and low price. It has . . . given me more trouble than the [[Ultimaker3]] but I'm happy it's made me learn more about how . . . 3d printers work. I've had to take apart the extruder . . . rebuild it twice! Manuals: https://manual.prusa3d.com/c/English_manuals . . .
1K - last updated 2018-09-16 00:14 by Auriea.
PureData
[[Reference]] * http://puredata.org/ * http://pure-data.sourceforge.net/ * http://crca.ucsd.edu/~msp/Pd_documentation/x2.htm#s1 . . . 3. install the present package . . . video processing objects for PDP : version 0.12.13 ( ydegoyon@free.fr ) IMPORTANT : use pdp_ieee1394 . . .
2K - last updated 2006-11-07 19:47 by Auriea
Quest3D
[[Reference]] <source> Step 3 So now we have 1 object with 2 different UV sets and textures, to . . . get them into Quest 3D we have to import the object 2 times, one time for . . . it. [edit] Step 4 Now we have 2 objects in Quest 3D 1 with the diffuse map and 1 with the lightmap. . . . Collision objects are 1 meter underground and 3 meters tall. '''In the case of the Ruin:''' * click . . . ''Channeltools > Collapse Object'' * Take the 3d Object Data channel from the new Channel Group that . . .
8K - last updated 2008-08-28 20:25 by d54C6FBEA.access.telenet.be
Quest3DInstructions
image/jpeg
85K - last updated 2005-06-29 23:12 by Auriea
Quest3DMultiTextureInstructions
image/jpeg
93K - last updated 2005-07-26 21:55 by Auriea
Quest3DNaturePainterInstructions
image/jpeg
103K - last updated 2005-07-26 20:46 by Auriea
Quiche
[[Food]] ==Quiche van broccoli en Cheddar== 4 personen * 1 bladerdeegroll * 1 broccoli * 100g Cheddar . . . geraspt * 3 eiren * 2 dl room * zwarte peper * 1 tl muskaatnoot . . . * 3 el verse peterselie '''Bereiding:''' Maak de broccoliroosjes . . . Giet het eirmengsel erover. Bak de quiche 30 min in een voorverwarmde oven op 200C. Gaarneer . . .
1K - last updated 2006-09-12 20:00 by Auriea
RandomFunction
RandomIdeas <html> <SCRIPT language="JavaScript"> <!-- function get_random() { var ranNum= . . . is not very likely"; quote[2]="hmmm..."; quote[3]="YES!"; quote[4]="Absolutely NOT!"; alert(quote[whichQuote]); . . . ------ // The Central Randomizer 1.3 (C) 1997 by Paul Houle (houle@msc.cornell.edu) rnd.today=new . . . function rnd() { rnd.seed = (rnd.seed*9301+49297) % 233280; return rnd.seed/(233280.0); }; . . .
2K - last updated 2005-12-26 13:32 by Auriea
RaphaelHasan
==April 6, 2014 - Raphael's Birthday and A Day for Hasan== [[thumb:RaphaelPortrait|frame|right|250px|The . . . before he died, far too young, at the age of 37. Younger than me. I didn't know how old he was. . . . wonderful blog on Renaissance Art [http://www.3pipe.org|http://www.3pipe.net]. And on twitter. <center>[[thumb:HasanWisdom|frame|250px|We . . . master.]] [[thumb:RaphaelSighting|frame|right|350px|I always tweeted him with joy at every Raphael . . . of Renaissance Color" in videogames. [http://www.3pipe.net/2011/11/modes-of-renaissance-colour.html] . . .
14K - last updated 2014-05-20 10:24 by Auriea
Ratatouille
[[Food]] http://www.guardian.co.uk/lifeandstyle/wordofmouth/2010/jul/15/how-to-make-perfect-ratatouille . . . seeded and cut into small dice, plus juices 3 sprigs of thyme, plus 1tsp thyme leaves Pinch of . . . saffron 1 tsp balsamic vinegar (optional) 3 courgettes (a mix of yellow and green is good if . . . 1 clove garlic, minced 1. Heat the oven to 230C, cut the peppers in half, removing the seeds and . . . soft, but not browned (about 8 minutes), adding 3 cloves of minced garlic 5 minutes in. Stir in the . . .
3K - last updated 2010-07-15 13:08 by Auriea
Ravi
CastOfThousands http://farm3.static.flickr.com/2612/3721997929_7539da2fed_b.jpg . . .
1K - last updated 2010-04-14 23:41 by Auriea
RealTime
ElegantMedia some definitions # real-time - Describes an application which requires a program to respond . . . a given time. ---- Michael and I use RealTime 3d alot. we are having a love affair with it. since . . . i have begun using 3D I find it pointless to present the work in any way . . . ''see also: VisualProgramming'' * [[Quest3D]] * MaxMsp * Lily - http://www.lilyapp.org/ * QuartzComposer . . .
2K - last updated 2012-09-27 11:16 by Auriea
RealtimeArtManifesto
ElegantMedia [[download:RAM.pdf]] ==Abstract== # '''Realtime 3D is a medium for artistic expression.''' . . . the only option accessible to artists. Realtime 3D is the most remarkable new creative technology since . . . even. ==Outline== ; Premise : That real-time 3d interactives can be an art form unto themselves. . . . * develop a unique language for the real-time 3D medium and not fall in !MacLuhan's trap (which predestines . . .
14K - last updated 2006-09-15 12:17 by Auriea
RebeccaHorn
CastOfThousands [[image:infestation]] Img:Rebecca+Horn http://www.guardian.co.uk/artanddesign/2005/may/23/art . . .
9K - last updated 2009-11-18 02:45 by Auriea
RecycledPaper
[[Studio]] http://www.funsci.com/fun3_en/paper/paper.htm http://www.twinrocker.com/sbkstch2.htm Papermaking . . .
1K - last updated 2008-05-28 19:13 by Auriea
Render
[[Reference]] [[3D]], Blender ==Cycles== ==Renderman== * https://rmanwiki.pixar.com/display/REN/RenderMan+Documentation . . . ==360== * doc made for DIMENSIONS class : [[download:[[Dimensions360Render]]]] . . .
1K - last updated 2017-02-28 15:42 by Auriea
Rijksmuseum
[[Writing]] We went to Amsterdam to celebrate our 13th wedding anniversary. I took time to go to the . . .
1K - last updated 2020-12-29 00:00 by Auriea
Robots
[[Research]] climbing robot - http://www.newscientist.com/blog/technology/2006/03/tree-climbing-robot.html . . .
1K - last updated 2006-06-24 23:31 by Auriea
Rockefeller2007
[[Projects]] these are notes. theres work to be done. mhm. ==Proposed Project== ===Title (required)=== . . . Direction, Conceptual Design, Creation of all 3D assets, Visual effects programming ===Production . . . Format=== Interactive Software, Realtime 3D ===Proposed Running Time=== non-linear ===Brief . . . Femmes Fatales'' is a series of realtime 3d compositions borrowing from the traditions of painting . . . words)=== ====Research Project==== Creating a 3d world is a lot of work. I have been creating worlds . . .
6K - last updated 2007-11-19 18:17 by Auriea
Rodin
CastOfThousands [[image:Rodin-3Adams]] [[image:Rodin-Art1]] [[image:Rodin-Art2]] [[image:RodinAtWork]] . . . [[image:Book32_Page20-21]] . . .
1K - last updated 2010-09-14 00:37 by Auriea
Rodin-3Adams
image/jpeg
44K - last updated 2007-08-31 19:46 by Auriea
RomanEmpire
[[Research]] # Julius Caesar (dictator) 49-44 BC # Augustus 31 BC - AD 14 # Tiberius AD 14-37 # Gaius . . . (Caligula) 37-41 # Claudius 41-54 # Nero 54-68 # Galba 68-69 # . . . # Nerva 96-98 # Trajan 98-117 # Hadrian 117-138 . . .
1K - last updated 2009-11-19 11:16 by Auriea
Rome
OutsideSomeplace Living here. ArtSuppliesRoma -------- [[Italy]] ''[[Rome2017]]'' Extended Stay at Academia . . . the kids and stayed in piazza novona area in 2013 or 2014, not sure there was also Plan V? did we stop . . . ----- ''see also: [[Book31]]'' Roma - Michaels . . .
5K - last updated 2021-06-05 11:45 by 93-39-148-146.ip76.fastwebnet.it
Rome2017
OutsideSomeplace [[Roma]] That time we went to Rome and stayed for 5 months. September 2017 - January . . . nature of art creation -- model in clay, 3d scan, model in computer, 3d print, finish or remodel-rescan, . . . . . . - Rebecca Molholt {{The Art Bulletin, Vol. 93, No. 3 (September 2011), pp. 287-303}} * "The Italians" . . . Clemente] Via Labicana, 95 Open Mon-Sat, 9am-12.30pm; 3pm-6pm; Sun 12.15pm-6pm Entry fee: €10 * Domitilla . . .
3K - last updated 2018-03-29 10:07 by 78-22-179-76.access.telenet.be
Rosas
CastOfThousands Belgian dance group lead by Anne Therese DeKeersmaker. Gorik designed their logo. I believe . . . speaking in the twelve voices] see: [[2004-11-03]] [http://www.rosas.be/Rosas/frames_prod_sh.html . . .
1K - last updated 2005-08-09 17:17 by AurieaHarvey
Ruins
[[Projects]] Photogrammetry created from Youtube HD drone video of the ruins of Homs, Syria https://www.youtube.com/watch?v=DoRdCbDd50o&t=31s . . . . . . src="https://sketchfab.com/models/9bf395f77a4347fdbd5566a65ccfebbe/embed" frameborder="0" . . . frameborder="0" allowvr allowfullscreen . . . src="https://sketchfab.com/models/9bf395f77a4347fdbd5566a65ccfebbe/embed" frameborder="0" . . .
3K - last updated 2017-09-15 23:37 by Au-Danae
RulesOfAcquisition
[[Reference]] Rule 001 » Once you have their money, you never give it back. Rule 002 » The best deal . . . is the one that brings the most profit. Rule 003 » Never spend more for an acquisition than you have . . . worth doing is worth doing for money. Rule 013 » Anything worth doing is worth doing twice. Rule . . . success. Rule 029 » What's in it for me? Rule 030 » Talk is cheap; synthehol costs money. Rule 031 . . . something he cares about, instead). Rule 032 » Be careful what you sell. It may do exactly what . . .
10K - last updated 2009-01-17 01:51 by Auriea
Russian
[[Language]] 1 2 3 4 5 6 7 8 9 10 11 |12 13 "14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 . . . 33 А Б В Г Д Е Ё Ж З И Й К Л М Н О . . .
1K - last updated 2010-04-05 23:23 by Auriea
SacredArt
CurrentObsession # there are gods and godessess inside each one of us. ## use of 3d scanning and manipulation . . .
1K - last updated 2017-03-20 13:13 by Au-Mercury
SacredGeometry
[[Research]] [[tube:sJ9OlPsndVs 320 240 0]] ''see also: TheUniverse'' . . .
1K - last updated 2008-06-24 13:15 by Auriea
SacredTexts
[[mythology]] http://www.sacred-texts.com/index.htm ==Founders of religions== Abraham - claimed as a . . . and organized Roman religion, ca. 717 BC-673 BC Siddartha Gautama - Buddhism, ca. 563 BC-483 BC, . . . - Taoism, ca. 500 BC Mozi - Mohism, ca. 470 BC-390 BC Jesus - Christianity, ca. 4 BC-ca. 30 AD Mani . . . 210-276 Muhammad - prophet of Islam, ca. 570-632 Nanak - Sikhism, 1469-1539 Nakayama Miki - Tenrikyo, . . . 1817-1892 Mirza Ghulam Ahmad - Ahmadiyya 1835-1908 Ngo Van Chieu (first disciple)- Cao Dai 1878-1926? . . .
2K - last updated 2005-12-27 20:10 by Auriea
Salome
FataleVrouwen John the Baptist Beheaded 14King Herod heard about this, for Jesus' name had become well . . . anything you want, and I'll give it to you." 23And he promised her with an oath, "Whatever you ask . . .
3K - last updated 2007-11-12 14:18 by Auriea
SalvadorDali
CastOfThousands 50 Secrets of Magic Craftsmanship [[image:DaliAdvice]] one of the most influential artists . . . first time i stood before it at TheMet. i <3 SalvadorDali[http://search.freefind.com/find.html?id=17493&pageid=r&mode=ALL&query=dali&x=0&y=0] . . .
1K - last updated 2018-07-07 12:04 by Au-Roma
SandySpreitz
CastOfThousands http://sandystudio.com basically still the same site design that i made for him circa . . . Volume 3 - http://ia301130.us.archive.org/3/items/Tom_Brown_Records_003/ . . .
1K - last updated 2006-06-06 23:21 by Auriea
SantaMariaInTrastevere
[[Rome2017]] [[thumb:SantaMariaInTrastevere-Labyrinth|frame|200px|According to these testimonies, the . . . maze, which had a diameter of about 3m and 33cm, was in the side aisle near the sacristy. . . .
1K - last updated 2017-09-06 10:31 by Au-Danae
Scans
[[foreground:none|#000000]] <center>[[thumb:artemis.png|1080px]]</center> <center>See . . . src="https://sketchfab.com/models/a8ab38d1422040dd94d95226d341a1dc/embed" frameborder="0" . . . src="https://sketchfab.com/models/6c18376147ef421788740f5b7593d250/embed" frameborder="0" . . . <center>[[iframe:http://auriea.com/3d/index.html|1080px|1000px]]</center> . . .
1K - last updated 2018-12-24 15:38 by Auriea.
Sculpture
[[Works]] [[thumb:BronzeMagdalenes3|500px]] ''see also: DigitalSculpture'' * [[Minorinth]] * [[Fauna]] . . .
1K - last updated 2020-12-30 00:35 by Auriea
SculptureResources
[[Reference]] WikiPedia:Category:Hellenistic_sculptors ''see also: painting, drawing, DigitalPainting, . . . http://library.thinkquest.org/23492/data/marble.htm [[::sculptors]] # Gianlorenzo . . .
1K - last updated 2018-09-28 13:58 by Auriea.
SecretWriting
SketchBooks ''see also: [[Marginalia]]'' ==made up scripts== * http://dscript.org kind of like the one . . . * WikiPedia:Voynich_manuscript, http://www.voynich.nu/ . . .
2K - last updated 2015-06-08 11:41 by Auriea
SecretWriting3
image/jpeg
225K - last updated 2014-06-25 15:18 by Auriea
Sedum
TuinPlanten A whole family{{http://www.jovihappy.nl/1895128.htm}} of succulent plants. Of which i currently . . . have 3. # HemelSleutel # JadePlant # SedumSpathulifolium . . .
1K - last updated 2006-03-16 12:36 by Auriea
SevenSisters
[[Research]] [[image:constellation_Pleadies]] The Pleiades Star Cluster ''Photo Credit and Copyright: . . . open clusters. The Pleiades contains over 3000 stars, is about 400 light years away, and only . . . 13 light years across. Quite evident in the above photograph . . .
1K - last updated 2005-08-09 17:17 by AurieaHarvey
Shapeways
[[3dPrinting]] http://www.shapeways.com/tutorials/how-does-shapeways-work 1. objects must be closed. . . . 2. objects must be manifold. 3. observe the maximum size and wall-thickness. (2mm) . . .
1K - last updated 2010-06-21 00:22 by Auriea
SightSize
[[drawing]] ''see also: CaproniCasts, LifeDrawing'' ==::BargueDrawing== http://www.learning-to-see.co.uk/bargue-drawings . . . plates: http://picasaweb.google.com/104620822473004383244/BargueBook ==::CastDrawing== sources for . . . [http://www.fineartstore.com/Catalog/tabid/365/List/1/CategoryID/14887/Level/a/Default.aspx?SortField=UnitCost%2cUnitCost] . . .
2K - last updated 2011-09-24 23:15 by Auriea
SilentHill4Kyodan
SongBook [[image:SilentHill4Kyodan-image]] ====Disc 2 Kyodan (Dramatic Storytelling) - "Inescapable Rain . . . 02 E -Tangin- 02 断金(タンギン) 03 F -Hyoujou- 03 平調(ヒョウジョウ) 04 F Sharp . . . Scale = November 02. Tangin = D# = December 03. Hyoujou = E = January 04. Shozetsu = F = February . . . http://silenthillforum.com/viewtopic.php?t=16663 This CD contains horror stories produced by the voice . . . 1,750 women in the 1700s, with records of some 3,000 women from all over Japan at one time. The area . . .
11K - last updated 2009-01-13 14:51 by Auriea
SketchBooks
[[thumb:AnneCarson-Candor|600px]] This archive is a work in/of constant progress. '''I welcome you to . . . [[Book48|48]], [[Book44|44]], [[Book43|43]], [[Book42|42]], [[Book41|41]], [[Book40|40]], . . . [[Book39|39]], [[Book38|38]], [[Book32|32]], [[Book31|31]] . . . [[Book22|22]] (especially the video) & [[Book33|33]] Those marked with a * are my favorites. ------ . . . 43 - De Rerum Natura|http://auriea.org/Book43|*43.]] . . .
8K - last updated 2019-06-07 10:17 by Auriea
SmellMemory
ElegantMedia * http://www.cbihateperfume.com/ ** '''Winter 1972''' - A field of untouched new fallen . . . collecting odors, building a library of 6,763 scents, including dirt, toys, and rotten bananas. . . . others have only been extinct for the last 30, due to things like deforestation." These scents . . .
8K - last updated 2009-09-04 14:33 by Auriea
SnelBelgWet
ProofOfMyExistence U kunt in lokaal 211 in het Administratief centrum uw aanvraag doen. Hiervoor heeft . . . 2. uw huwelijksakte , te bekomen in lokaal 201 3. nationaliteitsbewijs van uzelf, te bekomen in uw . . .
1K - last updated 2008-04-09 16:58 by Auriea
Solitaire
[[cards]] ''see also: Games, Gog:solitaire+source'' actionscript source (50$) * http://www.ifbin.com/news/2006/03/flex-2-actionscript-3-klondike-by.html . . .
1K - last updated 2007-08-13 13:56 by Auriea
SomeBeautifulTrueAndFalseNamesOfAllah
[[Research]] ====Once upon a time... Some of the Beautiful True and False Names of Allah {{lifted from . . . was sent as an email by Alan Sondheim [[2004-12-23]]}}==== The Reckoner or One Who Suffices for Everyone . . .
3K - last updated 2010-05-26 13:28 by Auriea
SomeOfMyFavoriteSites
[[Empire]] <table/non A, B> A:<tt> handprint, watercolor.....[http://www.handprint.com/HP/WCL/] . . . david bull.....[http://www.asahi-net.or.jp/~xs3d-bull/main_page.html] [http://woodblock.com/webcam/index.html] . . . Sich.....[http://www.walkerart.org/archive/C/B4737D456D87BAD76164.htm] syndicate.....[http://www.anart.no/syndicate] . . .
3K - last updated 2010-08-06 13:37 by Auriea
SongBook
[[Quoth]] [[image:ItNeverChangesToStop-TheBooks]] * LastFM * http://lyricwiki.org/ [[background external:http://auriea.org/data/static/2006-08-19_fountain.jpg|repeat . . . SongBook> [[image:diagram_JohnCageScore-3]] [[image:TheWandsCassette]] . . .
1K - last updated 2012-07-11 15:25 by Auriea
SonicYouth
CastOfThousands ''see also: SongBook'' My favorite band. [[image:SY|aren't they pretty|http://sonicyouth.com]] . . . Why is this. I first heard them in 1993, my first boyfriend passed them on to me {{lost my . . .
2K - last updated 2007-08-31 14:00 by Auriea
SoundCloud
<html> <div style="font-size: 11px;"><object height="165" width="100%"> <param name="movie" . . . . . . . . .
1K - last updated 2009-08-10 16:51 by Auriea
Spatialism
* WikiP:Lucio_Fontana * “We have renounced the practice of familiar art forms and are working to develop . . . nelle loro dimensioni, meno una. (Esempio: 1, 2, 3, 4). La Torre di Babele è un esempio antichissimo . . .
11K - last updated 2019-05-18 16:49 by Auriea
StJTB
==CLAY== <center>[[vimeo:310987804 720 398 0]] Sculpture in clay, from a live model. Made in Studio . . . [[thumb:StJTB-Prints|500px]] various 3d printed versions. (need better photos :p) ==SKETCHES== . . . [[thumb:BronzeMirror|250px|left]] [[thumb:PiraeusApollo|250px|left]] . . . [[thumb:StJTB-PrintReflection|300px|left]] . . .
1K - last updated 2019-03-28 15:41 by Auriea
StabatMater
SongBook http://www.stabatmater.info [[tube:2XUC2MQ74DE 320 240 0]] http://www.stabatmater.info/vivaldi.html . . . VALIGN="TOP"><p ALIGN="CENTER">3</td> <td WIDTH="47%" VALIGN="TOP"><dir> . . . VALIGN="TOP"><p ALIGN="CENTER">13</td> <td WIDTH="47%" VALIGN="TOP"><dir> . . . <dir> <p> </p> <h3><a NAME="medieval"></a>Medieval English . . . (Stanzas 9 - 14) with translation</h3> <p> </p> </dir> </dir> . . .
11K - last updated 2014-05-30 12:59 by Auriea
StokRoos
TuinPlanten WikiPedia:Alcea_rosea Hollyhock http://farm4.static.flickr.com/3256/2618850595_6ca0e62493.jpg . . . bloomed for the first time in June 2008. After 3 years sitting in a pot too small we replanted in . . .
3K - last updated 2008-06-29 21:43 by Auriea
StrawberryShortcake
[[Food]] Strawberry Shortcake Serves 6. Fruit: 2 pounds strawberries, washed, hulled, and sliced 3 or . . . 2 teaspoons baking powder 2 tablespoons sugar 3/4 teaspoon table salt 2/3 cup cold buttermilk 1 large . . . the fruit: Gently toss the strawberries with the 3-4 tablespoons sugar in a large bowl to macerate. . . . Let stand at least 30 minutes. For the biscuits: Adjust oven rack to middle . . . flour remains. Continue stirring vigorously for 30 seconds. Using greased 1/3 cup dry measure, scoop . . .
3K - last updated 2008-06-29 21:33 by Auriea
StreetView
OutsideSomeplace permalinks to random places. via: http://web.mit.edu/~jmcmicha/www/globegenie/ and http://www.mapcrunch.com/ . . . gnarled old tree [http://www.mapcrunch.com/?p=22.386727,114.177321,46.35,3.51,0] ==South America== * . . . * hanging laundry, unfinished . . . * pretty purple tree on a quiet street . . . ==Antarctica== * penguins! . . .
2K - last updated 2010-12-23 16:42 by Auriea
StudLoan
ProofOfMyExistence ==2017== ||I.17 || $129+179 || $300 (11,04 EURfee) || 285,13 EUR || 20170107 || $1,947 . . . || ||II.17 || $129+179 || $300 (11,64 EURfee) || 302,54 EUR || 20170207 || $?? . . . || ||III.17 || $129+179 || $300 (2,81 EURfee) || 293,06 EUR || 20170310 || $?? . . . || ||IV.17 || $129+179 || $300 (2,81 EURfee) || 294,49 EUR || 20170410 || $?? . . . || ||V.17 || $129+179 || $300 (2,81 EURfee) || 303,00 USD{{there was a paypal . . .
14K - last updated 2017-06-16 11:39 by Au-Danae
Studio
<center>[[thumb: fortune|600px]]</center> [[background:2010-06-24_silver|repeat #274b5b]] . . . [[image:Studio2017]] [[image:Book38_page4-5]] [[image:LainComputes-img]] ------ = The . . . [[image:AurieaDrawing3]] [[thumb:Ingres-vs-Delacroix_illustration1|400px|right]] . . .
1K - last updated 2020-04-08 12:37 by Auriea-Mercury
Sunday
SongBook ==Gloomy Sunday== Gloomy Sunday - the notorious 'Hungarian Suicide Song' - was written in 1933. . . . and his Orchestra, with Bob Allen on vocals (1936), that was to become the most widely covered. The . . .
5K - last updated 2005-06-21 10:58 by Auriea
SwannsWay
InSearchOfLostTime ===Week 2=== thread: [http://www.goodreads.com/topic/show/1046872-through-sunday-13-jan-swann-s-way] . . . year wave, trying very hard to touch me in 2013 from their origin in 1913. * '''viaticum''' - the . . . myself to see it this way. ** [[tube:HlhcyWLORes 320 240 0]] *** ''Many years have passed since that . . .
7K - last updated 2013-01-07 13:05 by Auriea
SweetPotatoPie
[[Food]] http://www.ehow.com/how_6999_make-sweet-potato.html ------ My recipe for sweet potato pie [[thumb:2005-11-01 . . . pie]] 3 sweet potatoes boiled and mashed like crazy. chunk . . . into the crust. Put into an oven preheated to 375 degrees. Cook for about 35-40 minutes or until . . . in the center comes out dry. or this: a. 3 lbs. Yams. b. 1 1/2 cups sugar. c. 1 can evaporated . . .
4K - last updated 2009-05-21 20:25 by Auriea
Synthetic Corpo-Reality
[[Exhibitions]] <aggregate "La_Vita_Nova"> Synthetic Corpo-Reality is inspired by the extended . . . photography, video, multi channel animations, 3D printer scans, sketch-fab, GIFs, AI softwares, augmented . . . reality, 360 experiences and virtual reality. For this show . . . On my 46th birthday I forgave myself. I made two 3d scans to mark the occasion. Now why do i bring this . . . away. take from that what you will. [[vimeo:515693367 570 417 0]] Curated by Julie Walsh for MEET Digital . . .
3K - last updated 2021-02-23 13:08 by Auriea
TV
ProofOfMyExistence http://en.wikipedia.org/wiki/Jem_%28TV_series%29 i stopped watching television when . . . . . .
1K - last updated 2009-04-18 14:43 by Auriea
TableOfContents
SketchBooks width in cm. divided by 2 [[thumb:Book49_Cover|75px]] [[thumb:Book48_Cover|65px]] [[thumb:Book47_Cover|72px]] . . . [[thumb:Book44_Cover|80px]] [[thumb:Book43_cover|85px]] [[thumb:Book42_Cover|60px]] [[thumb:Book41_Cover|128px]] . . . [[thumb:Book40_Cover|80px]] [[thumb:Book39_Cover|43px]] [[thumb:Book38_Cover|45px]] ------- . . . [[thumb:Book37_Cover|65px]] [[thumb:Book36_Cover|65px]] [[thumb:Book35_Cover|65px]] . . . [[thumb:Book34_Cover|100px]] [[thumb:Book33_Cover|63px]] [[thumb:Book32_Cover_Lightside|82px]] . . .
2K - last updated 2014-09-09 14:27 by Auriea
TagakiMasakatsu
[[DrawingImaging]] <html><iframe width="420" height="315" src="https://www.youtube.com/embed/xufG5lYRafQ" . . . width="420" height="315" src="https://www.youtube.com/embed/v-9t3ue9Sjc" . . .
1K - last updated 2016-08-13 18:00 by Auriea
TakayoshiSato
[[Games]] <html> <object width="425" height="350"><param name="movie" value="http://www.youtube.com/v/EFJZKf3Ox_k"></param><embed . . . src="http://www.youtube.com/v/EFJZKf3Ox_k" type="application/x-shockwave-flash" width="425" . . . height="350"></embed></object> </html> . . . first game, and whom IGN met and interviewed at E3 this last May. We spoke with Sato late last week, . . . we looked at Tomb Raider, to study how to make 3D worlds. IGNPS2: Obviously, now that you're using . . .
9K - last updated 2008-06-17 01:29 by Auriea
Tamara
CastOfThousands http://farm4.static.flickr.com/3026/2741511338_315b2e5d85_b.jpg . . .
1K - last updated 2010-04-14 23:34 by Auriea
TaoTeChing
[[Quoth]] [[1]] [[2]] [[3]] [[4]] [[5]] [[6]] [[7]] [[8]] [[9]] ... [[37]] [[38]] [[39]] [[40]] [[41]] . . . has two parts, the Tao Ching (道經; chaps. 1–37) and the Te Ching (德經; chaps. 38–81) * site . . .
1K - last updated 2012-06-07 13:48 by Auriea
Tarot
ElegantMedia Tarot with FoAM - LibFoam:tarot -------- Tarot Exchange [http://groups.yahoo.com/group/Tarot-Exchange] . . . - a beginning (timing) 2 ~ further development 3 ~ planning 4 ~ practical attainment 5 ~ unbalance, . . . ** http://www.tarotforum.net/showthread.php?t=136753 (when is it not tarot but an oracle?) ==games== . . .
4K - last updated 2012-02-27 13:32 by Auriea
Techne
ElegantMedia Mythica:techne <source> From: rob@robmyers.org Subject: [NetBehaviour] Heidegger And . . . And Art Computing Date: 2007年5月12日 18:40:30:GMT+02:00 To: netbehaviour@netbehaviour.org Reply-To: . . .
2K - last updated 2007-05-12 19:10 by Auriea
TedNelson
CastOfThousands "Designer, Generalist, Contrarian Theodor Holm Nelson, 1937- Best known for: coining . . . terms "hypertext" and "hypermedia," 1963 (first published 1965), and as founder and pursuer . . .
1K - last updated 2004-11-25 15:09 by Auriea
TenThousandThings
[[Quoth]] ''see also: numbers, [[1]], [[2]], [[3]], [[4]] ... [[33]], [[34]], [[35]], [[36]], [[37]], . . . [[38]], [[39]], [[40]], [[41]]...'' The Tao that can . . .
1K - last updated 2012-07-11 14:45 by Auriea
TeunisBloem
TuinPlanten [[Gog:Oenothera tetragona]] [[WikiPedia:Oenothera]] [[thumb:2005-06-22_TeunisBloemBloom|frame|right|150px|it . . . - from June to September - reaching a height of 3 to 4 feet) open in the evening, hence the name "evening . . . and O. tetragona as separate species. Hardy zone 3. Height is 15 inches to 20 inches. As mentioned . . . above, in good soil will spread to form a patch 3 feet wide. . . .
4K - last updated 2005-06-22 22:44 by Auriea
TextFormattingRules
[[Empire]] If you click on the question mark you can make a new wiki page. If a wiki page already exists . . . controlling the look.'' .red {font:30px zapfino; color:red;} ----- ==HEADLINES== ===Equal . . . .InclusionSamplePage { background-color:#333333; border:3px dotted #ff0000; width:200px; height:130px; . . . color:#ffffff; font:30px Arial;} ===AGGREGATE=== Controlled with aggregate.pl . . . oda=0.92 pos=2 country=Denmark oda=0.84 pos=3 country=Netherlands oda=0.81 pos/c=... pos=9 country=Switzerland . . .
16K - last updated 2017-02-28 15:38 by Auriea
TheAeneid
''see also: http://auriea.de'' For Aeneas in Book 3 - Halfway between Delos and Crete <center><html><iframe . . . src="https://www.google.com/maps/embed?pb=!1m0!3m2!1sen!2s!4v1422891925644!6m8!1m7!1sWddsUw1geEoAAAQIt9RnsQ!2m2!1d36.462018!2d25.403616!3f217!4f0!5f0.7820865974627469" . . .
1K - last updated 2017-08-14 14:32 by Au-Mercury
TheAnalyticalLanguageOfJohnWilkins
[[Quoth]] THE ANALYTICAL LANGUAGE OF JOHN WILKINS By Jorge Luis Borges Translated from the Spanish 'El . . . in Jorge Luis Borges, 'Other inquisitions 1937-1952' (University of Texas Press, 1993) I have noticed . . . Henderson; the 'Wörterbuch der Philosophie' (1935), by Fritz Mauthner; 'Delphos' (1935), by E. Sylvia . . . Pankhurst; 'Dangerous Thoughts' (1939), by Lancelot Hogben. All of us have once experienced . . . pope; number 282, the Roman Catholic Church; 263, the Day of the Lord; 268 Sunday schools; 298, mormonism; . . .
9K - last updated 2010-09-13 21:50 by Auriea
TheAntichrist
[[Mythology]] 46 Prophecies the Antichrist will fulfill # The antichrist will be a man - Daniel 7:24-25 . . . this covenant. The word here for "confirm" is 1396 gabar (gaw-bar'); a primitive root; to be strong; . . . Holy Roman Empire - Daniel 2:44 # He will uproot 3 kings from the original 10 kings to gain political . . . government which he will dominate - Revelations 13:1-2 Now this also, could refer to several things. . . . religious partner (false prophet) - Revelations 13:11-12 # He was, and is not, and yet is - Revelations . . .
9K - last updated 2009-06-25 09:25 by Auriea
TheBangBangClub
http://lens.blogs.nytimes.com/2009/08/20/showcase-38/ http://lens.blogs.nytimes.com/2009/08/21/showcase-39/ . . .
1K - last updated 2009-08-27 22:17 by Auriea
TheBeautyOfTheHusband
FiftyBooks Read this while spending one day in the hospital{{uterus, [[2005-02-07 The Day Before]], [[2005-02-09 . . . Keats, Otho the Great: A Tragedy in Five Acts, I.3.114 ad 114 All myth is an enriched pattern, a two-faced . . .
5K - last updated 2013-01-05 22:01 by Auriea
TheBlueCurtain
reference [[tube:yKJIZ0WyjN8 512 350 0]] . . .
1K - last updated 2018-06-09 18:19 by Au-Mercury
TheDiseaseManifesto
[[Entropy8.com]] Manifesto | 1996 - 1998 [[image:bread]] Co-written by Bable and the Cut-up Machine. . . . with it. make it one of the bottom enthralls. 003. I know Ive been promising it for a long time I have . . . to do what I want to do with this section. 013. It started out being a dream a few years ago. 014. . . . a long time and I still dont have it for you. 023. I am truly addicted. Addicted to life at this point . . . make it one of the things you say make sense. 030. Not being afraid because you know none of i matters . . .
21K - last updated 2018-09-10 19:41 by Auriea.
TheFlowerSeller
<html><center><div class="sketchfab-embed-wrapper"><iframe width="90%" height="750" . . . frameborder="0" allowvr allowfullscreen . . .
1K - last updated 2018-03-09 16:15 by Au-Mercury
TheFourByFive
[[photography]] http://farm3.static.flickr.com/2367/2518960124_4d245c7134.jpg --i think i lost part of . . . # LINHOF Schneider-Kreuznach Angulon 1:6,8/90 3668257 Synchro-Compur 6,8 - 32 [http://photo.net/large-format-photography-forum/00OsJr] . . . May 1952] # SEIKOSHA-SLV Commercial Astragon 1:6.3 f=180mm (7 1/8") No.83481 6.3 - 63 . . .
1K - last updated 2009-02-22 14:05 by Auriea
TheFuries
[[mythology]] Aeschylus The Eumenides ''The Kindly Ones'' 458 BC ''This translation, which has been prepared . . . the source is acknowledged. Last revised May 2003'' '''Dramatis Personae''' Priestess: prophetic priestess . . .
53K - last updated 2006-06-02 20:58 by Auriea
TheGlassEssay
[[Quoth]] POEM The Glass Essay BY AnneCarson I I can hear little clicks inside my dream. Night drips . . . 4 years,” she wrote in her Diary Paper of 1837. Yet her poetry from beginning to end is concerned . . . There is a fragment of a poem she wrote in 1839 (about six years before Wuthering Heights) that . . . way and that way unable to stand upright. Nude #3. Woman with a single great thorn implanted in her . . . big window and a combination lock (5—25—3) to the west wing, for chronic care patients. . . .
46K - last updated 2013-01-06 12:10 by Auriea
TheGraeae
FataleVrouwen The three "old women" or "gray ones" from Greek mythology. They are the daughters of Phorcys . . . PEPHREDO, ENYO, DEINO (Apollodorus 1.10) [1.3] PEMPHREDO, ENYO, DINO or PERSIS (Hyginus Preface) . . . tooth and eye." - Apollodorus, The Library 2.37-39 "He [Perseus] that stole the lamp [eye] of his . . .
4K - last updated 2006-12-24 15:35 by Auriea
TheLibraryOfBabel
The Library of Babel by Jorge Luis Borges By this art you may contemplate the variations of the 23 letters... . . . is a total book on some shelf of the universe; (3) I pray to the unknown gods that a man -- just one, . . .
18K - last updated 2010-10-02 01:15 by Auriea
TheLimitsOfTwo
Not a fun place to be. What happens when the relationship between Michael and I break down and we are . . . sometimes. We make up, always. [[thumb:2006-07-03 20h45 limits of two revisited]] . . .
1K - last updated 2012-07-11 15:18 by Auriea
TheLivingLine
[[Projects]] ''see also: Drawing, DrawingDancing, Residencies, LiveDrawing, [http://auriea.com/thelivingline/ . . . Zacht] ==Tools for Lines== Now that I have a 3DPrinter I should think more seriously about making . . . my own tools. Making custom tools in 3d and printing and finishing by hand! Others can download/alter/print . . . a flourish) ===examples=== # Shantell Martin's 3d printed drawing tools ==VR Tools for Lines== And . . .
2K - last updated 2017-08-23 13:26 by Au-Mercury
TheLouvre
<html><script src="http://occipital.com/360/embed.js?pano=3Wf7cT&width=100%&height=400"></script></html> . . .
1K - last updated 2014-01-08 12:19 by Auriea
TheNineBillionNamesOfGod
[[Quoth]] The Nine Billion Names of God By Arthur Clarke "This is a slightly unusual request," said Dr. . . . was, thought George. The battered old DC-3 lay at the end of the runway like a tiny silver cross. . . .
15K - last updated 2007-12-21 14:58 by Auriea
TheRitualOfLoveAndDeath
[[Quoth]] <html><embed src=http://video.google.com/googleplayer.swf?docid=9201439452997071422&hl=en&fs=true . . . style=width:400px;height:326px allowFullScreen=true allowScriptAccess=always . . .
1K - last updated 2010-07-26 22:47 by Auriea
TheSandman
FiftyBooks A GraphicNovel series written by NeilGaiman. Covers by DaveMcKean. [http://spiffyness.net/dream/ . . . giving Morpheus the key. # '''A Game of You''' (32-37) The Cuckoo. Something inside of a little girl. . . . Possibly Go Wrong?, DC Comics, 1992 ''Sandman #43'', "The People Who Remember Atlantis-Concerning Mammoths, . . . You Ma'am-Tiffany Watches II, DC Comics, 1993 ''Sandman #46'', Life Isn't Pleasant, Petrified-The . . . Frangit, Death Talks About Life, DC Comics, 1993 ''Sandman #47'', Cooking Considered As One Of The . . .
7K - last updated 2010-05-19 14:56 by Auriea
TheThirdSecretOfFatima
[[Quoth]] The third part of the secret revealed at the Cova da Iria-Fatima, on 13th July 1917. "I write . . .
2K - last updated 2014-04-16 13:40 by Auriea
TheToyRoom
[[Projects]] ==The Endless Forest Toys== I am in touch with http://crazylabel.com but maybe it is too . . . of the model – before reducing it to 1/32 of its real size. * one model for boys AND girls. . . . treasured secret.secret treasure ---- size: 174/32 = 5.4375 ---- but lets free up the mind a bit... . . . (drawings and a nice web design) http://www2.tky.3web.ne.jp/~aokigaro/new/exhibition/bel/bel.html * . . .
2K - last updated 2006-05-30 15:38 by Auriea
The Archive To Come
<center><html><iframe src="https://player.vimeo.com/video/461163311?title=0&byline=0&portrait=0" . . . width="700" height="394" frameborder="0" allow="autoplay; fullscreen" allowfullscreen></iframe> . . . This work is of a 3D scan made in the Rijksmuseum, Amsterdam. "Facial . . . I never stop wondering who these people were. . . . What is so appealing about broken things? My 3D capture was done in less than ideal circumstances, . . .
3K - last updated 2021-01-04 12:13 by Auriea
The Two Sisters
SongBook There were two sisters walking down by a stream Oh the wind and the rain The older one pushed . . . wind and rain. FM:Nico+Muhly/_/The+Only+Tune%3A+III.+The+Only+Tune+-+Samamidon . . .
2K - last updated 2008-08-04 14:27 by Auriea
ThirdSecretOfFatima
[[Mythology]] The third part of the secret revealed at the Cova da Iria-Fatima, on 13th July 1917. "I . . .
2K - last updated 2005-03-21 10:39 by Auriea
ThoughtPhotoStream
<html><script type="text/javascript" src="http://www.flickr.com/badge_code_v2.gne?show_name=1&count=10&display=latest&size=m&layout=h&source=user_set&user=81482434%40N00&set=72157624960278365&context=in%2Fset-72157624960278365%2F"></script></html> . . .
1K - last updated 2012-02-10 21:15 by Auriea
ThreeMarys
FataleVrouwen [https://www.biblegateway.com/passage/?search=John+19%3A25&version=NIV John 19:25] . . . at times been thought to be the same person.[3] Mary, mother of Jesus Mary Magdalene Mary of Bethany . . . (Luke 10:38–42; John 12:1–3) Mary (mother of James the Less) . . . "the other women", after stating earlier (Luke 23:55) that at the burial of Jesus "the women who had . . . [http://shadowsineden.blogspot.be/2015/03/the-gospel-of-mary.html The Gospel of Mary] . . .
3K - last updated 2017-04-07 13:12 by Au-Danae
ThunderPerfectMind
[[Quoth]] I was sent forth from the power, and I have come to those who reflect upon me, and I have been . . . the designation of the division. And I [...]. (3 lines missing) [...] light [...]. [...] hearers [...] . . .
9K - last updated 2006-05-22 10:05 by Auriea
TillWeHaveFaces
FiftyBooks [[thumb:TillWeHaveFaces-scan1]] [[thumb:TillWeHaveFaces-scan2]] [[thumb:TillWeHaveFaces-scan3]] . . . . . . . . .
1K - last updated 2006-11-08 02:29 by Auriea
TillWeHaveFaces-scan3
image/jpeg
235K - last updated 2005-11-19 12:36 by Auriea
ToWatch
[[Movies]] <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/kxIYuOeAKnw?fs=1&hl=en_US"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . . * Art21 - http://video.pbs.org/program/1217143847 * best ov ubu - http://ubu.com/resources/feature.html . . . <object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/Gn8IoA6wGCo&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object> <object width="480" . . .
3K - last updated 2011-01-12 19:41 by Auriea
TooManyOptions
[[Entropy8]] i see this as a problem with the Empire. I want something sown together, something whole. . . . * this here akiw, this here wiki. is love <3. its fragile, but its love. need to make a mobile . . . ## SoundCloud €9/mo €108/yr ### LastFM €3/mo €36/yr ### emusic €13,99/mo €167,88/yr ## . . .
3K - last updated 2009-08-10 17:07 by Auriea
TuinPlanten
[[Botany]] ===About Plants=== http://www.theplantlist.org/ ==Complete Listing== see also: worms http://www.plantentuin.ugent.be . . . #ba039e]] Summer 2005: Aphids Summer 2006: Spider Mites . . .
2K - last updated 2011-01-02 20:07 by Auriea
Twine
ElegantMedia These will be notes about how to use [http://twinery.org twine] ==Resources== * [http://twinery.org/forum/index.php . . . to (colour: #ff0000)) [$customColor[00:30]]</code> . . .
2K - last updated 2015-08-06 16:14 by Auriea
UArtsy
[[Projects]] https://www.uartsy.com/users/auriea-harvey ==Classes to take== # https://www.uartsy.com/course/power-grace-the-structure-of-man . . . # https://www.uartsy.com/course/create-3d-models-textures-from-photos # https://www.uartsy.com/course/3d-printing-for-artists . . .
1K - last updated 2015-11-30 17:36 by Auriea
Ultimaker3
[[3dPrinting]] =This Much I Know= # PLA is: ## brittle, don't drop it ## '''moisture in your PLA filament . . . roll is real''' ### here [http://3dprintingforbeginners.com/how-to-store-3d-printing-filament/] . . . [http://3dprintingforbeginners.com/3d-printer-filament-storage-made-easy/] . . . of rolls [https://www.thingiverse.com/thing:1416307] ### filament dryer [https://www.thingiverse.com/thing:1618037] . . . == would be useful to get . . .
2K - last updated 2017-08-23 17:54 by Au-Mercury
UnderTheSea
[[image:lobster]] Dr. O'Dor was on a cruise to the Arctic last year that made a number of finds, including . . . but looks bulkier. Sooty shearwaters average 350 kilometres a day in their search for food. A satellite . . . of water under a microscope. This one, found 4,300 metres beneath the surface, was a centimetre in . . .
3K - last updated 2006-12-12 15:10 by Auriea
Unity3D
[[Reference]] = [::uScript] = Forum [http://www.uscript.net/forum/index.php] * bring up the editor with . . . F = center on object Terrain guide - http://unity3d.com/support/documentation/Components/script-Terrain.html . . . Lightmapping guide - http://unity3d.com/support/documentation/Manual/Lightmapping.html . . . ----- ==Learning Javascript== http://forum.unity3d.com/threads/34015-Newbie-guide-to-Unity-Javascript-(long) . . . it easier to add features== http://www.prime31.com/unity/ . . .
1K - last updated 2012-06-18 11:41 by Auriea
Unity3dShaders
[[Unity3d]] http://www.unifycommunity.com/wiki/index.php?title=Shaders ====from the forums==== * Force . . . Field Shader [http://forum.unity3d.com/viewtopic.php?t=10160&postdays=0&postorder=asc&start=0] . . . * Atmosphere [http://forum.unity3d.com/viewtopic.php?t=50262] . . .
1K - last updated 2010-05-26 20:38 by Auriea
UnityXCode
==HumanitarianAssistance== * ''it is important to have the iPhone OS 4.0 SDK (iOS 4) installed on your . . . 4.0" and the Deployment Target to "iPhone OS 3.0", your game will work with fast app switching (multitasking) . . .
1K - last updated 2010-08-03 19:10 by Auriea
VIDEOGAMES
1) Bientôt l’été, 2011 http://tale-of-tales.com/bientotlete A holodeck beach simulation. Entertainment . . . to, in french, if possible. https://vimeo.com/54039868 https://vimeo.com/54038250 2) The Graveyard, . . . game design at a time when all vidogames were 23hours long and involved combat, we gave the world . . . 3. Luxuria Superbia, 2013 Something completely . . .
2K - last updated 2020-06-15 22:30 by Auriea-Mercury
Vanitas
ElegantMedia ==Flower Painting== WikiPedia:Jan_van_Huysum WikiPedia:Abraham_Mignon WikiPedia:Jan_Weenix . . . Paintings - http://www.freewebs.com/garyosborn/235degreereferences.htm ==Momento Mori Elements== ===living=== . . .
2K - last updated 2008-03-18 17:30 by d54C6FF9F.access.telenet.be
VegetalTime
[[Botany]] copied to: LibFoam:tale_of_vegetal_time ==The Goal== * to make the player feel like a plant . . . ==Dealing with time== Use seasons as tools All . . . -like: somewhere between Puzzle Quest http://pix3lnati0n.files.wordpress.com/2008/01/puzzlequest.jpg . . .
4K - last updated 2008-11-30 00:56 by Auriea
VelvetPlant
TuinPlanten [[thumb:2005-06-04_VelvetPlant|frame|right|the latin name is Gynura but it is also known . . . it is best to keep them trimmed to a length of 3 ft. or less. Pinching the growing tips will result . . . sun. Keep the soil evenly moist. Feed every 2-3 weeks with half-strength house plant food when the . . . (Purple Passion Plant) is easily propagated by 3-5 inch cuttings set in soil or vermiculite or simply . . . barely moist at all times. FERTILIZING: Wait 2 - 3 months before fertilizing newly purchased plants. . . .
3K - last updated 2005-07-14 11:22 by 84.194.164.18
VijaCelmins
CastOfThousands <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/tORoyCJtO4o&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . .
1K - last updated 2010-05-05 00:31 by Auriea
Vimeo
[[Empire]] <html> <iframe src="http://player.vimeo.com/video/18599827" width="400" height="300" . . . .vimeoBadge a:link, a:visited, a:active { color:#3A75C4; text-decoration:none; cursor:pointer; } .vimeoBadge . . . </html> ==tag== [[vimeo:190454 400 300 0]] ==rss== <rss "http://www.vimeo.com/auriea/videos/rss"> . . .
2K - last updated 2011-04-05 12:40 by Auriea
VincentDesiderioLectureNotes
[[Painting]] [[tube:GxRN9tcN6pQ 640 480 0]] # this talk is about how to control color temperature and . . . # better to do what he calls a chromatic grisalle. . . .
8K - last updated 2014-08-21 13:50 by Auriea
VisualProgramming
[[Reference]] WikiPedia:Visual_programming_language ''see also: [[HTML5]], RealTimeProgramming'' For . . . http://www.creativeapplications.net/news/3d-freehand-drawing-with-field-news/ . . .
2K - last updated 2012-09-27 12:06 by Auriea
Wabi-sabi
ElegantMedia "Wabi-sabi is the most conspicuous and characteristic feature of traditional Japanese beauty . . . nothing is finished, and nothing is perfect.”[3]" WikiPedia:Wabi-sabi http://c2.com/cgi/wiki?WabiSabi . . .
1K - last updated 2010-06-02 14:50 by Auriea
Wales
OutsideSomeplace [[vimeo:7254503 720 400 0]] . . .
1K - last updated 2009-10-28 23:26 by Auriea
WarsawFoksalGalleryShow2019
<html> <div class="sketchfab-embed-wrapper"><iframe width="640" height="480" src="https://sketchfab.com/models/be76382be40a4574b96b7c6b59a79c8b/embed?autospin=0.2&autostart=1&camera=0" . . . src="https://sketchfab.com/models/04d4f3a310d742fc8a71498ffc8917ef/embed?autospin=0&autostart=1&camera=0" . . .
1K - last updated 2019-02-25 15:26 by Auriea
Weapons
[[Research]] [[tube:ynCsFZ3AS3E 320 240 0]] http://www.nuclearweaponarchive.org/index.html [[image:Weapon-TellerDiagram]] . . .
1K - last updated 2008-03-17 10:25 by d54C6FF9F.access.telenet.be
WhiteChocolateFrosting
[[Food]] 1 cup butter, softened (no subs) 2 cups confectioners' sugar 6 ounces white chocolate or 6 ounces . . . white baking bar, melted and cooled 3 -5 tablespoons whipping cream or 3 -5 tablespoons . . . white chocolate and whipping cream (start with 3 tablespoons and add in more to achieve desired consistency). . . . Beat on high speed for 3-4 minutes, scraping the bowl with a spatula. . . .
1K - last updated 2015-08-25 19:09 by Auriea
WilliamKentridge
CastOfThousands ''see also: TheLivingLine'' ==Six Drawing Lessons== <html><iframe width="560" . . . height="315" src="https://www.youtube.com/embed/tyndlMIgbnU?rel=0" . . . ==Other Lectures== # [https://vimeo.com/78123839 Second Hand Reading] . . .
2K - last updated 2015-11-23 19:44 by Auriea
WirefirePortraits
<html><object width="320" height="240"> <param name="flashvars" value="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2F&set_id=72157594473311985&jump_to="></param> . . . <param name="allowFullScreen" . . . allowFullScreen="true" flashvars="&offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Fsets%2F72157594473311985%2F&set_id=72157594473311985&jump_to=" . . . width="320" height="240"></embed></object></html> . . .
2K - last updated 2009-01-11 00:05 by Auriea
WongKarWai
CastOfThousands His films are complex and very romantic. Saturated colors and ornamental sets even if . . . http://www.sensesofcinema.com/contents/01/13/wong-symposium.html WikiPedia:Wong+Kar+Wai Img:Wong+Kar+Wai . . . http://www.imdb.com/name/nm0939182/ ==Movies== [::ChungKingExpress] Multiple stories. . . .
3K - last updated 2007-01-22 01:58 by Auriea
WordGames
[[Language]] ''see also: SecretWriting'' 1. Isogram A word in which no letter of the alphabet occurs . . . obscure words or initials can be found here. 3. Palindrome A word, sentence, or longer written work . . . F. Scott Fitzgerald's Gatsby as great, but in 1939 Ernest Vincent Wright produced the phenomenal Gadsby: . . .
5K - last updated 2015-08-25 19:10 by Auriea
WordPress
==portfolio shortcodes== https://en.support.wordpress.com/portfolios/portfolio-shortcode/ * display_types: . . . include_type=ui-design,app-design columns=3 showposts=10 orderby=title]</tt> Jetpack shortcode . . .
2K - last updated 2016-08-04 19:52 by Auriea
Works
------ [[Sculptures]] '''2018''' # Minorieas 1, 2, 3, 4 # Bottle heads # 2 Magdelene bronzes # Magdelene . . . # Viola head iterations # Cyclops prototype # 3d Print experiments [[Simulations]] '''2017''' # Minorinth . . . for Finding the Eye [[Scans]] '''2018''' # 3d scan of StJTB . . .
1K - last updated 2019-01-30 16:53 by Auriea
X3DOM
in Header: <script src="http://www.x3dom.org/release/x3dom.js"></script> <link rel="stylesheet" . . . href="http://www.x3dom.org/release/x3dom.css"> test: <html> . . . <x3d width='600px' height='400px'> <scene> <shape> . . . </shape> <transform translation='-3 0 0'> <shape> <appearance> <material . . . </transform> <transform translation='3 0 0'> <shape> <appearance> <material . . .
1K - last updated 2019-06-29 23:55 by Au-Roma
XLVI
<center><html><div class="sketchfab-embed-wrapper"><iframe width="90%" height="700" . . . . . . frameborder="0" allowvr allowfullscreen . . .
1K - last updated 2017-09-15 23:44 by Au-Danae
YearZero-bitforms-installation-3
image/jpeg
1085K - last updated 2021-03-16 16:05 by Auriea
YojimboPotatoes
[[Food]] ==Yojimbo Potatoes== Ingredients: 1.5 pounds small red potatoes 2 tablespoons olive oil .5 sprig . . . rosemary (or 1 teaspoon dried rosemary leaves) 3 slices of thick, center-cut bacon, cooked until crisp . . .
1K - last updated 2006-01-25 13:26 by Auriea
YoshinoyaAuthenticGyudonRecipe
[[Food]] 日本 ===YOSHINOYA AUTHENTIC GYUDON, TOLD TO ME BY A VERY KNOWLEDGABLE JAPANESE GIRL{{lifted . . . stuff. The rice has to stick to itself. * 360ml Water * 1 ½ Tbsp Shoyu (Soy Sauce, I just typed . . .
3K - last updated 2007-08-31 20:39 by Auriea
Youkali
SongBook Paroles en Français : C'est presqu'au bout du monde, ma barque vagabonde, errant au gré de . . . English Language : C'est presqu'au bout du . . .
4K - last updated 2014-08-27 14:19 by Auriea
Yurt
[[Research]] <html><script src="http://flash.revver.com/player/1.0/player.js?mediaId:149791;width:480;height:392;" . . .
1K - last updated 2009-01-04 01:23 by Auriea
ZBrush
DigitalSculpture ZBrush is the only application that makes me think that 3d modeling could be alright . . . after drawing a 3d object you must go into EDIT MODE for it to be treated . . . like a true 3d onbect 3d tool used QWERT * ROTATE = drag in empty . . . = alt + LMB then let go of ALT{{turn around 3 times and sacrifice a goat, hope this works}} ** . . . this you will be able to goto tool > make 3d polymesh // what happens now is: your zsphere version . . .
14K - last updated 2014-09-17 17:07 by Auriea
ZbrushShortcuts
The following list of Shortcuts and Mouse Actions is arranged by category. For a list arranged by palette . . . * Brushes – '''F2''' * Strokes – '''F3''' * Alphas – '''F4''' * Textures – '''F5''' . . . Dial - '''Z''' ==Edit mode Navigation== with a 3D mesh in Edit mode - Free Rotate - '''Click & . . . Replay Last Stroke - '''1''' Record Stroke - '''3''' Replay All Recorded Strokes – '''2''' ==3D Models== . . .
10K - last updated 2012-04-20 19:20 by Auriea
abyss
[[Quoth]] "Battle ye not with monsters, lest ye also become a monster. And remember that when you look . . . . . . 2:14 P.M: this time finally awake. . . . 2:35 P.M: this time completely awake,” along with negations . . . out, followed by “I was fully conscious at 10:35 P.M., and awake for the first time in many, many . . . spoke of the Second World War (he was born in 1938) and how his family would go to bomb shelters and . . . (I worked it out, laboriously: it is 40,320.) I asked him about Prime Ministers. Tony Blair? . . .
43K - last updated 2007-09-19 20:32 by Auriea
aesthetics
ElegantMedia I am going to have to give my opinion on Aesthetics during the okno Public 01 symposium . . . * Figurative sculpture/as it relates to computer 3d sculpture ** not the photorealistic stuff the beauty . . . is in hindsight? perhaps? I should talk about 3d as i relates to THESE images -----> she called . . .
7K - last updated 2006-05-24 14:58 by Auriea
anarchy
PrevalentPhilosophy [[image:anarchy sign]] ''One thing that I've learned in academia is no one much cares . . . - [http://www.counterpunch.org/frank05132005.html David Graeber]'' * http://en.wikipedia.org/wiki/Anarchism . . .
1K - last updated 2008-01-14 13:53 by Auriea
anatomy
SketchBook ''see also: LifeDrawing'' the differences between man and woman * http://anthropology.si.edu/writteninbone/male_female.html . . . * UC Berkeley IB 131 General Human Anatomy webcast [http://webcast.berkeley.edu/courses/archive.php?seriesid=1906978375] . . . Designed to be taken concurrently with 131L."'' ** Books [http://www.amazon.com/Anatomy-Coloring-Book-3rd/dp/0805350861][http://www.amazon.com/Anatomy-Coloring-Book-3rd/dp/0805350861] . . . ==Atlases== * interactive full body 3d http://www.visiblebody.com * of the face (interactive . . . of England http://www.fineart.sk/ http://www.3d.sk/ http://characterdesigns.com/ ==Cast objects== . . .
4K - last updated 2011-09-05 23:47 by Auriea
anotherdayfullofdread
SongBook http://www.azchords.com/b/bonnieprincebilly-tabs-10331/anotherdayfullofdread-tabs-101820.html . . .
1K - last updated 2010-12-10 19:04 by au
applications
[[Reference]] ==2020== blender3d 4eva my slicers - cura, prusa, preform procreate playform (online GAN . . . dropbox evernote google calendar ------ blender3d max/msp/jitter codea <3 readitlater, kindle, . . . goodreads my wiki <3<3 livejournal xo tumblr ooooooooooooo last.fm . . . unity3d zbrush artrage ! evernote things twitter web browser . . .
1K - last updated 2020-01-14 14:53 by Au-Elektra
autodidact
ProofOfMyExistence 2 definitions The Collaborative International Dictionary of English v.0.48 Autodidact . . . One who is self-taught; an automath. [1913 Webster] WordNet (r) 2.0 autodidact n : a person . . .
1K - last updated 2006-12-24 14:40 by Auriea
banana
[[Food]] '''Banana pancakes''' INGREDIENTS 1 cup all-purpose flour 1 tablespoon white sugar 2 teaspoons . . . sides; serve hot. ----- '''Banana Bread''' 2-3 over-ripe bananas 2 eggs, well beaten 2 cups all-purpose . . . juice freshly-grated orange zest Preheat oven to 350°. Grease and flour a standard 9 x 5 loaf pan (I . . . Pour batter into a 9x5-inch loaf pan and bake at 350° for 1 hour, or until a wooden pick or cake tester . . . nut bread. ----- '''Banana Bread Muffins''' 3 or 4 ripe bananas, smashed 1/3 cup melted butter . . .
3K - last updated 2007-08-31 19:31 by Auriea
beauty
ElegantMedia Here's the GutaiManifesto: "This is described as the beauty of decay, but is it not perhaps . . . its original life?" [[tube:8nxUOIAyuvw 425 350 0]] [[thumb:DorianGrayPreface|150px|right]] maja . . . etc... http://vs2.i-dat.org/unstructured03/05.html ''might be taken as an illustration of Dostoyevsky's . . . ''see also: BeautyInTheAgeOfDigitalArt'' . . . his own image for the very first time. Nikon F5; 300mm lens; 1/125 sec at f2.8; Ektachrome E100VS; tripod. . . .
5K - last updated 2018-09-10 16:13 by 78-22-179-76.access.telenet.be
biscuits
[[Food]] http://allrecipes.com/Recipe/Easy-Baking-Powder-Drop-Biscuits/Detail.aspx INGREDIENTS: 2 cups . . . 1. Preheat an oven to 450 degrees F (230 degrees C). 2. Mix flour, baking powder, salt, and . . . at a time, stirring lightly between additions. 3. Drop the batter by spoonfuls onto a cookie sheet, . . .
1K - last updated 2013-06-14 10:39 by Auriea
black
[[Quoth]] Scientists create darkest color out of carbon nanotubes, hundreds of times darker than black.[http://www.chron.com/disp/story.mpl/front/5451632.html] . . . [[tube:NWmCbEbMmeU 320 240 0]] ----- <table poemde, poemen> poemde= . . .
7K - last updated 2014-09-12 09:33 by Auriea
black.css
[[Empire]] @import url('https://fonts.googleapis.com/css?family=Cardo|Crimson+Text|Quattrocento|Source+Serif+Pro'); . . . a.url:before { } a.inter { color: #576D3B; background-color: #F6FF97; padding: 1px 2px; text-decoration: . . . 1px #cccccc; border-style: outset; padding: .23em .4em; color: #666666; text-shadow: #222222 0px . . . img{ border: 10px outset rgba(255, 255, 255, 0.38); margin: 0 auto; display: block; -moz-box-shadow: . . . } form.search input{ background-color: #c3c3c3; } form.search p{ padding: 0; margin: 0; } form.search . . .
14K - last updated 2017-02-26 09:41 by Auriea
blacker
[[sound:blacker.mp3]] . . .
1K - last updated 2007-10-12 23:36 by Auriea
blueblueelectricblue
DigitalSculpture <center><html> <div class="sketchfab-embed-wrapper"><iframe width="1080" . . . src="https://sketchfab.com/models/ed124c52c0b74232b719913f55fc077d/embed" frameborder="0" allowvr allowfullscreen . . .
1K - last updated 2018-12-25 15:00 by Auriea.
bookbinding
SketchBooks ==The Making Of [[Book50]]== ===1.=== <html><iframe class="vine-embed" src="https://vine.co/v/MpqZaFMXgit/embed/postcard" . . . width="320" height="320" frameborder="0"></iframe><script . . . width="320" height="320" frameborder="0"></iframe><script . . . tape[http://store.falkiners.com/store/category/93/227/Sewing-Threads%2C-Tapes-&-Cords/] to fit . . . transfer the hole marks to the signatures. ===3.=== <html> <iframe class="vine-embed" src="https://vine.co/v/MpqKJJmveAd/embed/postcard" . . .
8K - last updated 2014-06-02 17:08 by Auriea
breathe
ProofOfMyExistence ''see also: exercise, yoga, meditation'' http://www.youtube.com/results?search_query=yoga+breath&aq=f . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/WjbMB5IEUFI&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . . [http://www.angelfire.com/ny5/shenandoah/OBB/OBB.html . . . steps (1) through (4) only once or repeat steps (3) and (3) for up to 20 minutes.* # End with a slow . . .
5K - last updated 2010-07-03 00:49 by Auriea
calligraphy
[[Research]] guess i might as well autodidact this like everything else Calligraphy means"beautiful writing." . . . [[thumb:biosculpture_ThePillowBook|300px]] http://www.studioarts.net/calligraphy/ . . .
1K - last updated 2005-06-29 10:09 by wof
ceremony
SongBook <html> <object width="425" height="355"><param name="movie" value="http://www.youtube.com/v/rF9xO2Tpwzs&rel=1"></param><param . . . wmode="transparent" width="425" height="355"></embed></object> </html> . . .
2K - last updated 2007-11-12 00:30 by Auriea
color
[[Reference]] ''see also: FavoriteColor'' [::DeadColor] The first layers of paint the artist applies . . . R: 249, G:244, B:006 Cadmium Lemon R: 244, G:237, B:001 Yellow R: 241, G:167, B:016 Cadmium Yellow . . . R: 231, G:129, B:053 Cadmium Orange R: 225, G:036, B:066 . . . Cadmium Red R: 231, G:081, B:110 Rose Madder R: 166, G:036, B:046 Alizarin . . . Blue R: 069, G:057, B:140 Deep Cobalt Blue R: 053, G:079, B:151 French Ultramarine R: 047, G:058, B:127 . . .
2K - last updated 2013-01-16 12:15 by Auriea
computer history
[[Empire]] ==prehistory== # brother or sx-70 ?? something (i was 8) # commodore vic 20 !! <3 # mac . . . - Gray iMac # Debbie Does Dell - Dell Precision 340 # Melody - iBook G4 # [[Bonnie and Clyde]] - !MacBook . . . Pro 2.33Ghz Intel ## Antonius and Faustina - 500 GB drive . . . (June 2010) ## reformatted as Minerva (Nov 2013) # Eureka Maru - Lenovo Thinkpad x201t Tablet PC . . . # Mercury - !MacBook Air 13" i7 256 (mid 2013) acquired Feb 2014 # ATLAS - iMac . . .
2K - last updated 2024-12-20 15:29 by Au
css
/* @override http://auriea.org/?* */ @import url('https://fonts.googleapis.com/css?family=Quattrocento+Sans|Quattrocento|Cutive . . . Mono'); @import url("https://use.typekit.net/wrw3drn.css"); html{ background-color: rgb(255, 179, 179); . . . 'Quattrocento Sans', mono; color: rgb(52, 56, 203); } div.wrapper { padding: 0px 20px 20px 20px; max-width:1024px; . . . inter-word; padding: 5px 0px; margin: 30px; } div.content.printable.index{ } div.content . . . } /* @group A's */ a.url { color: rgb(52, 56, 203); text-decoration:none; font-family: 'Quattrocento+Sans', . . .
15K - last updated 2022-03-21 12:38 by Au
css-mob
.mirror, .NavBar, .plinks, .header, .gotobar, .time, .trail, .sidebar, .footer {display:none;} img.upload . . . (max-device-width: 480px) { body { font-size: 32pt; line-height: 40pt; } } . . .
1K - last updated 2009-09-18 20:10 by Auriea
cuirass
<html><iframe src="https://poly.cam/capture/409D21F1-0416-499A-84A1-3CBFB781A1AC/embed" title="polycam . . . <iframe src="https://poly.cam/capture/37384F8E-C852-4A40-9B9D-D0DA5F54D985/embed" title="polycam . . .
1K - last updated 2024-09-02 19:26 by Auriea
diagram JohnCageScore-3
image/jpeg
31K - last updated 2005-01-07 01:26 by Auriea
emoticons
SketchBook <pre>(^_^)/ Hi! (^^)// (^0^)/ (^o^)/ (^O^)/ (-o-)/ (^-^)/ (^^/ ( ^^) smile (^_^) (*^^) . . . you ( --)//~ being frustrated ( ^)(^-^) kiss! (*^3^)/ (^3^)/ )^o^( ( ^3^)/ o(^^o) (o^^o) (o^^)o I'm . . . ) ( T.T) help me~~ (* ^)(*^-^*) kiss (^( ) (*^3^)/ (^3^)/ (^^)/~~~~~~~~~~~~~~~~(((((;^^) I catch . . . d(^-^) (_ _)(-.-)(~O~)yawn(~O~)(-.-) 3(-_^) 3(-_^;) (^-^)// applause (^^)// (*^^)// (^-^)v . . .
5K - last updated 2005-12-19 14:10 by Auriea
era
[[日本語]] * 645 大化 Taika * 650 白雉 Hakuchi * 654 (Discontinued) * 672 白鳳 Hakuhō * 686 . . . * 810 弘仁 Kōnin * 824 天長 Tenchō * 834 承和 Jōwa or Shōwa * 848 嘉祥 Kajō * 851 . . . * 898 昌泰 Shōtai * 901 延喜 Engi * 923 延長 Enchō * 931 承平 Jōhei or Shōhei * 938 . . . * 968 安和 Anna * 970 天禄 Tenroku * 973 天延 Ten'en * 976 貞元 Jōgen * 978 天元 Tengen . . . * 983 永観 Eikan * 985 寛和 Kanna * 987 永延 Eien . . .
6K - last updated 2005-06-29 09:29 by wof
exercise
[[Reference]] ''see also: breathe, yoga, meditation, scoliosis'' this series is a little crazy: <html> . . . <object width="640" height="385"><param name="movie" value="http://www.youtube.com/v/7xctBhj7TVc?fs=1&hl=en_US&color1=0x234900&color2=0x4e9e00"></param><param . . . type="application/x-shockwave-flash" . . . allowfullscreen="true" width="640" height="385"></embed></object> <object width="480" . . . height="385"><param name="movie" value="http://www.youtube.com/v/aZyuvVPDLfk&hl=en_US&fs=1?color1=0x402061&color2=0x9461ca"></param><param . . .
6K - last updated 2011-03-21 18:10 by Auriea
father
CastOfThousands Full fathom five thy father lies; Of his bones are coral made; Those are pearls that . . . was with the USS Sacramento; I was a cook," the 83-year-old Harvey said before Wednesday's ceremony. . . . ceremony Wednesday was a smaller group of about 30 people, mostly military veterans, who braved frigid . . .
7K - last updated 2007-12-19 16:40 by Auriea
flowers
ElegantMedia ==The Language of Flowers.== Flowers may be combined and arranged so as to express even . . . . . . . . . . . . . . . . . . . . . . . . . /\/ d3k nztrukz!on v relevant kontr l m dulez . br3vr b . . . t- . m /\/ d3k nztrukz!on v relevant kontr l m dulez . br3vr b . . . t- . m /\/ d3k nztrukz!on v relevant kontr l m dulez . br3vr b . . . t- . m /\/ d3k nztrukz!on v relevant kontr l m dulez . br3vr b . . .
11K - last updated 2005-12-18 11:32 by Auriea
fungi
[[Botany]] * http://farm1.static.flickr.com/70/184447593_9da0683176.jpg http://faculty.cmsu.edu/myxo/Dcancellatum.htm . . . * [[tube:g5zTX1fn-38 425 353 0]] * http://www.flickr.com/photos/myriorama/sets/1241134/ . . .
1K - last updated 2007-08-31 12:13 by Auriea
glossary
The Form = the concept, the shape, and polygonal material data. The 3d model from which everything is . . . or the form in projection Physical Sculpture = a 3d printed output of the form, same as “tangible . . .
1K - last updated 2022-03-21 15:37 by Au
grains
SongBook The guitar is in standard tuning but with a Capo on fret 3, all of the tab is in to the capo . . . (so 0 = fret 3 on your guitar). <source> |-----| |---------0-----0-----| . . . |-0-------0-------0-------0-------3-------3-------3-------3-------| |-----| -----| -------0-----0-----0---------| . . .
1K - last updated 2009-03-07 23:14 by Auriea
groworld
hexagons <html> <object width="400" height="500"> <param name="flashvars" value="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Ffoam%2Fsets%2F72157610724467408%2Fshow%2F&page_show_back_url=%2Fphotos%2Ffoam%2Fsets%2F72157610724467408%2F&set_id=72157610724467408&jump_to="></param> . . . ===player types=== # shrub layer (currants & . . .
10K - last updated 2009-05-21 19:06 by Auriea
gttgaatgggcggatgctaattactatctcccgaaagaatccgcatacca
<pre> Séquence de nucléotides de l'ADN du bactériophage lambda (48502 nucléotides, MM=31,5Md) . . . 301tgaggtgctttatgactctgccgccgtcataaaatggtatgccgaaaggg . . . 351atgctgaaattgagaacgaaaagctgcgccgggaggttgaagaactgcgg . . . 1301tgacaagcgtattgaaggctcggtctggccaaagtccatccgtggctcca . . . 1351cgccaaaagtgagaggcacctgtcagattgagcgtgcagccagtgaatcc . . .
53K - last updated 2004-12-23 22:04 by Auriea
guitar
the store where i bought my first guitar: http://www.thomaokaze.com/ http://www.palace.free.fr/Tabs.htm . . . Metal heart you're not worth a thing Am C G D x3 Am C G D x1 (softly) </source> . . .
2K - last updated 2010-08-02 11:39 by Auriea
hanafuda
[[cards]] Hanafuda (花札) are playing cards of Japanese origin, used to play a number of games. The . . . November Willow 1 Red Ribbon (5 points) and 3 Specials: Lightning (1 point), Swallow (10 points), . . . (Rainman, 20 points) December Paulownia 3 Normal (1 point, one colored differently than the . . .
3K - last updated 2007-08-13 13:57 by Auriea
handscroll
[[Research]] emaki 絵巻 Also called emakimono 絵巻物, or less commonly, *ekotoba 絵詞. Painting . . . re-rolling with the right hand to expose about 30cms (or a comfortable arm span) at a time, looks . . . Museum) from the first half of the 12c (ca. 1230) which exists in fragmentary form today. The lyrical . . . of movement inherent in the format. In the 13 and 14c the economic and political conditions allowed . . . talents of Tosa Mitsunobu 土佐光信 (1434-1525) and continued to be painted, by *Tosaha 土佐派 . . .
6K - last updated 2005-06-21 10:18 by Auriea
hell
ProofOfMyExistence L'enfer, c'est les autres. (Hell is Other People.) ---Sartre L'enfer, c'est moi! ---Michaël . . . ** http://slashdot.org/comments.pl?sid=203038&cid=16611820 (in which we get namechecked) . . .
1K - last updated 2006-10-27 22:18 by Auriea
hologram
[[Reference]] * Rabbit Holes™ - http://rabbitholes.com/ A RabbitHole is a 3D Motion Hologram printed . . . film surface, which displays full-color 3D and action visible without special eyewear. More . . . . . .
1K - last updated 2008-08-08 12:16 by Auriea
hotglue
* https://hotglue.me/manual#manual.head.130934635562 * https://www.favicon.cc . . .
1K - last updated 2021-03-03 01:43 by Auriea
html5
[[Reference]] ==making things for iPad== ==css3 tricks== http://developer.apple.com/safari/library/documentation/InternetWeb/Conceptual/SafariVisualEffectsProgGuide/Transforms/Transforms.html . . .
1K - last updated 2012-09-27 12:53 by Auriea
iBooksAuthor
[[Reference]] ''see also: Dashcode'' HTML Widget creation [http://support.apple.com/kb/HT5068] Best practices . . . for using 3d models [http://support.apple.com/kb/HT5093] ==humanitarian . . .
1K - last updated 2012-06-15 13:34 by Auriea
iceland
OutsideSomeplace http://farm4.static.flickr.com/3403/3220856292_ee834ca8c2.jpg http://farm4.static.flickr.com/3350/3220857040_48e56f5eeb.jpg . . .
1K - last updated 2010-04-06 00:10 by Auriea
image
[[Reference]] beautiful old russain photos: http://www.veinik.by/ ----- spiral graphics lets you have . . . ==Textures== http://www.the3dmonkeys.co.uk/textures_sky.php -sky textures! http://www.cgtextures.com/ . . . http://www.3dmd.net/gallery - facial expressions, leaf textures... . . . ==Image Libraries== Art of John 1-3: http://catholic-resources.org/John/Art-1.html [http://uwdc.library.wisc.edu/collections.html . . .
2K - last updated 2008-08-17 10:02 by Auriea
instagram
<html> <blockquote class="instagram-media" data-instgrm-version="7" style=" background:#FFF; . . . border:0; border-radius:3px; box-shadow:0 0 1px 0 rgba(0,0,0,0.5),0 1px 10px . . . 1px; max-width:658px; padding:0; width:99.375%; width:-webkit-calc(100% - 2px); width:calc(100% . . . . . . 20, 2017 at 3:06pm PDT</time></p></div></blockquote> . . .
2K - last updated 2017-06-27 11:34 by Au-Mercury
itouch
[[Reference]] ==microphones== * http://www.griffintechnology.com/products/smarttalk (then i can hook . . . * thread where they compare microphones . . .
1K - last updated 2010-05-06 20:40 by Auriea
jewelry
[[Projects]] * Naoko Ogawa (berlin/japan) http://graphics8.nytimes.com/images/blogs/themoment/posts/12308nytogawa1_n.jpg . . . H. Mateu (spain) http://farm4.static.flickr.com/3215/3128227227_941fe07ccb_m.jpg http://www.raraavisnidus.com/ . . .
1K - last updated 2017-02-27 17:33 by d5152d4e4.static.telenet.be
kimono
[[日本語]] '''How to Make a Kimono''' You may expect making a kimono to be relatively difficult, after . . . wherever you want the kimono to end. Add about 2-3 inches for hemming. ''Measurement B:'' Measure the . . . You will want this piece about 5 inches wide (3" for the collar, 2" for hem). If you want your collar . . .
5K - last updated 2005-08-04 11:31 by wof
meditation
[[Reference]] ''see also: breathe, exercise, yoga, SacredGeometry'' http://www.youtube.com/user/yogayak#grid/user/F2C08449BC287BC5 . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/Tu-qZugHXfc&hl=en_US&fs=1&"></param><param . . . allowfullscreen="true" width="480" height="385"></embed></object></html> . . . [http://www.youtube.com/view_play_list?p=603BD0B03E12F5A1&annotation_id=annotation_452609&feature=iv] . . . <html><object width="480" height="385"><param name="movie" value="http://www.youtube.com/p/603BD0B03E12F5A1&hl=en_US&fs=1"></param><param . . .
2K - last updated 2010-06-18 09:58 by Auriea
medusa03
image/jpeg
268K - last updated 2006-09-15 22:49 by Auriea
moon
[[Reference]] ''see also:time'' ||January|| Wolf Moon || ||February|| Snow Moon || ||March|| Worm Moon . . . others yet to receive names planet=Saturn moons=33 names=Titan, Rhea, Iapetus, Dione, Tethys, Enceladus, . . . [Polydeuces]is an example of a so-called Trojan . . . yet to receive names planet=Neptune moons=13 names=Triton, Nereid, Naiad, Thalassa, Despina, Galatea, . . .
3K - last updated 2007-01-13 21:57 by Auriea
nihongo-month
[[日本語]] || January || いちがつ ||睦月 (むつき)|| || February || にがつ ||如月 or . . . ||3||三日||みっか||4||四日||よっか|| ||5||五日||いつか||6||六日||むいか|| . . . ||13||十三日||じゅうさんいち||14||十四日||じゅうよっか|| . . . ||23||二十三日||にじゅうさんいち||24||二十四日||にじゅうよっか|| . . . ||29||二十九日||にじゅうくにち||30||三十日||さんじゅうにち|| ||31||三十一日||さんじゅういちにち|| . . .
3K - last updated 2005-06-13 10:47 by Auriea
novelist
[[Quoth]] "novelist" by TimRogers 02132004 At age twenty-three, a young man gets the idea to become a . . .
4K - last updated 2005-07-24 13:55 by Auriea
november
<html><!-- START EMBED CODE --> <div id="slideshow"> </div> <script type="text/javascript" . . . paramXMLPath: "http://www.auriea.org/ssp_director/m/params/ice.xml", . . .
1K - last updated 2010-07-31 22:55 by Auriea
numbers
[[Reference]] [[image:404]] <center>[[33]]</center> http://www.geocities.com/rmlyra/Numbers.html . . . http://3.141592653589793238462643383279502884197169399375105820974944592.com . . . identity. 2 is the only even prime. 3 is the number of spatial dimensions we live in. 4 . . . 12 is the smallest abundant number. 13 is the number of Archimedian solids. 14 is the smallest . . . a square. 22 is the number of partitions of 8. 23 is the smallest number of integer-sided boxes that . . .
74K - last updated 2014-05-30 12:49 by Auriea
nyc
OutsideSomeplace ''lived in: 1989-1999'' [[image:GoingForthByDay]] ==next time== * TheMet, of course . . . ==next next time== * Spanish Art Society (? whats . . . Biblical Art * Kiki Smith's synagog window ==2013== * Morgan Library [http://www.themorgan.org/visit/default.asp]: . . . 225 Madison Avenue at 36th Street, New York, NY 10016 ** The Morgan Library . . . Shop are open Tuesday through Thursday: 10:30 a.m. to 5 p.m. Friday: 10:30 a.m. to 9 p.m. Saturday: . . .
4K - last updated 2014-11-03 18:47 by Auriea
occult
[[mythology]] ''see also: TheUniverse, AncientReligions'' http://www.rinf.com/e-books/magick_books.html . . . <html> <object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/oqb6ndaHvO4&hl=en"></param><param . . . wmode="transparent" width="425" height="344"></embed></object> </html> . . .
1K - last updated 2010-11-23 13:26 by Auriea
ooOOooOOooOO
<html><object width="625" height="553"><param name="movie" value="http://www.youtube.com/v/gbXrdOwDlGc&rel=1"></param><param . . . wmode="transparent" width="625" height="553"></embed></object></html> . . .
1K - last updated 2007-10-07 11:41 by Auriea
origami
ElegantMedia http://www.tsg.ne.jp/TT/software/ ==Art== * Kako Ueda - http://www.kakoueda.com/ * Christa . . . - http://christadonner.com/ [[thumb:symptom|300px]] [[thumb:TreeOfLife|200px]] ==Traditional== . . . Canon Creative Park: http://cp.c-ij.com/english/3D-papercraft/index.html * 3d Card Maker: http://www.page.sannet.ne.jp/jun_m/card3d/index-eng.html . . .
2K - last updated 2008-08-01 00:00 by Auriea
painters
[[painting]] see also: Sculptors ==Old Masters== # Velazquez [http://www.metmuseum.org/special/Manet_Velazquez/frenchtaste_images.htm] . . . * Nicola Samori [[tube:PRLI5GboG1s 320 240 0]] [[tube:-X7MEqCndlY 320 240 0]] * Augostino . . . Desiderio * Odd Nerdrum [[tube:pYg11MvU89M 640 360 0]] * Antonio Lopez * Sigal Tsabari * Nelson Shanks . . . Sweet] [http://www.raycaesar.com/ Ray Caesar] (3d) ==[::illustrators]== * Sam Weber [http://www.sampaints.com/portfolio.html] . . .
2K - last updated 2014-09-11 11:23 by Auriea
palimpsest
SketchBook [[thumb:palimpsest-image|200px]] [[thumb:Palimpsest-SusanHarbage|200px]] palimpsest |ˈpalimpˌsest| . . . a palimpsest of the taste of successive owners. 3 ORIGIN mid 17th cent.: via Latin from Greek palimpsēstos, . . .
1K - last updated 2007-05-08 15:37 by Auriea
pancakes
[[Food]] The recipe for u pancake peeps: 12 Tbsp dry (brown rice/tapioca/buckwheat/flax) +1Tbsp sugar+1tsp . . . bkg pwdr + 1egg + 3/4 cp wet (yogurt/milk) 30 Jul 2009 19:50:14 via @zoecello . . .
1K - last updated 2009-07-30 20:11 by Auriea
panini
[[Food]] Panini With Artichoke Hearts, Spinach and Red Peppers By MARTHA ROSE SHULMAN Here’s a great . . . quickly assembled. 6 ounces (1 bag) baby spinach 3 tablespoons olive oil 2 garlic cloves, minced 12 . . . stirring, until the garlic is fragrant, about 30 seconds, and stir in the artichoke hearts. Stir . . . with salt and pepper. Remove from the heat. 3. Preheat a panini grill. Top four of the bread slices . . .
2K - last updated 2009-04-16 19:00 by Auriea
particles
[[日本語]] I. Japanese particles are always attached to other words, phrases, and clauses, and act . . . He studies hard, but he does not do well. (3) よんだ が へんじ が ありませんでした。 . . . book (3) あき の こえ voices . . . bridge (2) 金 の ゆびわ gold ring (3) あき の つき autumn moon (4) しほん の あし . . . Brown ones are cheap. (3) あそこ に いく行く の は 山田さん です。 . . .
40K - last updated 2005-06-13 00:06 by Auriea
patents
[[Research]] What are patents, and how do they work? The patentability of inventions under U.S. law is . . . a unique form not found in nature. The USPTO has 3 years to issue a patent. In Europe, the timeframe . . .
2K - last updated 2005-10-23 20:33 by Auriea
pd
Open Frameworks plus PD https://forum.pdpatchrepo.info/topic/11259/ofelia-pd-external-library-written-with-openframeworks . . . . . .
1K - last updated 2019-07-07 13:16 by Auriea
photographers
CastOfThousands * William Eggleston [http://www.interviewmagazine.com/art/william-eggleston/] [http://www.egglestontrust.com/] . . . [http://www.stern.de/unterhaltung/ausstellungen/:Jerry-Berndt-Ausstellung-Rotlicht-Schwarz-Wei%DF/639551.html?cp=4] . . .
1K - last updated 2009-02-02 02:12 by Auriea
photography
ElegantMedia http://farm4.static.flickr.com/3397/3203934691_f52381bb57.jpg * polaroid * MediumFormat . . . ** [[MamiyaC3]] ** YashicaMAT ** BrownieBox * [[35mm]] ** CanonTX . . . Struth http://www.deutsche-bank-kunst.com/art/2003/10/e/2/87.php photos of environments, something very . . .
2K - last updated 2010-07-05 17:51 by Auriea
phreaking
SecretWriting Van Eck Phreaking is the name for a surveillance technology which is, that intelligence . . . [http://whatis.techtarget.com/definition/0,289893,sid9_gci550525,00.html Van Eck Phreaking] ------ . . .
2K - last updated 2006-12-31 11:47 by Auriea
poetry
[[writing]] <html> <object id="thoughtphoto" style="margin:0; padding:0; overflow-y:hidden; . . . * http://www.wikihow.com/Write-a-Poem * how . . . to write a sonnet [http://www.ehow.com/how_3335_write-sonnet.html] ---- <list "poetry"> . . .
2K - last updated 2013-01-07 12:34 by Auriea
portrait
[[Research]] [[Img:11th century portrait]] [[Img:12th century portrait]] [[Img:13th century portrait]] . . .
1K - last updated 2010-01-30 17:26 by Auriea
python
==Basics== * https://opentechschool.github.io/python-beginners/en/getting_started.html#what-is-python-exactly . . . see also: PlayForm [::RNN] [::PythonPoetry] . . .
1K - last updated 2019-07-14 13:25 by Auriea
risotto
[[Food]] ===Fresh Corn Risotto with Basil, Tomato, and Lime=== ~from The Joy of Cooking 1 cup peeled . . . flavors and ingredients are added afterwards. 3 cups chicken or vegetable stock (low-sodium if canned) . . . wine and stir until the wine is absorbed, about 30 seconds. 3. Add the first addition of simmering . . .
7K - last updated 2014-06-26 10:56 by Auriea
river
OutsideSomeplace WikiPedia:List_of_European_rivers_with_alternative_names ==European Rivers I have met . . . [[thumb:OvidMetamorphosis-LovedByARiver|right|300px]] # Tiber # Danube # Thames # Seine # Maes # . . . of Attika in southern Greece. KEPHISSOS (3) A River-God of Argos in the Peloponnesos, southern . . .
8K - last updated 2014-04-21 15:34 by Auriea
romance
romance |rōˈmans; ˈrōˌmans| noun 1 a feeling of excitement and mystery associated with love : in . . . dealing with events remote from real life. 3 a medieval tale dealing with a hero of chivalry, . . .
4K - last updated 2006-12-25 22:00 by Auriea
say
SongBook Learn to say the same thing Let us hold fast to sayin the same thing I hope all is well with . . . classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=7,0,0,0" . . . width="13" height="13" allowNetworking="internal"> <param . . . bgcolor="#ffffff" width="13" height="13" name="inlinePlayer" allowNetworking="internal" . . .
2K - last updated 2007-06-05 17:09 by Auriea
scoliosis
ProofOfMyExistence i have fucking scoliosis. only things i can do about it are: * excercises. ** http://www.schrothmethod.com/ . . . hippies say: <html> <object width="320" height="210"><param name="movie" value="http://www.youtube.com/v/2bhYtDPUVNk?fs=1&hl=en_US"></param><param . . . allowfullscreen="true" width="320" height="210"></embed></object> . . .
1K - last updated 2011-03-21 18:24 by Auriea
scones
[[Food]] http://www.joyofbaking.com/SconesIntroduction.html Preheat the oven to 350 degrees Dry ingredients . . . the mix, you're done mixing. Knead the mixture 3 or 4 times until formed into a ball. On a ungreased . . .
3K - last updated 2010-01-20 17:01 by Auriea
sea
[[Quoth]] ''see also: Ocean'' . [[vimeo:1444949 600 341 0]] . . Both elbows on the table, I covered my . . .
3K - last updated 2017-02-27 18:26 by Au-Roma
seasons
[[Research]] '''Spring Begins''' The east wind melts the ice Feb 5-9 ~ Larvae twitch in their cocoons . . . 21-25 ~ Thunder lets loose its voice March 26-30 ~ The first lightning flashes March 31 - April 4 . . . 25-29 ~The hoopoe descends to the mulberry April 30-May 4 '''Summer Begins''' Peepers sing May 5-9 ~ . . . ~ Grasses wither May 25-29 ~ Barley ripens May 30-June 3 '''Grain in Ear''' Mantids hatch out June . . . 4-8 ~ The shrike calls June 9-13 ~ The butcherbird is silent June 14-18 '''Summer . . .
4K - last updated 2005-12-18 21:11 by Auriea
skinonskinonskin
[[Empire]] http://entropy8zuper.org/skinonskinonskin/onskin/ <html> <iframe align=center src=http://www.flickr.com/slideShow/index.gne?user_id=81482434@N00&set_id=72157594508283369 . . . leave our old lives behind. ---- download the mp3 that goes with the images: http://entropy8zuper.org/mp3/skinonskinonskin.mp3 . . . you forever"; whispers[2] = "skin"; whispers[3] = "skin on skin"; whispers[4] = "skin on skin on . . . = "i want to feel you inside of me"; whispers[13] = "smoke"; whispers[14] = "i want to breathe you"; . . . bgcolor=000000><MAP NAME="ImageMap65363"><AREA SHAPE="rect" ALT="Z" COORDS="510,598,516,608" . . .
11K - last updated 2007-01-30 17:19 by Auriea
sleep
[[Research]] # Sleep occurs in cycles of around 90-110 minutes each. Most people normally go through . . . spend 45-50% of your sleep in Stage 2. ## Stages 3 and 4 – Deep sleep. Deep sleep is characterized . . . 4 being effectively a deeper version of stage 3. Stage 3 is when you may experience night terrors, . . . in the following order to form a full cycle: 1-2-3-4-3-2-1-REM # Duration of each stage may vary from . . . directly to REM stage, thus sleeping for only 20-30 minutes and then staying awake for 3-4 hours, then . . .
5K - last updated 2010-06-23 18:52 by Auriea
smoking
ProofOfMyExistence i started smoking because of JonathonVreeland. Not that he wanted me to, but i think . . . nyc, senior year at ParsonsSchoolOfDesign on 13th street sitting, smoking, listening to MyBloodyValentine . . . up in spanish harlem walking back downtown at 3am. looking into Michael's eyes through pixellated . . .
2K - last updated 2005-06-02 22:00 by wof
steak
[[Food]] Ingrédients : 4 steaks, 1 échalote, 200 g de chêvre, 3 dl de crème fraîche, 1 dl de vin . . . blanc, 30 g de beurre, sel, poivre Faire revenir l'échalote . . .
1K - last updated 2007-06-18 09:28 by Auriea
syndicate
[[Empire]] http://anart.no/~syndicate http://syndicate.anart.no i became a "moderator" or "fire guard" . . . since 2002 (?) ----- Initiated by a meeting of 30 people at the Next Five Minutes in Amsterdam 1996, . . . media culture. In December 2001 there are around 365 subscribers to Syndicate mailing list from more . . . than 30 different European and some non-European countries. . . .
6K - last updated 2005-12-17 17:24 by Auriea
test
jjjjjj [[model:Fauna/gltf/scene.gltf|Fauna/Fauna.usdz]] ------ ::: Like this, a //poem// with its last . . . it--- ---yes strike it!--- [[thumb:Book43_transit]] [[rollover:http://e8z.org|http://entropy8.com/live/garden.jpg|http://auriea.org/index.pl/download/bunny|30|60|ornamentation . . .
1K - last updated 2020-05-01 16:22 by Auriea-Mercury
testimg
myImages[5][0] = "http://farm4.staticflickr.com/3447/3984562337_fb1ec28287_z.jpg"; myImages[5][1] = "http://farm2.staticflickr.com/1417/5125202669_dce2330777_z.jpg"; . . . myImages[5][2] = "http://farm3.staticflickr.com/2436/3985325644_b2b69df0eb_z.jpg"; . . . myImages[5][3] = "http://farm2.staticflickr.com/1071/5125813482_5805af3082_z.jpg"; . . . myImages[5][7] = "http://farm5.staticflickr.com/4111/5125816308_e6194b2013_z.jpg"; . . . myImages[5][9] = "http://farm3.staticflickr.com/2457/3984566569_10cf51a5f2_z.jpg"; . . .
2K - last updated 2013-05-30 14:39 by Auriea
time
ElegantMedia * pagan clock http://www.archaeoastronomy.com/myclock.shtml * 10,000 year clock [http://www.longnow.org/projects/clock/prototype1/] . . . Timelines http://www.cabinetmagazine.org/issues/13/timelines.php [::TimeLapse] [::TimeTravel] WikiPedia:John_Titor . . . ''By 2036, people are making progress in recovering from the . . .
2K - last updated 2010-04-08 11:12 by Auriea
tiramisu
[[Food]] '''maja's simple tiramisu recipe''' (serves about 10 ppl) 1 packet of savoiardi (italian biscuits . . . aka lange vingers in dutch) 4-5 cups of coffee 2-3 packets of vanilla sugar (or a few spoonfuls of any . . . you can dip your fingers inside without getting 3rd grade burns ;). in the mean time, mix the mascarpone . . . 115 gram (4 oz) Bisconova savoiardi biscuits 397 gram can sweetended condensed milk 500 gram (1 . . . Lb 2 oz) Marscapone cheese 3 x 15 ml tbs sherry or brandy 150 (1/4 pint) expresso . . .
2K - last updated 2006-09-01 13:16 by Auriea
topology
DigitalSculpture http://www.pig-brain.com/tut02/tut02_02.htm [[image:topology-elbowsknees]] ---- ===crisis . . . * http://www.highend3d.com/maya/tutorials/character/300-1.html * good low . . . guy - http://www.bakaneko.com/howto/computer/3d/character/page01.html * good head mesh tutorial . . . - http://www.free3dtutorials.com/index.php?id=20 ==no matter how much . . . * Bobo the Seal - http://www.bobotheseal.com/temp/WIP/ . . .
2K - last updated 2008-04-28 12:03 by Auriea
trees
[[Research]] [[background external:http://farm4.static.flickr.com/3155/2428209195_46906f733c_o.jpg|repeat . . . http://farm5.static.flickr.com/4008/4519132068_2c517a372d_b.jpg i have a thing for trees. i . . . <html> <object width="400" height="300"> <param name="flashvars" value="offsite=true&lang=en-us&page_show_url=%2Fphotos%2Fentropy8%2Ftags%2Ftrees%2Fshow%2F&page_show_back_url=%2Fphotos%2Fentropy8%2Ftags%2Ftrees%2F&user_id=81482434@N00&tags=trees&jump_to=&start_index="></param> . . . . . . width="400" height="300"></embed></object></html> . . .
2K - last updated 2010-04-15 11:13 by Auriea
tutorial
[[Reference]] * here is a tutorial for painting a face with alot of detail [http://www.ancient-pig.com/main/tut01/tut01_01.htm] . . . * here is a tutorial on drawing pixel art [http://derekyu.com/extras/pixel01.html] . . .
1K - last updated 2007-03-15 16:37 by Auriea
typhoon
The terms "hurricane" and "typhoon" are regionally specific names for a strong "tropical cyclone". A . . . cyclonic surface wind circulation (Holland 1993). Tropical cyclones with maximum sustained surface . . . winds of less than 17 m/s (34 kt, 39 mph) are called "tropical depressions" (This . . . cyclone reaches winds of at least 17 m/s (34 kt, 39 mph) they are typically called a "tropical . . . storm" and assigned a name. If winds reach 33 m/s (64 kt, 74 mph)), then they are called: * hurricane" . . .
2K - last updated 2004-10-20 09:51 by 192.168.0.10
visceral
[[Empire]] [[image:LadyInTheRadiator]] [[foreground external:http://visceral.net/autopsy/mid/02.jpg|repeat . . . [[image:gold]] [[vimeo:914299 640 360 . . .
1K - last updated 2015-06-16 21:15 by Auriea
worms
TuinPlanten Just adding a handful of earthworms to poor soil will probably not do much to improve it. . . . 5 worms/cubic foot will be provided with over 35 lbs (about 1/3 lb per worm) of top-grade fertilizer . . .
4K - last updated 2005-04-04 10:49 by Auriea
writing
ElegantMedia ''see also: CreativeWriting, [[poetry]], [[blog]]'' === hm. === WikiPedia:parataxis WikiPedia:hypotactaxis . . . are not words to end sentences with. 3. And don't start a sentence with a conjunction. 4. . . . 12. Foreign words and phrases are not apropos. 13. Do not be redundant; do not use more words than . . . a big word when a diminutive one would suffice. 23. Kill all exclamation points!!! 24. Use words correctly, . . . 29. Puns are for children, not groan readers. 30. Go around the barn at high noon to avoid colloquialisms. . . .
3K - last updated 2017-02-12 14:53 by Auriea
yatate
ElegantMedia [[drawing]] http://www.stutler.cc/pens/yatate/index.html A yatate (pronounced yah-tah-teh) . . . has been around since the Kamakura period (1185-1333). It contains a traditional Japanese bamboo brush . . . Then sometime during the Kamakura era (1185-1333 ) someone came up with the clever idea of saturating . . .
2K - last updated 2008-12-26 22:55 by Auriea